ID: 933751170

View in Genome Browser
Species Human (GRCh38)
Location 2:85602740-85602762
Sequence CCACGTCCCGGCGGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 364}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933751170_933751177 0 Left 933751170 2:85602740-85602762 CCGCGCCGCCCGCCGGGACGTGG 0: 1
1: 0
2: 3
3: 25
4: 364
Right 933751177 2:85602763-85602785 AGTCCGCGCAGCCCCGGCCTCGG 0: 1
1: 0
2: 2
3: 12
4: 125
933751170_933751176 -6 Left 933751170 2:85602740-85602762 CCGCGCCGCCCGCCGGGACGTGG 0: 1
1: 0
2: 3
3: 25
4: 364
Right 933751176 2:85602757-85602779 ACGTGGAGTCCGCGCAGCCCCGG 0: 1
1: 0
2: 1
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933751170 Original CRISPR CCACGTCCCGGCGGGCGGCG CGG (reversed) Intronic
900091750 1:923866-923888 CCCCGGCGCGGCGGGCGGCGCGG - Intergenic
900095285 1:937699-937721 GCTGGGCCCGGCGGGCGGCGGGG - Intronic
900259336 1:1716075-1716097 GCACGTCCCGCCGGGCGCAGTGG - Intronic
900349261 1:2227251-2227273 CCAGGGGCCGGCGGGCGGGGCGG + Intergenic
900427463 1:2587075-2587097 CCACGGCCTGCCGGGCGGCTGGG - Exonic
901084681 1:6603153-6603175 CCCGGTCCCGGCGCGCGGCGAGG - Intronic
902018730 1:13328613-13328635 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
902019083 1:13329435-13329457 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
902251099 1:15154537-15154559 CAACGTCCCAGGGTGCGGCGGGG + Intronic
902400746 1:16155536-16155558 ACGCGTCCCGGCGGGGGGCGTGG - Intronic
903081674 1:20816305-20816327 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
903324869 1:22563845-22563867 CCTCGGCCCGGGGGGCGGGGTGG + Intronic
903446295 1:23424640-23424662 CCTCGCCCCGCCGGGCGTCGCGG - Exonic
903458434 1:23504365-23504387 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
903637498 1:24832915-24832937 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
903637907 1:24833841-24833863 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
903962282 1:27064610-27064632 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
904039435 1:27575647-27575669 CCACATGCCGGCCGGCCGCGCGG + Intronic
904143279 1:28370066-28370088 CCAAGTCTCGGGGGGCGGAGAGG - Intronic
904215445 1:28914938-28914960 CCGCGTCCCGGCTGGCGACTCGG - Intronic
904751030 1:32741674-32741696 CCCGGTCCCGGCGGAGGGCGAGG - Intergenic
904784439 1:32974276-32974298 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
904857296 1:33509287-33509309 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
905137033 1:35808079-35808101 CAGGGTCCCGGCGGGCGGAGGGG - Intergenic
905151369 1:35930820-35930842 CGACGTCGCGGCTGGCGGCGGGG - Intronic
905847125 1:41242257-41242279 CCACCTCGCAGCGGGAGGCGCGG - Intergenic
906627132 1:47334239-47334261 CCACTGCCACGCGGGCGGCGCGG - Intronic
906761517 1:48382639-48382661 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
907140612 1:52181979-52182001 CCCCGTCCCGGAGGGAGGCGAGG + Intronic
907140634 1:52182028-52182050 CCCCGTCCGGGAGGGAGGCGAGG + Intronic
907429880 1:54405782-54405804 CGAGGCCGCGGCGGGCGGCGTGG - Intronic
908360899 1:63367666-63367688 CCAGCGGCCGGCGGGCGGCGGGG + Exonic
908501275 1:64745445-64745467 ACGCGTCCCGAGGGGCGGCGGGG + Intronic
908582039 1:65525977-65525999 CCAGCGCCCGGCGGGCGGCGGGG + Intronic
910412680 1:86963841-86963863 CCCCGTCCGGGCGGGAGGTGGGG - Intronic
912381461 1:109250052-109250074 CCAGCTCCCGGCCGGCGGCCGGG - Exonic
912776525 1:112509221-112509243 CCACGCCCCTCCGGGCTGCGCGG + Exonic
913022750 1:114804460-114804482 CCCCGTCCAGGAGGGAGGCGGGG - Intergenic
914888248 1:151600959-151600981 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
915208419 1:154287770-154287792 CCCCGTCCGGGCGGGAGGTGGGG + Intergenic
915539682 1:156558184-156558206 CCCCGTCCGGGAGGGAGGCGCGG + Intronic
915552314 1:156642292-156642314 CGACCCCACGGCGGGCGGCGGGG - Intronic
