ID: 933743294

View in Genome Browser
Species Human (GRCh38)
Location 2:85551875-85551897
Sequence ACTTGGCCCTCCAGGGAGAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933743289_933743294 16 Left 933743289 2:85551836-85551858 CCTCAGTGTGGTTGTCTAGGCTG 0: 1
1: 0
2: 1
3: 15
4: 131
Right 933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG 0: 1
1: 0
2: 0
3: 15
4: 194
933743287_933743294 19 Left 933743287 2:85551833-85551855 CCACCTCAGTGTGGTTGTCTAGG 0: 1
1: 0
2: 0
3: 17
4: 109
Right 933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG 0: 1
1: 0
2: 0
3: 15
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933743294 Original CRISPR ACTTGGCCCTCCAGGGAGAC AGG Exonic
900570607 1:3356415-3356437 AATCTGCCCTCCGGGGAGACGGG + Intronic
901220000 1:7578337-7578359 CCTGGGTCCTCCAGGGAGCCGGG + Intronic
903886932 1:26546139-26546161 GCCTGGCCCTGCAGGGTGACTGG + Intronic
905016305 1:34781275-34781297 ACCTCGGCCTCCAGGGAGGCCGG - Exonic
906606856 1:47178957-47178979 ACCTCTCCCTCCAGGGATACGGG + Intergenic
907462561 1:54613726-54613748 AATTAGCACTCCAGGAAGACAGG + Intronic
907602547 1:55785436-55785458 ACTTGGCCTTCAATGGAGTCAGG + Intergenic
911845576 1:102747363-102747385 AATTGACCCTCCAGGGAGTCAGG + Intergenic
912581783 1:110727541-110727563 ACTGAGCCAGCCAGGGAGACAGG + Intergenic
916083713 1:161253152-161253174 AATTGACCCTCGAGGGAGTCAGG - Intergenic
917086170 1:171307590-171307612 AATTGACCCTCAAGGGAGTCAGG - Intergenic
917279917 1:173370589-173370611 AATTGACCCTCAAGGGAGTCAGG - Intergenic
917281204 1:173379501-173379523 AATTGACCCTCAAGGGAGTCAGG - Intergenic
917495949 1:175540360-175540382 ATCTGGCCCTCCTGGGAGTCTGG - Intronic
920166895 1:204042389-204042411 ACTTGGTCCTCCAGGAACCCTGG + Intergenic
920607949 1:207408557-207408579 ACTTGTCCCTCCAGTGATCCTGG + Intergenic
920913268 1:210237018-210237040 CCTTGGGCCTGCAGGGAGATGGG - Intronic
1063371774 10:5526903-5526925 ACTGGGACCTCCAGGATGACAGG + Intergenic
1065082459 10:22141528-22141550 AATTGACCCTCCAGTGAGTCGGG - Intergenic
1065458925 10:25934953-25934975 AGGGGGCCCTGCAGGGAGACTGG + Intronic
1067689235 10:48490708-48490730 GATGGGCCCACCAGGGAGACTGG - Intronic
1068142747 10:53027575-53027597 AGTTGGCCTTCCAGGGAATCTGG + Intergenic
1068841927 10:61625104-61625126 ACTTGTCACTCCAGAGATACTGG + Intergenic
1069673856 10:70233272-70233294 ACTCGGTACTCCAGGGAGAAGGG + Exonic
1069855639 10:71439547-71439569 TCTTTGCCCTCCTGGGGGACTGG - Intronic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1072705585 10:97678551-97678573 AAGTGGCCCACCAGGGAGACTGG + Intronic
1072854889 10:98936318-98936340 ACTTGGAACTCTAGTGAGACAGG - Intronic
1074157653 10:110812464-110812486 CGTTGTCCCTCCAGGGAGCCGGG - Exonic
1074976798 10:118587577-118587599 ACCTCGCCCTCCAGGGACAGAGG + Intergenic
1075224731 10:120618048-120618070 ACTAGGGCCTGCAGGGAGAGAGG + Intergenic
1075791495 10:125087505-125087527 CCTTTGCCCTTCAGGGGGACTGG - Intronic
1077251395 11:1562208-1562230 ACTCTGGCCTCGAGGGAGACAGG + Intronic
1078356436 11:10635442-10635464 ATTTGGCCCACCAGGGAAAGTGG - Intronic
