ID: 933751224

View in Genome Browser
Species Human (GRCh38)
Location 2:85602945-85602967
Sequence CCTGCCGGGGAAGCGTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933751215_933751224 20 Left 933751215 2:85602902-85602924 CCGCTCTAAAACCGAGATGACTA 0: 1
1: 0
2: 1
3: 3
4: 65
Right 933751224 2:85602945-85602967 CCTGCCGGGGAAGCGTCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
933751217_933751224 9 Left 933751217 2:85602913-85602935 CCGAGATGACTAGAGGTTCCGTT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 933751224 2:85602945-85602967 CCTGCCGGGGAAGCGTCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 117
933751219_933751224 -9 Left 933751219 2:85602931-85602953 CCGTTTAACCGATTCCTGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 933751224 2:85602945-85602967 CCTGCCGGGGAAGCGTCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933751224 Original CRISPR CCTGCCGGGGAAGCGTCAGC AGG Intronic