916963205 1:169909773-169909795 CCAGGTCCCGACGGGCTGCCCGG - Intergenic
920451706 1:206064634-206064656 CCCCGTCCCGGGGGGAGGTGGGG + Intronic
921060433 1:211579625-211579647 CCACGTGGGGGCGGGCCGCGCGG + Intergenic
921140026 1:212298456-212298478 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
921140279 1:212299056-212299078 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
921142347 1:212320582-212320604 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
921142503 1:212320946-212320968 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
921142556 1:212321073-212321095 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
921814230 1:219546226-219546248 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
922102699 1:222488327-222488349 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
924539793 1:244970473-244970495 CGGGGTCGCGGCGGGCGGCGAGG - Exonic
924719731 1:246610941-246610963 CCACGGCCAAGCGGGCGGAGGGG - Intronic
1063776778 10:9273401-9273423 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1064108341 10:12519402-12519424 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1066085811 10:31970972-31970994 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1068969821 10:62948282-62948304 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1069052611 10:63811457-63811479 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1070138369 10:73715653-73715675 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1070305321 10:75235802-75235824 CCTGGTCCCGGCGGGCGGGTGGG - Intronic
1070966645 10:80534598-80534620 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1070966667 10:80534647-80534669 CCCCGTCCAGGAGGGAGGCGGGG + Intergenic
1072117178 10:92376482-92376504 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
1072602163 10:96941069-96941091 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1073062689 10:100741938-100741960 CCACTTCCCGGGGAGCGGCTAGG - Intronic
1074377501 10:112951650-112951672 GCGGGGCCCGGCGGGCGGCGCGG - Intronic
1074591916 10:114821857-114821879 CCGGGACGCGGCGGGCGGCGAGG - Exonic
1074592049 10:114822267-114822289 CCACGACCCGGCGGCCGCCCAGG - Intronic
1076721979 10:132396862-132396884 CCACGAGCCCGGGGGCGGCGGGG - Intergenic
1076921636 10:133457433-133457455 CCACGTCCCGGCGGGGGGCCTGG - Intergenic
1077062646 11:624640-624662 CCACGTCCCGGAGGGCCAGGAGG - Exonic
1077074874 11:695800-695822 CGACGGACCGGCGGGCGGGGCGG + Exonic
1077109325 11:855154-855176 CCAGGTCCCAGCTGGCGGCAGGG + Intronic
1079020762 11:16907494-16907516 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1079020784 11:16907543-16907565 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1079444959 11:20548852-20548874 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1080503689 11:32892916-32892938 CCGGGCCGCGGCGGGCGGCGAGG - Intergenic
1080606671 11:33869769-33869791 CACCATCCCCGCGGGCGGCGCGG - Exonic
1081981420 11:47269581-47269603 CCATCTCCCAGCGGGCGCCGCGG + Intronic
1083228767 11:61301745-61301767 CCACCTCCAGGGGGGCGGGGAGG + Intronic
1084560885 11:69904913-69904935 CCAGGTCCCGGTGGACGGTGTGG + Intergenic
1084643809 11:70442649-70442671 CCAGGGCCTGGCGGGCGGGGTGG + Intergenic
1084839255 11:71831560-71831582 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1084924562 11:72502149-72502171 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1085139657 11:74129181-74129203 CCCCGTCCCGGAGGGAGGTGAGG - Intronic
1085513134 11:77098334-77098356 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1086366172 11:86110958-86110980 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1089158674 11:116421545-116421567 CCAGGTCCCGGTGGGTGGCTCGG - Intergenic
1089264737 11:117251260-117251282 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1091378823 12:42660-42682 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1091558696 12:1594483-1594505 CCGCGGGCCGGCGGGCGGCGAGG + Intronic