1081570375 11:44286935-44286957 CCTTGGCCCTCCAGAGAGGGTGG + Intronic
1081944934 11:46983565-46983587 TCTTTGCCCTCCAGGGATGCAGG + Intronic
1084564301 11:69920612-69920634 ACCTGGACCTCCTGGGGGACTGG - Intergenic
1084768161 11:71325744-71325766 ATATGGCCCTCCAGGGAGGTTGG + Intergenic
1085348434 11:75782903-75782925 AATTGGACAGCCAGGGAGACTGG - Intronic
1086112855 11:83218074-83218096 AGTTGGCCTTCCAGGGAATCTGG + Intronic
1086443186 11:86848605-86848627 AGTTGGCCTTCCAGGGAATCCGG - Intronic
1087238685 11:95750974-95750996 ATTTAGCCCTCCAAGGAAACTGG - Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1089163627 11:116458213-116458235 AATGGGCCCTCCAGGTGGACAGG + Intergenic
1089498210 11:118918453-118918475 ACCTTGCCCTCCAGGGCGATTGG + Intronic
1089750660 11:120648976-120648998 CCTTGGCCCCCGAGGGAGCCTGG + Intronic
1092389127 12:8059922-8059944 ACTTGGCTCTCCAGGGACAGTGG - Exonic
1096466533 12:51849808-51849830 ACTGGGAGCTCCAGGAAGACAGG - Intergenic
1096795814 12:54076976-54076998 ACTTGGGGGTCCAGGGAGCCAGG + Intergenic
1103200475 12:119083876-119083898 ACTTGGCCATGCAGAGACACAGG + Intronic
1103400542 12:120640569-120640591 ACCTGGGCCGCCAGGGAGCCGGG + Exonic
1103890996 12:124239054-124239076 ACTCTGCCCTCCAGGGAAACAGG - Intronic
1104820729 12:131675852-131675874 CCTTGCCCCTGCAGGGAGCCAGG + Intergenic
1105438859 13:20399649-20399671 GCTTGGCCCTGCATGGTGACGGG - Intergenic
1106479118 13:30123706-30123728 ACATGGCCACCCAGGGAGGCAGG - Intergenic
1106865274 13:33957828-33957850 ACCTGGCCAGCCTGGGAGACTGG - Intronic
1111396783 13:87675999-87676021 ACTTGGACCTCCGGGGGAACCGG + Exonic
1112068909 13:95825952-95825974 ACTTGGCCCTACAGGTTGGCTGG - Intronic
1113464932 13:110506419-110506441 ACCAGGCCGTCCAGGGAGCCCGG + Exonic
1113551451 13:111196053-111196075 AATTGACCCTCTAGGGAGTCGGG + Intronic
1113878925 13:113611867-113611889 ACTAGGCTCTGCAGGCAGACAGG - Intronic
1115614655 14:35083166-35083188 ACTAGTACCTCTAGGGAGACAGG - Exonic
1119022972 14:71130535-71130557 ACTTTGAACTCCAGGAAGACAGG - Intergenic
1122907490 14:104808460-104808482 ACCTGGCGCCCCAGGGAGGCTGG - Intergenic
1122986165 14:105212663-105212685 GCTGGTCCCCCCAGGGAGACAGG + Intronic
1124440907 15:29685690-29685712 AGTGGGCCCTCCAGGGAGGGAGG + Intergenic
1129233328 15:74208871-74208893 ACTTGTCCCTCCAGGCAAGCAGG + Intronic
1131249833 15:90823023-90823045 GCCTGGCCCGGCAGGGAGACAGG - Intergenic
1131411259 15:92210020-92210042 ACTTGACCCTCGAGCGAGTCAGG - Intergenic
1131979138 15:97978927-97978949 CCTTGGCCAGCCAGGGACACTGG + Intergenic
1133030724 16:3009818-3009840 ATTGGGTCCTCCAGGGAAACCGG - Intergenic
1133322901 16:4925226-4925248 AGCTGGCCCTCCAGGCAGGCAGG - Intronic
1135125919 16:19809181-19809203 ACTTTGCCCTGGAGGGAAACTGG - Intronic
1137720264 16:50623511-50623533 ACTTGGGCTTCCAGGGAGGCAGG - Intronic
1142131334 16:88432887-88432909 ACTTGGCATTTCAGGGTGACGGG + Exonic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1148000840 17:44386043-44386065 CCTCGGCCCTCCAGGGGCACAGG + Exonic
