ID: 933744585

View in Genome Browser
Species Human (GRCh38)
Location 2:85561375-85561397
Sequence CGCCCAGCTCAGGTAGGCTT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933744585_933744597 24 Left 933744585 2:85561375-85561397 CCTAAGCCTACCTGAGCTGGGCG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933744597 2:85561422-85561444 CCGCCATTGCTCTGCGGAGGAGG 0: 1
1: 0
2: 0
3: 5
4: 79
933744585_933744595 21 Left 933744585 2:85561375-85561397 CCTAAGCCTACCTGAGCTGGGCG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933744595 2:85561419-85561441 ACACCGCCATTGCTCTGCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 46
933744585_933744590 -5 Left 933744585 2:85561375-85561397 CCTAAGCCTACCTGAGCTGGGCG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933744590 2:85561393-85561415 GGGCGAGGTCCGCGCGGACCCGG 0: 1
1: 0
2: 0
3: 14
4: 114
933744585_933744599 28 Left 933744585 2:85561375-85561397 CCTAAGCCTACCTGAGCTGGGCG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933744599 2:85561426-85561448 CATTGCTCTGCGGAGGAGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 181
933744585_933744594 18 Left 933744585 2:85561375-85561397 CCTAAGCCTACCTGAGCTGGGCG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 933744594 2:85561416-85561438 CAGACACCGCCATTGCTCTGCGG 0: 1
1: 0
2: 0
3: 5
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933744585 Original CRISPR CGCCCAGCTCAGGTAGGCTT AGG (reversed) Exonic
900188559 1:1343916-1343938 CCCCCAGGTCAGATAGGCTTGGG + Intronic
900983773 1:6061305-6061327 GGCCCAGTGCTGGTAGGCTTTGG - Intronic
904042520 1:27592870-27592892 GGCCCAGCTCAGAGAGGCTTGGG + Intronic
905010245 1:34742243-34742265 CCCCCAGCCCAGATAGGCCTGGG - Intronic
907440326 1:54474819-54474841 GGCCCAGCTGGGGTGGGCTTGGG + Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
921045546 1:211474672-211474694 CTCCCAACTCAGCTAGGATTTGG - Intergenic
922506504 1:226129106-226129128 CACCCAACTCAAGAAGGCTTGGG + Intergenic
924918470 1:248599755-248599777 CGTACAGCTCAAGTAGTCTTTGG + Intergenic
1065175333 10:23069923-23069945 AGCCCAGGGCAGGTAGGCTTTGG + Intergenic
1067474415 10:46556584-46556606 CGCCCAGGCCAGGTCGGCTCTGG - Intergenic
1067685790 10:48465432-48465454 AGCCCAGCTCAGAGAGGCTTAGG - Intronic
1081765405 11:45606756-45606778 TCCCCAGCTCAGGCAGGTTTAGG - Intergenic
1084691913 11:70732520-70732542 AGCCCAGCTCAGTGAGGCTGGGG - Intronic
1084979505 11:72821772-72821794 CGCCCACCTCAGGGAGGCCCGGG + Intronic
1089362569 11:117900809-117900831 AGCCCAGCTCAGGCAGGCCATGG - Intronic
1095739493 12:45591740-45591762 CGGCCAGCACAGGGAGGCCTTGG + Intergenic
1095882308 12:47150830-47150852 GGGCCAGATCATGTAGGCTTAGG + Intronic
1104782552 12:131431217-131431239 TGCCCAGCTCAGCTAGGGTACGG - Intergenic
1107935236 13:45340879-45340901 CGCCCAGCTCTGGTGTGCTACGG - Intronic
1118068479 14:62218450-62218472 CTCCCATCTCAAGTAGGCTCTGG + Intergenic
