ID: 933751584

View in Genome Browser
Species Human (GRCh38)
Location 2:85605678-85605700
Sequence CAGGCTCACAAATTTAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933751584 Original CRISPR CAGGCTCACAAATTTAAATG AGG (reversed) Intronic
901272385 1:7962342-7962364 CATGGGCAAAAATTTAAATGTGG - Intronic
903593627 1:24477390-24477412 CAGGCTCAGAACTTTAACTCAGG + Intergenic
907711709 1:56889039-56889061 CAGCCTCACAGATTTTAAAGAGG - Intronic
908811950 1:67990626-67990648 CAAGGTCACAAATTTAAAAGAGG + Intergenic
909104651 1:71393102-71393124 CTGGGTCTCAAATATAAATGTGG + Intergenic
910025192 1:82641961-82641983 AAGGCTAACAAAATTAAGTGAGG - Intergenic
910044204 1:82891872-82891894 CAGGCTCACATGTTTAGATTTGG - Intergenic
910480301 1:87651429-87651451 GAGCCTCACAAATGTATATGTGG - Intergenic
910697405 1:90035053-90035075 CAGCCTGAAAAATTTAAATCTGG - Intronic
911312030 1:96305228-96305250 AAAGCTCAGAAATTCAAATGAGG + Intergenic
914856535 1:151355793-151355815 CAGGCTCAGTAATTGGAATGTGG + Intergenic
916692904 1:167208361-167208383 CAGGCACTGAAATTTGAATGTGG - Intergenic
916893479 1:169137014-169137036 CAGGCACACATATTTTAATTTGG - Intronic
918101442 1:181378892-181378914 AAGGCTCACAAATATTTATGGGG + Intergenic
918638228 1:186805749-186805771 CAGGCTGCCAACTTTGAATGTGG - Intergenic
919345315 1:196368782-196368804 CAGGCTCACAAATGTGAAGGAGG - Intronic
920256132 1:204655767-204655789 CAGACTCACAAATATGACTGTGG + Intronic
1063110236 10:3029261-3029283 GAGGCTCATAAATTTCAATTTGG - Intergenic
1063344077 10:5295078-5295100 TAGCCTCACAAAATTGAATGTGG - Intergenic
1066345454 10:34580687-34580709 CAAGCTTAAAAATTTAAATGTGG - Intronic
1071199100 10:83197024-83197046 CAGTATCACAAATTTAAAAGGGG - Intergenic
1073923879 10:108491145-108491167 CATTCTCTCAAATTTAAAAGTGG + Intergenic
1074996920 10:118765553-118765575 CATGCTCAAACATTTTAATGGGG - Intergenic
1076262798 10:129081740-129081762 GAGATCCACAAATTTAAATGGGG + Intergenic
1078913158 11:15752062-15752084 CAGGTTGAAAAAGTTAAATGTGG - Intergenic
1079399890 11:20098246-20098268 CAGGCCCACAAAGTTCACTGAGG + Intronic
1080649655 11:34211989-34212011 GAGGCCCAAAAATTCAAATGGGG + Intronic
1081910840 11:46698847-46698869 CAGGCTCAGAAGTTAAACTGTGG - Intronic
1087256578 11:95962319-95962341 GAGACACACAAATATAAATGGGG + Intergenic
1087347267 11:96987758-96987780 CAGGCTCACTTATATAAATGAGG - Intergenic
1088979454 11:114848762-114848784 CAAGCCCAAAAATTTACATGTGG + Intergenic
1089588680 11:119526090-119526112 CAGGATGACAATTTTAAATCAGG - Intergenic
1091837430 12:3595606-3595628 CAGCCTCAAAAATGTAAAAGAGG - Intergenic
1093916871 12:24813067-24813089 CAGTCTTAAAAATTGAAATGGGG - Intronic
1098907523 12:76177417-76177439 CAGGCTCAGAAAGTAAAATAAGG - Intergenic
1099308837 12:80993168-80993190 CAGGCGCCCAAATTTTCATGGGG - Intronic
1099570192 12:84307308-84307330 AAGTCTCATAAATTTATATGAGG + Intergenic
1100102965 12:91131978-91132000 AAGTCACACAAATATAAATGGGG - Intergenic
1101052009 12:100873621-100873643 TTGGCTCACAAATATAAATATGG - Intronic
1103262911 12:119604120-119604142 CAGGCTCACATTTTTGGATGAGG - Intronic
1104222474 12:126798288-126798310 CAGGCCAGGAAATTTAAATGTGG - Intergenic
1109914272 13:68960097-68960119 TGGGGCCACAAATTTAAATGAGG + Intergenic
1112827654 13:103410601-103410623 CAGGCTCCTAAATTGAAATTAGG - Intergenic