1149295684 17:55260190-55260212 AGTTGGCCCTTCAAGGAGAAAGG - Intergenic
1150210487 17:63438703-63438725 ACGTGGCCCTCCAGGAGGAAAGG + Intronic
1150463901 17:65375482-65375504 TGTTGGCCTTCCAGGGAGAAGGG - Intergenic
1152577659 17:81149863-81149885 ACATGCCCCTCCAGGTAGACTGG - Intronic
1152691444 17:81719961-81719983 ACGAGGCCCTGGAGGGAGACAGG - Exonic
1156084534 18:33382797-33382819 ACCTGGAACTCCAGTGAGACAGG + Intronic
1157124124 18:44938700-44938722 ACCTGGGCCACCAGGGAGAAAGG - Intronic
1157678325 18:49583973-49583995 ACATGGGCCCTCAGGGAGACGGG + Intronic
1160507097 18:79433291-79433313 ACTTAACCCTCCAGTAAGACAGG - Intronic
1160920992 19:1520459-1520481 TCCTGGGCCTCCAGGGAGTCGGG + Intergenic
1161234137 19:3189731-3189753 CCCTGGCCCTCGAGGGAGGCTGG + Intronic
1161297766 19:3528245-3528267 GCTAGTCCCTACAGGGAGACTGG + Intronic
1161604486 19:5207056-5207078 AATAGGGCCTCCAGGCAGACGGG - Intronic
1163633148 19:18427123-18427145 ACTTGGTCCTCGAGGGAGCGTGG + Intronic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1165497773 19:36163763-36163785 ACTTCTCCCTCCAGGCATACTGG + Intergenic
1166676084 19:44741936-44741958 TCTTGGCAGGCCAGGGAGACTGG - Intergenic
1166750485 19:45162036-45162058 CCCTGGCCCACCAGGGAGGCGGG + Intronic
926419865 2:12685838-12685860 ACCTGGCCCTTCAGGGAGGAAGG + Intergenic
926475396 2:13315041-13315063 ACCTGGAACTCCAGTGAGACAGG - Intergenic
929657440 2:43748343-43748365 AGTTTGCCCTCAAGGGAAACAGG - Intronic
932825272 2:74933390-74933412 ACGTGTCCCTTCAGGGAGAATGG - Intergenic
932886559 2:75554304-75554326 ACTTTGCCCTCCATGGTGAGAGG - Intronic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
936974181 2:118202874-118202896 ACCTGGCCCTGCAGGCACACAGG + Intergenic
938376010 2:130807195-130807217 GCTTGGCACTCCAGTGAGAAGGG + Intergenic
940546806 2:155099787-155099809 ACTTTGCCCTCCACTGGGACAGG - Intergenic
941243458 2:163069474-163069496 AGTTGGCCCTCTAGTGAGTCGGG - Intergenic
948426028 2:237887002-237887024 ACTTGGCTGTCCTGGGACACAGG + Intronic
948591655 2:239054336-239054358 CCTTGGCCCTGCAGAGAGGCAGG - Intronic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
948817662 2:240521067-240521089 ACTTGGGCCTCAAGAGAGGCTGG + Intronic
1171410325 20:24942867-24942889 ATTTTACCCTCCAGGGAGCCGGG - Intergenic
1172340690 20:34155148-34155170 AATTGGCCCTCGAGTGAGTCAGG - Intergenic
1173141971 20:40492424-40492446 AGTTGACCCTCCAGAGAGGCTGG - Intergenic
1174500502 20:50980878-50980900 ACAGGACCCTCGAGGGAGACGGG + Intergenic
1175258585 20:57661520-57661542 ACTGGGGCCCCCAGGGAGCCTGG - Intronic
1176021790 20:62965987-62966009 ACTGGGTCCTCCATGAAGACGGG + Intronic
1176069569 20:63218995-63219017 ACGTGGCCCTCCAAGGTTACAGG - Intergenic
1179080770 21:38168766-38168788 ACATGGCTGACCAGGGAGACAGG + Intronic
1179289801 21:40008514-40008536 ACTTGTCCCTCTGGGGAGTCAGG + Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1179727107 21:43346798-43346820 ACGAGGCCCTCCAGGGACAGTGG - Intergenic
1179902117 21:44399749-44399771 GCTTATCCCTCCAGGGAGAGAGG - Intronic
1180093481 21:45543849-45543871 ACCTGGCCCTGCTGGAAGACAGG + Intronic