1091857785 12:3753164-3753186 GCACGTCCCGGAGGGCGTCCAGG - Intronic
1092295984 12:7199981-7200003 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1093453356 12:19340347-19340369 CCCCGTCCAGGAGGGAGGCGGGG + Intronic
1094041113 12:26122623-26122645 CGGCGGCCCGGGGGGCGGCGCGG - Exonic
1096148926 12:49296687-49296709 CCACCTGGCGGCGGGCAGCGGGG + Intronic
1097872071 12:64610336-64610358 CCACCTGCGGGCGGGCGGGGAGG + Intergenic
1098413003 12:70202821-70202843 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1098521678 12:71440370-71440392 CCACGAGCAGGCGGGCGCCGAGG - Intronic
1100315504 12:93441572-93441594 CCACGCCCCGGCGGAGGGTGGGG - Intronic
1100570277 12:95840476-95840498 CCCCGTCCGGGAGGGCGGTGGGG - Intergenic
1100570684 12:95841396-95841418 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1102294012 12:111723426-111723448 CCCCGTCCAGGAGGGAGGCGGGG - Intronic
1102294035 12:111723475-111723497 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1103623839 12:122204337-122204359 CCGCGGCTCGGAGGGCGGCGGGG + Intronic
1105367851 13:19779537-19779559 CCCCGTCCCGGAGGGAGGTGGGG + Intronic
1106560037 13:30839433-30839455 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1106602633 13:31200443-31200465 CCCCGAACCGGCGGGCGACGGGG + Intronic
1107499084 13:40955754-40955776 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1107499161 13:40955930-40955952 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1107603905 13:42040475-42040497 CCTCCTCCCGGCGGGTGGCCCGG - Intronic
1108059165 13:46515564-46515586 CCCCGTCCGGGAGGGCGGTGGGG - Intergenic
1110596598 13:77326802-77326824 CCTCGTCCCCGCGGGCCGGGCGG + Intronic
1114427941 14:22637841-22637863 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1114473737 14:22980757-22980779 CCAGGTGCCCGCGGGCGGGGCGG - Intronic
1114629060 14:24147653-24147675 CCGGGTCCTGGCGGGCGGCGAGG + Exonic
1115271682 14:31560158-31560180 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1115703406 14:35977076-35977098 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1115703478 14:35977244-35977266 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1118253224 14:64183021-64183043 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1118340773 14:64894780-64894802 CCCCGTCCGGGAGGGCGGTGGGG - Intergenic
1118341179 14:64895701-64895723 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1119742945 14:77026194-77026216 CGACGGCGCGGCGGGCGGCAAGG + Exonic
1120309854 14:82814433-82814455 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1122212417 14:100181286-100181308 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1122688939 14:103522591-103522613 CCGCGTCCCGGGGGGCGCCGGGG - Intronic
1122904582 14:104795832-104795854 CCACCGCGCGGCCGGCGGCGAGG + Intergenic
1125674759 15:41495973-41495995 CGACGGCTCGGAGGGCGGCGGGG - Intronic
1125740734 15:41962656-41962678 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1126295687 15:47133267-47133289 CCCCGTCCGGGAGGGAGGCGCGG + Intergenic
1126852469 15:52805668-52805690 CCACATCCCGGCGGGCCGCCAGG - Intergenic
1127165832 15:56243979-56244001 GCACGGCGCGGAGGGCGGCGCGG + Intergenic
1127480369 15:59372153-59372175 CCACGTCCCAGCAGGAGGAGGGG + Intronic
1127584320 15:60366784-60366806 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1128489832 15:68134851-68134873 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
1128586962 15:68859839-68859861 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1128587119 15:68860192-68860214 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1128970228 15:72100950-72100972 CCGCGTCCCGGAGGGAGGTGGGG + Intronic
1129431686 15:75504493-75504515 CCACGTCCGGGAGGGAGGTGGGG + Intronic