1118312423 14:64703977-64703999 CGGCCGGCTCTGGTAGGATTAGG + Intergenic
1119166768 14:72501088-72501110 TGCCAATCTCAGGTGGGCTTTGG + Intronic
1119274809 14:73345333-73345355 CTCCCACCTCAAGTAGGCTCCGG - Intronic
1122694422 14:103545854-103545876 CGCCGCGCTCAGGAGGGCTTCGG - Intergenic
1124217406 15:27818933-27818955 CGCCAGACCCAGGTAGGCTTCGG + Intronic
1128472009 15:67962298-67962320 AGCTCAGCTCAGGTGGCCTTTGG + Intergenic
1128498137 15:68209903-68209925 CGCCCAGCACAGGCAAGGTTGGG - Intronic
1131057751 15:89385745-89385767 TGCTCAGCTCAGGTTGGCCTGGG - Intergenic
1134283753 16:12841830-12841852 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1136456699 16:30383727-30383749 AGGCCAGCTGAGGGAGGCTTTGG - Intronic
1137842615 16:51653960-51653982 TGCCCAGCTGAGGCAGGCATGGG - Intergenic
1141676853 16:85522271-85522293 ACCACAGCTCAGGCAGGCTTTGG - Intergenic
1141939454 16:87265130-87265152 CGCCCAGCTCAGGTGGGAGGAGG + Intronic
1141979160 16:87539074-87539096 AGCCCAGCTCAGGCAGCCTGAGG + Intergenic
1142139047 16:88464465-88464487 GGAACAGCTCAGGAAGGCTTGGG + Intronic
1142231526 16:88902337-88902359 CGCCCAGCGCAGCCAGGCCTCGG - Intronic
1145125137 17:20293775-20293797 CTCCCAGCTTTAGTAGGCTTGGG + Intronic
1148754367 17:49964932-49964954 GGCCGAGCTCAGGCAGGCTGGGG + Intergenic
1151853936 17:76708753-76708775 TGGCCAGCTCAGGAAGGCCTGGG + Intronic
1152984541 18:309795-309817 CTCCCACCTCAGGTAGGCCCCGG - Intergenic
1156445990 18:37237062-37237084 GGCCCAGCTCAGGGAGCCATGGG - Intergenic
1159481424 18:68995390-68995412 CTCCCATCTTAGGTCGGCTTAGG + Intronic
1161158626 19:2748987-2749009 TGCCAAGCCCAGGTAGACTTGGG - Intergenic
1161221982 19:3122078-3122100 CGCCCAGCCCACGTGGGCTCCGG - Exonic
1163857576 19:19716909-19716931 CCCCCAGGTCACATAGGCTTTGG - Intronic
928388232 2:30887927-30887949 CCCCCAGCTGAGGTAGGCATGGG - Intergenic
929484453 2:42341416-42341438 CGCCCAGCCCAGGCAAGCTTGGG - Intronic
931433396 2:62227826-62227848 ATTCTAGCTCAGGTAGGCTTTGG + Intergenic
931849481 2:66237901-66237923 CCCCCAGCTCAGCTAGGCTGTGG + Intergenic
933744585 2:85561375-85561397 CGCCCAGCTCAGGTAGGCTTAGG - Exonic
934151809 2:89154324-89154346 AGCCCACATCAGGTAGGGTTTGG + Intergenic
934215451 2:90027582-90027604 AGCCCACATCAGGTAGGGTTTGG - Intergenic
941601344 2:167546998-167547020 TGCCCAGCTCATGGAGGCTGAGG - Intergenic
942146690 2:173034221-173034243 CATCCAGCTCAGGTTGGCTATGG + Intronic
943639528 2:190343606-190343628 CGCCCGGCTCGGGCAGGCGTGGG + Exonic
946202007 2:218075973-218075995 TGCCCAGCCCCAGTAGGCTTTGG + Intronic
1173395647 20:42677262-42677284 GGCCCAGCTCAGGGAGCCTCAGG + Intronic
1174359669 20:50020166-50020188 CGGCCAGGGCAGGTAGGCATGGG + Intergenic
1179022992 21:37656663-37656685 CGTCCAGCTCAGGCAGGCCGGGG - Intronic
1181047902 22:20224221-20224243 CCCCCAGCTCTGGAAGGTTTGGG - Intergenic
1181309494 22:21936958-21936980 AGCCAAGCTTAGGTAGGATTTGG - Intronic