1182008832 22:26983540-26983562 ATATTGCCCTCCAGGAAGACAGG - Intergenic
1182830811 22:33303291-33303313 ACTTGGCTCTGCAGCCAGACTGG + Intronic
1183429133 22:37755266-37755288 ACATGGCTCACCATGGAGACTGG + Intronic
1184401584 22:44277629-44277651 CCTTCGGCCTCCAGGGAGAGAGG - Intronic
1184458088 22:44622716-44622738 CCTTGGCCCTGCACAGAGACAGG + Intergenic
1184501912 22:44879554-44879576 ACTTGTGCCTCCAGGGCCACAGG - Intergenic
1184994890 22:48198495-48198517 ACGTGGTCCTCCAGGGATCCAGG + Intergenic
1185392665 22:50571076-50571098 CCCTGGCCCTCCAGGCAGACAGG + Intronic
950170846 3:10838162-10838184 ACATGGCCCTCCTGGGTGCCAGG + Intronic
950306104 3:11916092-11916114 TCTAGGCCTGCCAGGGAGACTGG + Intergenic
951545809 3:23823894-23823916 ACTTCATCCTTCAGGGAGACTGG + Intronic
952555010 3:34521586-34521608 AATTGACCCTCAAGGGAGTCAGG + Intergenic
952940910 3:38443734-38443756 AATTGACCCTCGAGGGAGTCAGG + Intergenic
954820462 3:53322200-53322222 CCTTGGCCTTCCAGGGTGCCAGG - Intronic
961057469 3:123801235-123801257 ACTTGGACCTCAAGGGACCCTGG + Intronic
963989722 3:151639191-151639213 ACGTGGCAATCCAGGGAGAAAGG - Intergenic
965058227 3:163749326-163749348 ACTTGGACCTCCAGGCATCCTGG + Intergenic
965062780 3:163804306-163804328 AATTGACCCTCGAGGGAGTCAGG - Intergenic
967050857 3:185783338-185783360 GCTAGGCCCTCCAGGGTTACAGG + Intronic
967395375 3:189002638-189002660 ACATGGAGCTCCAGGGAGAATGG - Intronic
969692269 4:8710238-8710260 ACTTGGCCCTCCAGTGGGCCGGG + Intergenic
970185398 4:13446383-13446405 ACCTGGAACTCCAGTGAGACAGG - Intronic
970652863 4:18197780-18197802 AGATGGCCCTCCAGGGAGCTTGG + Intergenic
972716069 4:41647417-41647439 ACTTGGTCCTCAAATGAGACAGG + Intronic
974814728 4:66989535-66989557 ACCTGGATCTCCAGTGAGACAGG - Intergenic
977609631 4:99018824-99018846 ACCCGGCCTTCCAGGGAGATCGG + Intronic
980097938 4:128512388-128512410 TCTTGGCATTCCAGGGAGTCTGG + Intergenic
980855199 4:138431548-138431570 ACCTGGAACTCCAGTGAGACAGG + Intergenic
981029764 4:140112667-140112689 ATTTGGCCCTGCAAGCAGACTGG - Intronic
985544038 5:500411-500433 ACGGGACCCTCCAGGGACACAGG + Intronic
985552354 5:540210-540232 GCCTGGCCCGCCAGGGAGGCAGG - Intergenic
989568611 5:42924983-42925005 ACCTGGTGCTCCAGGTAGACAGG - Intergenic
989964340 5:50450861-50450883 AATTGACCCTCGAGGGAGTCAGG + Intergenic
991994549 5:72374437-72374459 ACTGGGCCCACCTCGGAGACTGG - Intergenic
996541434 5:124633414-124633436 ACTTGCCATTCCAGGTAGACAGG + Intergenic
997475432 5:134139770-134139792 ACTTGGCTCCCCAAGGAGATCGG + Intronic
997943479 5:138179167-138179189 ACTTGCTCCTCCTGGGATACTGG - Exonic
998172954 5:139883139-139883161 ACGCGGCCTGCCAGGGAGACAGG - Intronic
999675070 5:153991352-153991374 ACTTTGCCCTCAAGGGATACAGG + Exonic
1003684106 6:8283605-8283627 AATAGCACCTCCAGGGAGACCGG - Intergenic
1005251125 6:23947366-23947388 AGATGGCCATCCAGGGATACGGG + Intergenic
1006338141 6:33431667-33431689 CCCTGGCCCTCCAGACAGACAGG + Intronic
1006838807 6:37015123-37015145 ACCTGGCACTGCAGGGGGACAGG + Intronic