1131158285 15:90088385-90088407 CAACTTCCCCGCAGGCGGCGTGG - Exonic
1132365090 15:101251464-101251486 CGGCGGCCCGGCGGGCGGAGCGG - Exonic
1132601554 16:775219-775241 CCACGTCCCCCTGGGCGGCACGG + Exonic
1132879489 16:2155731-2155753 ACACGTCCCGGCGGGCGCAGCGG + Intronic
1133228588 16:4355246-4355268 TCACTTCCCGGCAGGCAGCGCGG - Intronic
1135479922 16:22814073-22814095 CCAGGTCCCTGGGCGCGGCGCGG + Intergenic
1136426000 16:30169457-30169479 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
1137728699 16:50674102-50674124 CCACCTCCCGGCGGGGGCTGCGG + Intronic
1139548214 16:67659701-67659723 CCAGGTCGCTGAGGGCGGCGCGG - Exonic
1139864634 16:70052140-70052162 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1141429758 16:83965509-83965531 CCACGGCCCGGCGGAAGGCATGG - Exonic
1141741961 16:85899281-85899303 CCACGCCCCGCCTGGCGTCGGGG - Intronic
1142120356 16:88383707-88383729 GCACGCCCGGGCGGGCGGCCCGG - Intergenic
1142211743 16:88811731-88811753 CGACCTCCGGGCGGGCGGGGCGG - Intronic
1142818859 17:2448058-2448080 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1143503111 17:7350294-7350316 CCACGTTCGGGCGGGCGGGCGGG + Intronic
1144510023 17:15867555-15867577 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1144782073 17:17813441-17813463 CCACGGCCCGGCTGATGGCGGGG - Exonic
1145049502 17:19648574-19648596 CCACGGGCCAGGGGGCGGCGGGG - Intronic
1145280569 17:21464237-21464259 CCAGGGGCCGGCGGGCGGCTGGG + Intergenic
1145684366 17:26638679-26638701 CCACGTCCGGGAGGGAGGTGTGG + Intergenic
1145733848 17:27212668-27212690 CCCCGTCCGGGAGGGCGGAGGGG + Intergenic
1146057826 17:29589792-29589814 CCCGGCCCCGGCGGGCAGCGTGG + Intronic
1146215984 17:30979541-30979563 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1146444143 17:32922212-32922234 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1146444442 17:32922881-32922903 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1147809642 17:43159325-43159347 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1147974411 17:44238746-44238768 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1147994660 17:44354179-44354201 CGACCTGCAGGCGGGCGGCGGGG - Exonic
1148422116 17:47556714-47556736 CCCCGTCCCGGAGGGAGGCGGGG - Intronic
1148632878 17:49125730-49125752 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
1157799729 18:50609392-50609414 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1160729320 19:633562-633584 ACAACTCCCGGCAGGCGGCGCGG - Exonic
1160775518 19:853400-853422 CCAGGTGCCGCCGGGCGGGGCGG + Exonic
1160909431 19:1467974-1467996 CTGGGTCCGGGCGGGCGGCGGGG - Exonic
1160991856 19:1863368-1863390 GCACATCCAGGCCGGCGGCGGGG + Exonic
1161179174 19:2867810-2867832 CCACGTCCCTGGGAGGGGCGAGG + Intronic
1161535841 19:4818029-4818051 CCACGTCCCGCAGCGAGGCGGGG + Exonic
1161729050 19:5947733-5947755 CCACGTCCCTGCCGGCGGGGTGG + Intronic
1162746574 19:12801933-12801955 CCATGCGCCTGCGGGCGGCGGGG + Intronic
1162948485 19:14057383-14057405 CCACCTCCCGGCGCGCGGCGCGG + Exonic
1163480898 19:17555726-17555748 CCACGCGCGGGCCGGCGGCGCGG + Exonic
1163666702 19:18606901-18606923 CCGCGGGCGGGCGGGCGGCGGGG - Intronic
1163945340 19:20530094-20530116 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1164066511 19:21721324-21721346 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1164066840 19:21722070-21722092 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1164105702 19:22106975-22106997 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1164168448 19:22702870-22702892 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1164192510 19:22927084-22927106 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1164244723 19:23419506-23419528 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