1113068846 13:106398771-106398793 CAGGCCCACAAATCTCAATTTGG + Intergenic
1113400519 13:109988427-109988449 CAGGCTGTCAAATTTACTTGGGG + Intergenic
1114822291 14:26035533-26035555 CAGAGTAACAAAATTAAATGTGG - Intergenic
1115906101 14:38204852-38204874 CAAGCTTACAAATTTATAAGAGG + Intergenic
1117618187 14:57555641-57555663 CAGCCTCACCATTATAAATGTGG + Intergenic
1119632324 14:76243832-76243854 CAGGCACACAAAGTATAATGTGG - Intronic
1120163720 14:81171998-81172020 CATGCTCACATATTTAAAGTGGG + Intergenic
1120265836 14:82249676-82249698 CAGGCTCAGAAAATCAAATTTGG - Intergenic
1120501036 14:85297616-85297638 CAGCTTCACAAATTTAAAAGTGG + Intergenic
1121730344 14:96182364-96182386 CAGGATCACAAATATAAAACAGG + Intergenic
1121953358 14:98191909-98191931 CAGGCTCTCAAAATGGAATGGGG + Intergenic
1127528971 15:59823355-59823377 CAGGCTCATATATTTAGATTGGG + Intergenic
1128963636 15:72035510-72035532 CAGTCTCAAAACTTTACATGTGG + Intronic
1130827998 15:87569104-87569126 CAGTCTCAGAAATTTAAAAGAGG + Intergenic
1131783974 15:95891531-95891553 CAGGCCCAGATATTTAAATTTGG + Intergenic
1134211960 16:12285028-12285050 CAGGCTCAGAAAAGTAACTGAGG - Intronic
1141384083 16:83603401-83603423 CAGGCTCACACAGTCAAATCAGG - Intronic
1143226597 17:5309979-5310001 GTGGCTCTCAAATTCAAATGTGG + Intronic
1145283085 17:21482521-21482543 AAGGCTTACAAATTTTCATGTGG + Intergenic
1145394398 17:22483279-22483301 AAGGCTTACAAATTTACATGTGG - Intergenic
1146913319 17:36661937-36661959 CATGCACACATATGTAAATGTGG + Intergenic
1153712345 18:7812416-7812438 CAGTCCCACAAATGTGAATGGGG - Intronic
1154461272 18:14590247-14590269 CAGCAACACAAATTAAAATGTGG + Intergenic
1155441124 18:25863855-25863877 CAGGCTCTCCAAATTAATTGAGG - Intergenic
1162815158 19:13189684-13189706 CAGGCTAGAAATTTTAAATGTGG + Intergenic
925494551 2:4432246-4432268 CAGCCTAACAACTTTTAATGAGG - Intergenic
926050455 2:9741127-9741149 CAGGATCACAAATGGAATTGTGG - Intergenic
926352831 2:12012395-12012417 CAAGCTCACAAATCTAGAAGTGG - Intergenic
926668547 2:15552017-15552039 CAGGATCACAGATTTAAAATAGG - Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930463669 2:51716606-51716628 ACTCCTCACAAATTTAAATGAGG - Intergenic
930776244 2:55173702-55173724 CAAGATTACAAAGTTAAATGAGG - Intergenic
933751584 2:85605678-85605700 CAGGCTCACAAATTTAAATGAGG - Intronic
934514413 2:94977154-94977176 CAGGCTCAGAAAGTTAAAAAGGG + Intergenic
934690688 2:96356577-96356599 CAGGCTCAGAGAGTTTAATGGGG + Intronic
935551209 2:104457533-104457555 ATGGATCACAAGTTTAAATGTGG - Intergenic
935984144 2:108655923-108655945 TAAGCTCACAACTTTGAATGAGG - Intronic
936136580 2:109899577-109899599 TAAGCTCACAACTTTGAATGAGG - Intergenic
936208117 2:110471908-110471930 TAAGCTCACAACTTTGAATGAGG + Intronic
936819835 2:116506930-116506952 CAATCTCACAAGTTTGAATGAGG - Intergenic
938566539 2:132523845-132523867 CAAGCTCTCAAGATTAAATGAGG + Intronic
940910101 2:159202994-159203016 CAGGCTCACACACTTGAGTGTGG - Intronic
941051873 2:160743796-160743818 CATTCTCACAAATTTAATTTTGG - Intergenic
941318828 2:164029635-164029657 CAGGCTAACTAATGAAAATGAGG + Intergenic
942038471 2:172034349-172034371 CACGATCACAAATTTACAAGTGG - Intronic
1170941268 20:20849973-20849995 CAGCCTCACAACTCAAAATGTGG + Intergenic
