ID: 933749725

View in Genome Browser
Species Human (GRCh38)
Location 2:85595588-85595610
Sequence CTAATTCGGCCCCCTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 30}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933749725_933749729 26 Left 933749725 2:85595588-85595610 CCAATGAGAGGGGGCCGAATTAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 933749729 2:85595637-85595659 GAGCCACTATGCCCGTCCCTCGG 0: 1
1: 5
2: 33
3: 383
4: 1545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933749725 Original CRISPR CTAATTCGGCCCCCTCTCAT TGG (reversed) Intergenic
901222138 1:7589258-7589280 CTACTTGGGCACCCTCTCCTTGG - Intronic
1064344543 10:14519929-14519951 GTAACTCGGCCCCCTCTCTGAGG + Exonic
1066624406 10:37391479-37391501 CTAATAAGGCCCCCTCTTTTGGG - Intergenic
1084138965 11:67210587-67210609 CTATTTCTGAGCCCTCTCATAGG - Intronic
1091095774 11:132820873-132820895 ATAATAAGGCCCCCTCTCAGAGG - Intronic
1093600882 12:21020962-21020984 CTAATTCAGCACCATCTCTTTGG + Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1101054088 12:100894529-100894551 CAAATTCTGCCCCCTCTTATGGG + Intronic
1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG + Intronic
1124603109 15:31151061-31151083 CCCATTCGGCCCCCTCTCTGTGG + Intronic
1135164304 16:20125250-20125272 ATAATTAGGCTCCCTTTCATGGG + Intergenic
1147582438 17:41634939-41634961 CTAATTCTGCCTCCTCTGACTGG - Intergenic
1150476011 17:65475790-65475812 CCAATCTGGCCCCCTCTCTTGGG + Intergenic
1151367204 17:73625384-73625406 CTCCTGCTGCCCCCTCTCATGGG - Intronic
1158407744 18:57175280-57175302 CTAAATCAGCCCCCACTCAAGGG + Intergenic
1161139146 19:2637648-2637670 CTAATTCCGTCCCCTCTACTGGG + Intronic
1163895237 19:20052578-20052600 GTGGTTCGGCCTCCTCTCATTGG + Intergenic
1165747364 19:38237923-38237945 CTCATGCGGCCCCGTCTCAGGGG - Intergenic
933749725 2:85595588-85595610 CTAATTCGGCCCCCTCTCATTGG - Intergenic
942752345 2:179302248-179302270 ATAATTCAGCCACCTCCCATGGG - Intergenic
948372254 2:237496747-237496769 CTCATGCGGCCCCTTCCCATCGG - Intronic
1181548213 22:23617432-23617454 CTTGTTGGGCCCCCTCTCCTGGG + Intronic
1184965505 22:47969237-47969259 CTAGTTCTGGCACCTCTCATGGG + Intergenic
954874956 3:53796152-53796174 CTAAAAAGGTCCCCTCTCATTGG + Intronic
972343323 4:38171889-38171911 CTAAGTCTGTCCCCTCTCCTGGG + Intergenic
979020097 4:115486476-115486498 CTAATCCTGCACCCTCTGATAGG - Intergenic
980285761 4:130776875-130776897 CTACTTCGGCTCGCCCTCATTGG - Intergenic
986231371 5:5867359-5867381 CTCACTCCGCCCCATCTCATCGG + Intergenic
1002468765 5:179422263-179422285 CTCATTCTGCCTCCTCTCATGGG - Intergenic
1015832451 6:137385137-137385159 CTATTTCAGCCTCCTCTCAAAGG - Intergenic
1046681780 8:117178622-117178644 CTAATCCTGCCCCATCTTATAGG - Intergenic
1049401925 8:142431863-142431885 CCTATTCAGCCCCCTCTCCTAGG - Intergenic
1062070107 9:134550801-134550823 CTCCTTCGGCCCCCTCTCCTGGG + Intergenic
1190711336 X:53072885-53072907 CTAGTTTGGCCTCCTGTCATGGG + Intronic
1198493447 X:137166756-137166778 CCAGTTAGGCCCCCTCTCACTGG - Intergenic