1164659247 19:29949012-29949034 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1165199475 19:34132854-34132876 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1165354518 19:35295517-35295539 CCACATGCCGGGGGGCTGCGGGG - Intronic
1165481881 19:36069176-36069198 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1165832407 19:38736225-38736247 TCACGTCGCGGCGGGCGCTGAGG + Exonic
1166084507 19:40466034-40466056 CCACCTCCCGGAGAGGGGCGGGG + Intergenic
1166162615 19:40965445-40965467 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1166317881 19:41998885-41998907 CCAGCTCCCGGGGGCCGGCGGGG + Exonic
1166425799 19:42676653-42676675 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1166996791 19:46723246-46723268 CCACGTCCTGGAGGGCCACGGGG - Exonic
1167738690 19:51311720-51311742 CACCGGCCCGGGGGGCGGCGGGG - Intergenic
1167897501 19:52593543-52593565 CCTCGTCCCGGAGGGAGGTGGGG - Intergenic
1167970680 19:53186932-53186954 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
927215854 2:20667449-20667471 CCGCGGCGCGGCGCGCGGCGCGG - Exonic
928005242 2:27557646-27557668 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
929065026 2:37964040-37964062 CCACGTCCGGGAGGGAGGTGGGG - Intronic
930079102 2:47433056-47433078 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
932608080 2:73177492-73177514 CCACCTCCCGGCAGCGGGCGGGG - Intergenic
933751170 2:85602740-85602762 CCACGTCCCGGCGGGCGGCGCGG - Intronic
934753034 2:96806136-96806158 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
935645367 2:105329783-105329805 CCGCGGGCCGGCGGGCGGCGCGG - Exonic
936938499 2:117859881-117859903 CCACGTTCCCGAGGCCGGCGGGG - Intergenic
938073292 2:128319238-128319260 CCACGTCCCCGCAGCCCGCGCGG + Intergenic
938088716 2:128418382-128418404 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
940299200 2:152160632-152160654 CCCCGTCCGGGAGGGCGGTGGGG + Intronic
941768844 2:169327245-169327267 CCACGTCCGGGAGGGAGGTGGGG + Intronic
941769171 2:169327995-169328017 CCACGTCCGGGAGGGAGGTGGGG + Intronic
942096216 2:172538067-172538089 CCCCGTCCGGGAGGGAGGCGTGG + Intergenic
942454860 2:176130590-176130612 CCCAGTCCCGGAGGGCGGCGGGG - Exonic
944585122 2:201166266-201166288 CCCCGTCCGGGAGGGAGGCGTGG - Exonic
944598324 2:201282573-201282595 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
944598804 2:201283696-201283718 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
944751552 2:202715261-202715283 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
945233150 2:207611076-207611098 CCCCGTCCGGGAGGGAGGCGGGG + Exonic
945835620 2:214835101-214835123 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
945970370 2:216226575-216226597 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
946240155 2:218348986-218349008 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
947119168 2:226798871-226798893 CCCCGGCGCGGGGGGCGGCGTGG - Exonic
948479058 2:238239318-238239340 CCGCGTCCCCGCGGGCCGGGTGG - Intronic
1168777842 20:462556-462578 TCACGTGCCGGCGCGGGGCGGGG - Intergenic
1169086186 20:2825099-2825121 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1170999050 20:21395988-21396010 GCACGGCCCGGGGGGCGGCCTGG - Exonic
1171951746 20:31427358-31427380 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1171951803 20:31427476-31427498 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1171957248 20:31471062-31471084 CCACGTCCGGGAGGGAGGTGGGG - Intronic
1172051481 20:32122036-32122058 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1172118370 20:32584336-32584358 CCACGGCCCGGGCAGCGGCGCGG + Intronic
1172721150 20:37000702-37000724 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1172721172 20:37000751-37000773 CCCCGTCCAGGAGGGAGGCGGGG + Intronic
1172721323 20:37001104-37001126 CCCTGTCCCGGAGGGAGGCGGGG + Intronic