1171945873 20:31377167-31377189 CAGGCACATGAATTTTAATGAGG + Intronic
1172440707 20:34964472-34964494 CAGGCTGACAACTCTAGATGTGG + Intergenic
1174696288 20:52562421-52562443 ATGGCTCACAAATTGAATTGTGG - Intergenic
1175101858 20:56584959-56584981 GTGGCTCTCAAATGTAAATGTGG - Intergenic
1180236324 21:46461344-46461366 CAGTCTGACAAACTTAAATTAGG + Intronic
1182745986 22:32605870-32605892 AGGGCTCACAACTGTAAATGTGG - Intronic
951158611 3:19387174-19387196 TAGGGTCACAGAATTAAATGTGG - Intronic
951956402 3:28259466-28259488 CAGGCTCCTATAATTAAATGTGG + Intronic
951981615 3:28573209-28573231 CTGGCTCTTAAACTTAAATGTGG + Intergenic
955497897 3:59555269-59555291 CAAGCTCAGAAATGTCAATGTGG - Intergenic
957652504 3:83026188-83026210 TATGTTCACAAATTTAAAAGAGG - Intergenic
957716561 3:83935989-83936011 GAGGCCAGCAAATTTAAATGGGG + Intergenic
960287158 3:115842591-115842613 CAGGCACACAAGTTTACATGAGG + Intronic
960382190 3:116977097-116977119 AAGGCTTACAAATTAAGATGGGG - Intronic
961827778 3:129607579-129607601 CAGGGTCAGATATATAAATGAGG + Intergenic
962402912 3:135076976-135076998 CATGCTCTAAAATTTAATTGTGG + Intronic
962431540 3:135325075-135325097 CAGGCTGCCATATTTAAAGGAGG - Intergenic
962996925 3:140638571-140638593 AAGGATCAGAGATTTAAATGTGG - Intergenic
964481387 3:157142017-157142039 CCGGCTAATCAATTTAAATGTGG + Intergenic
964721760 3:159774138-159774160 CAGCCCTACAAATTTAACTGGGG - Intronic
964878953 3:161402158-161402180 CAGGCTTCAAAATTTAAAGGAGG + Intergenic
966096540 3:176211301-176211323 CAAGGTCACAAAATTAGATGTGG - Intergenic
966502178 3:180655608-180655630 CAGGCTTACAAACATGAATGGGG + Intronic
967861957 3:194159179-194159201 CACGCTCCCATTTTTAAATGAGG - Intergenic
969410031 4:7022022-7022044 CTGGCTTTCAAATCTAAATGTGG + Intronic
970933465 4:21540402-21540424 CATGCTCACAATTTTAGCTGTGG - Intronic
972945713 4:44252839-44252861 CAGTCTCACAAATTGAAAAGAGG + Intronic
976041868 4:80896483-80896505 CAGACACACAAATTAACATGTGG + Intronic
976675928 4:87703442-87703464 CAGTCTCACATATGTAAAAGTGG + Intergenic
977274733 4:94962576-94962598 CAGGCACAGAAAGTTAAATATGG - Intronic
980668406 4:135970956-135970978 AAGACTCACAAATCTAAATTTGG - Intergenic
981126127 4:141108895-141108917 CAGGCTCTGAAATTTCACTGGGG + Intronic
982661600 4:158213908-158213930 CAGGATCACAAAGCTAATTGTGG - Intronic
984280585 4:177665846-177665868 CAAGTTCACACATTAAAATGAGG - Intergenic
989180934 5:38576160-38576182 GAGGTTCACAACTTTAAATTTGG - Intronic
992667331 5:79023392-79023414 AAGCCTTACAAATATAAATGAGG - Intronic
994569160 5:101491555-101491577 CAGCTTCACAAAATTAAAAGGGG - Intergenic
995633030 5:114154491-114154513 CAGGCTCAGAAATTTGATTTTGG + Intergenic
995730967 5:115241429-115241451 CAGGCTTCCAGATTTCAATGTGG - Intronic
996343780 5:122467906-122467928 CAGAATCACAAAATTAAAAGTGG - Intergenic
996523250 5:124450488-124450510 CAGGATCTCAAATCTCAATGGGG + Intergenic
997273412 5:132561620-132561642 CAGGGTCAAATATATAAATGTGG - Intronic
997996381 5:138590077-138590099 AAGGTTCACAAATCTAAATGAGG - Intergenic
998768077 5:145510758-145510780 AAGCCTCACAAATTTAACTAAGG + Intronic
999582135 5:153050617-153050639 CAGGCTCACAAGGTTGCATGAGG - Intergenic
1000526231 5:162361598-162361620 CAGGCTCACAGTTTTCAAGGAGG - Intergenic
1001467911 5:171985335-171985357 CACGCTCAAAAACTTACATGTGG + Intronic