1181752296 22:24997234-24997256 CAGCCAGCCCAGGTAGGCTTTGG - Intronic
1182773426 22:32812606-32812628 GGCACTGCTCAGGTAGGCTGTGG - Intronic
1183524063 22:38313638-38313660 AACCCAGCCCAGGCAGGCTTTGG - Intronic
952723545 3:36557985-36558007 AGCTCAGCTCAGGTAGGGATTGG + Intergenic
954163694 3:48739658-48739680 GGCCCAGCCCAGGTAGGCAAGGG + Intronic
955473601 3:59312849-59312871 AGGCCAGCCCAGGTAGGCTCTGG + Intergenic
956406079 3:68930930-68930952 AGCCCAGTTCAGGAAGGCCTTGG - Intronic
959693685 3:109226663-109226685 CACCGGGATCAGGTAGGCTTGGG - Intergenic
963939763 3:151086526-151086548 CGCCCAGCTGGGGTGGGTTTGGG + Intronic
965652399 3:170947498-170947520 AGCCCACCACAGGTGGGCTTGGG - Intergenic
967989595 3:195121148-195121170 CCTGCAGCTCAGGGAGGCTTTGG - Intronic
968008578 3:195259124-195259146 GGCCCTGCTCAGGCAGGCCTGGG - Intronic
968711562 4:2123193-2123215 CGCCCAGCTGAGGTTTGGTTTGG - Intronic
972479295 4:39482774-39482796 CGACCAGATGAGGAAGGCTTGGG + Intergenic
978832219 4:113101995-113102017 GGTCCAGCTCATGAAGGCTTTGG + Intronic
979603887 4:122616505-122616527 CTCCCAGCTCAGTTAGGGTTAGG + Intronic
982799026 4:159679854-159679876 CACCCAGGTCAATTAGGCTTTGG - Intergenic
985551602 5:535953-535975 CGCCCTGCCCAGGTGGGCTGCGG - Intergenic
985775720 5:1840808-1840830 CTCCCAGCTCCGGCAGGCCTCGG - Intergenic
986031040 5:3892766-3892788 GGCCTAGTTCAGGTGGGCTTGGG - Intergenic
989205503 5:38805434-38805456 CTCCCAGCTCAGGGAGGGTCTGG + Intergenic
990777990 5:59324744-59324766 CTCCCACCTCAGGATGGCTTTGG + Intronic
991062738 5:62395926-62395948 AGCCCAGCCCAGGGAGGCTGAGG + Intronic
1002436962 5:179237592-179237614 TGCCCAGCTCTGGGAGGCTGGGG + Intronic
1006417008 6:33910664-33910686 AGGCCAGCTCAGGGAGGCTGAGG + Intergenic
1011061862 6:83278858-83278880 CCCCCAGTTTAGGTAGGCTTTGG - Intronic
1011962764 6:93111883-93111905 CACCCAGCTCATGTAGAATTAGG - Intergenic
1015933824 6:138388500-138388522 CCCCCAGGTCAGTTAGGCTCTGG - Intergenic
1019188495 6:170235938-170235960 GGGCCAGCTCAGGAAGGCTGGGG + Intergenic
1028063673 7:86353275-86353297 CCCCCAGGTCAGTTAGGCTCTGG - Intergenic
1031484079 7:122307377-122307399 AGCCCGGCTCTGGAAGGCTTTGG + Intronic
1035470990 7:159108607-159108629 CGCCCAGGTCAGTGAGGCTCTGG - Intronic
1037466840 8:19169218-19169240 TGCCCAGCTCAGGAAGACATGGG + Intergenic
1038512423 8:28151734-28151756 CCCCCAGGTCAGTTAGGCTCTGG + Intronic
1040046209 8:42966633-42966655 CGCCCAGCACAGTTTGGCTCTGG + Intronic
1049120783 8:140735240-140735262 AGCTCAGCTCAGGTAGGAGTTGG - Exonic
1050490553 9:6184133-6184155 AGCCCAGATCAGGAAGGCTTTGG + Intergenic
1060299040 9:122363278-122363300 ATCCCAGCTCAGGGAGGCTGAGG - Intergenic
1061272157 9:129549868-129549890 CGCCCAGCTCTCGTGGGATTGGG - Intergenic
1061400594 9:130366078-130366100 CCCCCATCTCAGCTAGGCTCTGG - Intronic
1187274750 X:17807415-17807437 CACCAGGCTCAGGAAGGCTTAGG - Intronic
1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG + Intergenic