1175421821 20:58839642-58839664 CCACCTCCCCGCGAGCTGCGTGG - Intergenic
1175847258 20:62065433-62065455 CAGCTTCGCGGCGGGCGGCGCGG + Exonic
1175891368 20:62317466-62317488 CCCCATCCAGGCTGGCGGCGAGG + Exonic
1176074479 20:63242207-63242229 CCACTTCCCAGCAGGCGGCATGG - Intronic
1176430785 21:6574192-6574214 CCAGGCCCCGGTGGGCTGCGCGG - Intergenic
1176550443 21:8218711-8218733 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176569372 21:8401750-8401772 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1176577285 21:8445981-8446003 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1179706179 21:43181654-43181676 CCAGGCCCCGGTGGGCTGCGCGG - Intergenic
1180609237 22:17085073-17085095 CCATGGCCCGGCTGGCGTCGCGG - Exonic
1181586434 22:23855339-23855361 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1182586509 22:31346711-31346733 CCCCGGCCCCGCGGGCGGGGTGG - Intergenic
1182604108 22:31489925-31489947 TCACATCCGGGCGCGCGGCGGGG - Intronic
1183788344 22:40045036-40045058 CTCCGTCCCGGCGGGGCGCGGGG - Intronic
1183871377 22:40744790-40744812 CCCCGTCCGGGAGGGCGGTGGGG - Intergenic
1185313934 22:50170696-50170718 GCGCGGCCCGGCGGGGGGCGCGG - Intergenic
1203255339 22_KI270733v1_random:135050-135072 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
949569961 3:5283863-5283885 CCCCGTCCAGGAGGGAGGCGGGG - Intergenic
949992679 3:9592105-9592127 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
950438467 3:12994112-12994134 CGCCGTCCCCGCGGCCGGCGCGG + Intronic
953404628 3:42654378-42654400 CTGCGTGCCGGCGGGGGGCGCGG - Intronic
953926973 3:46987575-46987597 CCAGGACATGGCGGGCGGCGGGG + Intronic
956675039 3:71725326-71725348 CCGGGCCCCGGCGGGGGGCGCGG + Exonic
959415160 3:106073623-106073645 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
960780560 3:121313614-121313636 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
960921125 3:122747739-122747761 CCCCGTCCCGGAGGGAGGTGGGG + Intronic
961163654 3:124750027-124750049 CCCCGTCCCGGAGGGAGGGGGGG - Intergenic
961451937 3:127006194-127006216 CCAGGCCCAGGCGGGCGGAGGGG - Intronic
961962421 3:130868101-130868123 CCCCGTCCCGGAGGGAGGTGGGG + Intronic
962788004 3:138785218-138785240 CCCTGTCCCGGAGGGAGGCGGGG + Intronic
963036124 3:141030528-141030550 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
963036141 3:141030575-141030597 ACACGTCCGGGAGGGAGGCGGGG - Intergenic
963911239 3:150820207-150820229 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
966985436 3:185175707-185175729 CCACGTCCCGGCGGAGGCCCTGG + Intergenic
967177569 3:186874166-186874188 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
967938243 3:194746500-194746522 CCACGTCCCTGCAAGCGGCATGG - Intergenic
968035182 3:195542816-195542838 CCAGGGGCGGGCGGGCGGCGTGG - Intronic
968924106 4:3538485-3538507 CCGCGTCCGGGAGGGAGGCGGGG - Intergenic
969330596 4:6471896-6471918 CTGCCTCCCGGAGGGCGGCGCGG + Intronic
972162582 4:36244511-36244533 CCCCGCCCCCGCGGGCGGAGAGG - Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
975686058 4:76917926-76917948 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
975686108 4:76918053-76918075 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
975848424 4:78548236-78548258 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic
976265249 4:83182669-83182691 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
976265647 4:83185410-83185432 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
982709625 4:158746519-158746541 CCCCGTCCGGGCGGGAGGTGGGG - Intergenic
983904537 4:173169511-173169533 CCACTCCCCGGCGGGCGGGCCGG - Intronic
984803789 4:183735941-183735963 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
984804113 4:183736681-183736703 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
984811391 4:183798344-183798366 CCGCGGCTCGGCGGGCGGCTCGG + Intergenic