1007404893 6:41629492-41629514 CCTTGTCCCTCAAGGGAGACAGG - Intergenic
1011375025 6:86678656-86678678 AACTGGCCCTCCAGTGAGTCAGG + Intergenic
1014202263 6:118620163-118620185 AGTTGGCCTTCCAGGGAATCCGG - Intronic
1022145459 7:27534467-27534489 ACTCAGCCCTCCTGGCAGACAGG - Intronic
1026983112 7:74538054-74538076 CCTTGCCCCTCCAGGCAGTCAGG - Intronic
1027501608 7:78958720-78958742 ACTAGGGCCTCCAGGTAGAACGG - Intronic
1028411285 7:90532811-90532833 AAGTGGCCCTCAAGTGAGACTGG - Intronic
1031710215 7:125035334-125035356 ACCTGCCCCTTCAGGGAGACGGG + Intergenic
1032464972 7:132138433-132138455 ACTTTCCCCTCCAGGGAGCCAGG + Intronic
1032614958 7:133458441-133458463 ACATGTCACTCCAGGGACACAGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1035287458 7:157815338-157815360 CCTTTGCCCTCCAGGGTGCCAGG + Intronic
1035595957 8:858105-858127 CCTTGGCCCTCCAGAGTGTCGGG + Intergenic
1035596844 8:865151-865173 ACCTGGCCCACCAGGACGACGGG + Intergenic
1037811850 8:22091059-22091081 GGTTGGCCCTACAGGGAGACGGG + Intronic
1037821865 8:22138949-22138971 ACCTGGTCCTCCAGGTAGAGGGG + Exonic
1038430769 8:27497661-27497683 AATTGACCCTCGAGGGAGTCAGG + Intronic
1041953368 8:63529548-63529570 AATTGGCCCACCTGGGAGCCTGG - Intergenic
1044005425 8:86931786-86931808 AATTGACCCTCAAGGGAGTCAGG + Intronic
1050919756 9:11186573-11186595 GCTTGGCCTTACAGGGAGTCAGG + Intergenic
1052289499 9:26826087-26826109 AATTGACCCTCGAGGGAGTCGGG - Intergenic
1052860876 9:33437049-33437071 CCTGGGGCCACCAGGGAGACTGG - Intergenic
1053117497 9:35518465-35518487 ACTTGCCCCATCAGGCAGACAGG - Intronic
1055458267 9:76493012-76493034 AATTGACCCTCGAGGGAGTCGGG + Intronic
1056628819 9:88275932-88275954 ATTTGGCTGTCCAGGGAGGCAGG - Intergenic
1059635212 9:116163692-116163714 ACTTGGCCCCTGAGGGTGACAGG - Intronic
1061415702 9:130445699-130445721 GCTGCGCCCTCCAGGGAGGCAGG + Intronic
1061622085 9:131817300-131817322 CCATGCCCCTCCAGGGAGAGAGG - Intergenic
1062028075 9:134349709-134349731 CCCTGCGCCTCCAGGGAGACAGG - Intronic
1062531514 9:137003053-137003075 TCTTGCCCTTCCAGGGGGACAGG - Intergenic
1062549281 9:137078444-137078466 GCCTGGCCCTGCAGGCAGACGGG - Intronic
1185825948 X:3249864-3249886 ACTTTGCCCTCAGGGGACACTGG + Intergenic
1187335438 X:18377383-18377405 ACTTGGCCCCCCAAGGAGCTGGG - Intergenic
1191766759 X:64706098-64706120 ACCTGGAACTCTAGGGAGACAGG - Intergenic
1191974223 X:66852179-66852201 ACTTTGCTCTCCACTGAGACAGG + Intergenic
1192482751 X:71499462-71499484 AATTGACCCTCGAGGGAGTCAGG + Intronic
1192798120 X:74441608-74441630 ACATGGTCCTTCAGGGAGACAGG - Intronic
1193049193 X:77083146-77083168 ACTTCTTCCTCCAGGGAGGCTGG - Intergenic
1195435948 X:104843420-104843442 ACCTGGAACTCCAGCGAGACAGG - Intronic
1196127341 X:112114065-112114087 AATTGACCCTCAAGGGAGTCAGG + Intergenic
1196464404 X:115958178-115958200 CCTTGGGCCTCCAGAGAGCCTGG + Intergenic
1199801185 X:151252842-151252864 ACCTGGAACTCCAGTGAGACAGG + Intergenic
1200238223 X:154479339-154479361 ACTGGGGCCTCCAGGGACAAGGG - Intergenic
1201253054 Y:12079981-12080003 ACTTTGCCCTCAGGGGACACTGG - Intergenic