1003258440 6:4494337-4494359 CAAGCTCACAAAAAGAAATGGGG + Intergenic
1006129209 6:31859134-31859156 CAGGCTCACAAGGATACATGAGG + Exonic
1006251979 6:32795256-32795278 TTGGGTCACAAATTTCAATGGGG - Intergenic
1006847522 6:37072848-37072870 CAGGCTCAGAAATTCAAGTAGGG - Intergenic
1008886836 6:56440588-56440610 CAGGCTGACTCATTAAAATGAGG + Intergenic
1010261175 6:73818832-73818854 CAGGCTCTCAAATTCAGATCTGG - Intronic
1014408744 6:121087412-121087434 TAGGCTCAAGATTTTAAATGAGG - Intronic
1016867686 6:148784242-148784264 CAGGCTCAGAAACTTAAGTGGGG - Intronic
1017367242 6:153658104-153658126 CAGGCTAATCAATTTACATGTGG + Intergenic
1020515753 7:9116735-9116757 CAAGCTCACAAATTTTTAAGAGG - Intergenic
1022181973 7:27929404-27929426 CAGGCTCACAGAATGAAGTGAGG + Intronic
1022965139 7:35465528-35465550 CATGCTCATATATTTTAATGAGG - Intergenic
1024331109 7:48156227-48156249 CAGGAGCCCAAATTTAAATGTGG + Intergenic
1024835896 7:53518331-53518353 CAGGCAAACAAAATAAAATGAGG - Intergenic
1024906259 7:54384865-54384887 TAAGCTCACAAATATAAATAAGG + Intergenic
1026433790 7:70375359-70375381 CAGGTACACACATTTTAATGTGG - Intronic
1027755538 7:82206698-82206720 CAGGATCCCAAATTTAAAATAGG + Intronic
1028509573 7:91609205-91609227 CAGTATTACAAATTGAAATGGGG - Intergenic
1028733240 7:94177558-94177580 CAGGCACACAGATATGAATGTGG + Intergenic
1030591496 7:111488027-111488049 CAGGCACAAAAATTTGACTGGGG + Intronic
1031586454 7:123536114-123536136 AAGGCACACAAAGTTTAATGAGG + Intergenic
1032220851 7:129993000-129993022 TAGGCTCTCAAGTTTAAAAGGGG + Intergenic
1032479173 7:132232851-132232873 CAGGCAAACAAATTTCAATTTGG + Intronic
1033888802 7:145982081-145982103 CAGGCTGAGAGATTTTAATGTGG - Intergenic
1041712830 8:60909564-60909586 CACACAAACAAATTTAAATGTGG + Intergenic
1043577026 8:81669629-81669651 CAGGCTCACAAATGAGACTGTGG + Intronic
1044379067 8:91512095-91512117 CAGGCTCACAAATGAACATTTGG + Intergenic
1044813633 8:96088863-96088885 CCAGCTCACAAATTTAAAAGAGG + Intergenic
1045815180 8:106270362-106270384 CAGCCTCACAAACTTACTTGCGG - Intronic
1046447932 8:114347503-114347525 AAGATTCAGAAATTTAAATGAGG + Intergenic
1050602060 9:7262923-7262945 CAGCCTCACAAATATCATTGAGG + Intergenic
1050757699 9:9027940-9027962 CAGGCTAAAAAAACTAAATGTGG - Intronic
1056433361 9:86550659-86550681 CAGGCTCAGGAATTAAGATGGGG + Intergenic
1058165357 9:101612646-101612668 CAGGCTCAGATATTTAAAAGAGG - Intronic
1060609713 9:124951936-124951958 AAGTCTCATAAATTTGAATGAGG + Intronic
1187440965 X:19319305-19319327 CAGGCTCACATACATGAATGGGG + Intergenic
1188183816 X:27088954-27088976 AAGACTCACAACCTTAAATGAGG - Intergenic
1188387414 X:29578052-29578074 GAGGCCCACTAATCTAAATGAGG + Intronic
1190480633 X:50873218-50873240 CATGCTCACAAATAAAAATCAGG - Intergenic
1190840946 X:54143647-54143669 CAGGCTCTGAAATTAAATTGAGG + Intronic
1194614514 X:96085067-96085089 AATGCACACATATTTAAATGTGG + Intergenic
1194733126 X:97479578-97479600 AGGGCTCACAAAGTTAATTGGGG - Intronic
1196202086 X:112897988-112898010 CAAGATCACACATTTAAGTGGGG - Intergenic
1197473060 X:126886443-126886465 CAACCTCCCAAATTTAAATCAGG + Intergenic
1198850911 X:140964748-140964770 CTGGCTGATGAATTTAAATGGGG + Intergenic
1202117546 Y:21485198-21485220 TAGGCTAAAAATTTTAAATGAGG - Intergenic