985542893 5:495021-495043 CCACGTGCCGGCGGGCACCGAGG - Intronic
985782192 5:1877091-1877113 CCGTGTCCCGGGGGGGGGCGTGG - Intergenic
986608428 5:9545497-9545519 CCGGGTCCCGGCCAGCGGCGCGG + Intronic
989075724 5:37563085-37563107 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
991672567 5:69062901-69062923 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
991672591 5:69062950-69062972 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
992469583 5:77042592-77042614 CCACGTCCGGGAGGGAGGTGGGG - Intronic
994353075 5:98769046-98769068 CGCCGGCCCGGAGGGCGGCGCGG + Intronic
997892332 5:137687228-137687250 CCCCGTCCGGGAGGGAGGCGCGG + Intronic
998200392 5:140113936-140113958 TCACGTGCCGGCGGGCGGGTGGG + Intronic
998406764 5:141878530-141878552 CCACCTCCCGGCCGGAGGGGGGG - Intronic
998431630 5:142075292-142075314 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
999279729 5:150357473-150357495 CCAAGTCCCGGCCGGCCCCGGGG + Intergenic
1003290604 6:4776071-4776093 CCACGTCGAGGCGGGCTGGGGGG + Intronic
1005709469 6:28489818-28489840 CCACGTCCCGGTGGTGGGGGGGG + Intergenic
1005837276 6:29718873-29718895 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1005837604 6:29719618-29719640 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1006064524 6:31454384-31454406 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1006064701 6:31454786-31454808 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1006064954 6:31455392-31455414 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1006424645 6:33956447-33956469 CCACGTCCCGCCAGGGGGCTGGG + Intergenic
1007673480 6:43575953-43575975 CCGGGCCGCGGCGGGCGGCGGGG + Exonic
1008926197 6:56894235-56894257 CCCCGTCCGGGAGGGCGGTGGGG - Intronic
1010030250 6:71266046-71266068 CCGCGTCCAGGAGGGGGGCGGGG - Intergenic
1011734312 6:90296541-90296563 CCCCCTCCCGGCAGCCGGCGAGG + Exonic
1013033760 6:106360871-106360893 CCGCGTCCCGGCAGTCGGAGCGG + Intergenic
1013530752 6:111017358-111017380 CCCCGTCCAGGAGGGAGGCGGGG - Intronic
1014556727 6:122848554-122848576 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1014763812 6:125388324-125388346 CCCCGTCCGGGAGGGCGGTGGGG - Intergenic
1015643550 6:135363774-135363796 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1017214980 6:151899133-151899155 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1017671925 6:156777572-156777594 CGGCTTCCCGGCGGGCCGCGTGG + Intergenic
1018743061 6:166744759-166744781 CCACGTCCCTGGCGGCGGTGGGG + Intronic
1019453089 7:1109753-1109775 CCAGGGCCCGGCGGGCGGGAAGG - Intronic
1019458836 7:1146464-1146486 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1019486354 7:1291138-1291160 GCACGTCCCGGGGGGCAGCGCGG - Intergenic
1020003222 7:4767349-4767371 CCTCGGCCCTGCGGGCGGCCTGG + Exonic
1023937276 7:44748895-44748917 CCCCGGGGCGGCGGGCGGCGCGG + Intronic
1023951219 7:44847821-44847843 GCGCCCCCCGGCGGGCGGCGAGG + Intronic
1024472158 7:49775407-49775429 CCACGTCCCGGCGGGCGGGCGGG - Exonic
1024931158 7:54667688-54667710 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1025011441 7:55402256-55402278 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1025852922 7:65258408-65258430 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1025853331 7:65259301-65259323 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1025979458 7:66394132-66394154 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1026783191 7:73283927-73283949 CCACGTCCGGGAGGGAGGTGGGG - Intergenic
1030602837 7:111610240-111610262 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1032569952 7:132985761-132985783 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1032914894 7:136478745-136478767 CCACGTGCCGGGGGGAGGGGGGG + Intergenic
1033219704 7:139520151-139520173 CCCCGTCCCGGAGGGAGGTGGGG - Intergenic
1033323999 7:140362883-140362905 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1034440528 7:151083469-151083491 GCACTTCCGGGCGGGAGGCGCGG + Intronic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1034638479 7:152585587-152585609 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1035751907 8:2002272-2002294 CCTCTTCGTGGCGGGCGGCGTGG + Exonic
1040834601 8:51718926-51718948 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1040834644 8:51719018-51719040 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1041693596 8:60714079-60714101 CCAGGCCTCGGCGGGCGGGGTGG + Intronic
1042020580 8:64369420-64369442 CCACTTCCCAGCCGGCCGCGAGG - Intergenic
1042591588 8:70403009-70403031 CCGCGGCCCGGCGGGTGGCCCGG - Intronic
1044507705 8:93039565-93039587 CCCCGTCCGGGAGGGCGGTGGGG + Intergenic
1044674986 8:94719826-94719848 CCGCGTCCCCGCAGGCGGCCCGG - Intronic
1045111567 8:98942131-98942153 CCTCGTCCCGGCCGGCGTCTAGG - Intronic
1046636813 8:116680017-116680039 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1048214345 8:132481142-132481164 CCCCGTCGCGGCGGGAGGCCCGG + Intergenic
1048553886 8:135457312-135457334 CCAGGAGGCGGCGGGCGGCGGGG + Intergenic
1049083063 8:140457671-140457693 CCACGACCTGGCGGGCAGCGGGG + Intronic
1049406217 8:142452842-142452864 CCAGGCCCAGGCGGCCGGCGCGG + Intronic
1049585367 8:143430427-143430449 CCGCGCCCCGACGGGCGGCGTGG + Intergenic
1049854619 8:144853401-144853423 CGGCGTCCGGGTGGGCGGCGGGG + Exonic
1051280927 9:15442115-15442137 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1051280970 9:15442207-15442229 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1052358523 9:27529470-27529492 TCTCGCCCGGGCGGGCGGCGAGG - Intronic
1052492770 9:29189103-29189125 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1053011770 9:34637692-34637714 CTGCATCCCGGCGGGCGGCCTGG + Exonic
1055466512 9:76571805-76571827 CCCGGTCCCGGCGCACGGCGGGG - Intergenic
1056624686 9:88244729-88244751 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1056624709 9:88244778-88244800 CCCCGTCCGGGAGGGAGGCGGGG - Intergenic
1060209136 9:121699575-121699597 TAAGTTCCCGGCGGGCGGCGTGG - Intronic
1060249083 9:121971196-121971218 CCCCGTCCCGGAGGGAGGTGGGG + Intronic
1060264026 9:122099709-122099731 CCAGTTCCCGGAAGGCGGCGTGG + Intergenic
1060634633 9:125190056-125190078 TCACCTCCCGGCAGCCGGCGAGG + Intergenic
1061010319 9:127950780-127950802 CCACGTCCCGGCGTGCACCGGGG + Intronic
1061050473 9:128191851-128191873 CCACCTCCCTGCGGCCGCCGCGG + Intronic
1061285502 9:129620299-129620321 CCGCGACCCGGCGGGCCGTGCGG - Exonic
1061666027 9:132161556-132161578 CCACGGCCCGGGGAGGGGCGCGG - Intergenic
1061725592 9:132580481-132580503 CCCCAGCCCGGCCGGCGGCGGGG + Intergenic
1062124368 9:134851166-134851188 CCACCTCCCCGCGGGTGGCTTGG - Intergenic
1062424361 9:136499172-136499194 CCACGGCCAGGCGGGCAGCCAGG + Exonic
1062526054 9:136978521-136978543 CCACCTCCCGGGGCGGGGCGGGG + Intronic
1203471737 Un_GL000220v1:118187-118209 CCCGGTCCCGGCGCGCGGCGGGG - Intergenic
1203405434 Un_KI270539v1:4-26 CCACGTCCGGGAGGGAGGTGGGG + Intergenic
1203405614 Un_KI270539v1:435-457 CCACGTCCGGGAGGGAGGTGTGG + Intergenic
1187067378 X:15854486-15854508 CCACATCCCCGGGCGCGGCGCGG + Intronic
1187184154 X:16968527-16968549 CCCCGTCCCGGAGGGAGGTGGGG - Intronic
1188367683 X:29333806-29333828 CCCCGTCCGGGAGGGAGGCGGGG - Intronic
1189173603 X:38932554-38932576 CCAGGTCCCAGCTGGTGGCGAGG + Intergenic
1190779285 X:53579011-53579033 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1191794086 X:65002379-65002401 CCCCGTCCGGGAGGGAGGCGGGG + Intronic
1192567892 X:72179166-72179188 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1193924388 X:87466163-87466185 CCCCGTCCGGGAGGGAGGCGGGG + Intergenic
1201335815 Y:12878911-12878933 CCCCGTCCCGGAGGGAGGTGGGG + Intergenic