ID: 933752437

View in Genome Browser
Species Human (GRCh38)
Location 2:85611703-85611725
Sequence TTGCGGGGCCGCGTCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933752426_933752437 18 Left 933752426 2:85611662-85611684 CCTCACCTCGGTGTCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103
933752434_933752437 -9 Left 933752434 2:85611689-85611711 CCTGCAGGTCTGGCTTGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 138
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103
933752428_933752437 13 Left 933752428 2:85611667-85611689 CCTCGGTGTCGCGGCAGGTACAC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933752437 Original CRISPR TTGCGGGGCCGCGTCGGCGC GGG Exonic
900135661 1:1115980-1116002 CTGGGCGGCCGGGTCGGCGCAGG - Intronic
900166584 1:1246464-1246486 TCGCGGGGCAGCTTCGGAGCTGG - Intronic
900540091 1:3198229-3198251 TTAAGGGGCCAGGTCGGCGCAGG + Intronic
900581717 1:3412835-3412857 GGGCGGGGCCGCGGCGGTGCTGG + Intronic
900786882 1:4655084-4655106 TTGCTGCGCCGCGACAGCGCCGG + Exonic
905414383 1:37794390-37794412 GTGCGGGGCGGCGGCGGCGGCGG - Exonic
905580680 1:39081299-39081321 GCGGGGGGCGGCGTCGGCGCTGG + Intronic
906545501 1:46616855-46616877 TGGCGGGGCCGGGGCGGAGCTGG - Intronic
906640676 1:47438867-47438889 TGGCGGGGCCGCGGCGGCGGGGG + Exonic
911027180 1:93448085-93448107 AGGCGGGGACGCGTCGGCGGCGG + Intergenic
912518433 1:110229976-110229998 TGGCAGGGCAGCGTCGGGGCTGG + Intronic
915977569 1:160400874-160400896 GTGCCGGGCCGCGGGGGCGCGGG + Intronic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
1070234475 10:74609165-74609187 TTGCTGGGCTCCGTCGGGGCAGG + Intronic
1072493713 10:95934307-95934329 TTGCGGGGCTCCGTCGGGGTGGG + Intronic
1075430296 10:122374764-122374786 AGCCGGGGCCGCGGCGGCGCGGG + Exonic
1076373903 10:129971347-129971369 CTCCGGGGGTGCGTCGGCGCGGG + Intergenic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1081938113 11:46918537-46918559 TGGCGGGGCAGCGTCGGCTCTGG - Exonic
1083744955 11:64730205-64730227 TTGCGGGGGCGCTTCAGCTCGGG + Intronic
1084208290 11:67608649-67608671 TTGAGGGGCCGTGGAGGCGCTGG + Exonic
1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG + Intergenic
1098275685 12:68808787-68808809 CTGCGGGGCCGCTTCGGCGCGGG + Intronic
1098342958 12:69470561-69470583 CCGCGGGCCCGCGTCGGAGCTGG + Intronic
1101970720 12:109310084-109310106 GGGCGGGGCAGCGGCGGCGCGGG - Intergenic
1102679697 12:114683055-114683077 TTGGGAGGCAGCGTCAGCGCGGG + Exonic
1104891789 12:132143776-132143798 ATCTGGGGCCGCCTCGGCGCTGG + Exonic
1105031495 12:132887432-132887454 CTGCGGGGCTGCGTGGGCGCGGG - Intronic
1110630144 13:77698065-77698087 GTGCGGGGCGGCGGCCGCGCTGG - Intronic
1118276174 14:64387997-64388019 TTGCGGGGCGGGGTTGGGGCGGG - Intergenic
1120905659 14:89619067-89619089 TTGGGGGGCTGCGGCGACGCTGG + Exonic
1121343120 14:93116431-93116453 GTGCGGGTCAGCGTCGGCGCCGG + Intergenic
1121546933 14:94769697-94769719 CTGCGGGGCCGTGCCGCCGCTGG - Exonic
1122895180 14:104753221-104753243 TAGCGGGGCCACGTCCGCGAAGG - Exonic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1127995696 15:64152108-64152130 TTGCGGCGCCGCGGCTGCCCGGG - Intronic
1133156560 16:3880452-3880474 TGGGGGGGCCGCGGCGGCGGCGG - Exonic
1133802122 16:9092353-9092375 TCGGGGGGCCGCGACGGCGGCGG + Intronic
1136526437 16:30834384-30834406 GTGCGGGGCGGCTTCTGCGCTGG + Exonic
1138561277 16:57802284-57802306 TTGGGGCGCCGCGTCCGGGCCGG - Intronic
1139390803 16:66605364-66605386 CTGCGGGGCCGAGCCGGCGGGGG + Intronic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139954324 16:70686027-70686049 TCGCGGCGCAGCCTCGGCGCGGG + Exonic
1142764329 17:2057105-2057127 CTGCGGGGCGGCGGCGGCGGCGG + Exonic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1147684122 17:42276667-42276689 TTGCGGTGCGGCGTCGGCTAGGG - Intronic
1148615786 17:48998504-48998526 TGGCGCGGCGGCGGCGGCGCCGG + Intronic
1152654407 17:81513165-81513187 GGGCGGGGCCGCGCCGGAGCTGG + Intronic
1152817855 17:82418719-82418741 TCGCGGGACCGCGGCGGCGCAGG + Exonic
1153284879 18:3448476-3448498 TTGCAGGGCAGCGTCCGGGCGGG + Intronic
1153636649 18:7118121-7118143 CTGCAGGGCCGCGGCGGGGCGGG - Intergenic
1160053154 18:75455611-75455633 CTGCGGGGCCCTGTCGGCGGTGG + Intergenic
1160867087 19:1260767-1260789 TCGCGGGGCGGGGTCGGCCCTGG + Intronic
1160930665 19:1568192-1568214 GGGCGGGGCGGCGGCGGCGCGGG + Intergenic
1160991814 19:1863267-1863289 GTGGGGCGCCGCGGCGGCGCCGG + Exonic
1163509455 19:17726407-17726429 CTGCGAGGCCGCGTCGCGGCTGG + Exonic
1163634964 19:18433474-18433496 GGGCGGGGGCGCGTCGGCGGGGG + Intronic
1164648101 19:29873618-29873640 GCGCGGGGCCGGGTCGGAGCGGG - Intergenic
1166931416 19:46303774-46303796 GTGCTGGGCCGCGGCTGCGCAGG - Intronic
1167042739 19:47032279-47032301 CTGCGGGGCCGCGGCGGCCTGGG - Exonic
1167679321 19:50909635-50909657 TTGGGGGGCCGAGTCAGGGCTGG + Intronic
1168100469 19:54138459-54138481 TTGTGGGGCAGCCTCCGCGCCGG + Intronic
925976063 2:9142921-9142943 TCGCGGGGCAGAGGCGGCGCCGG - Intergenic
927591336 2:24360492-24360514 TTGTGGGGCTGAGGCGGCGCCGG - Exonic
932201272 2:69830170-69830192 GTGCGGGTCCGGGTCCGCGCGGG - Intronic
933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG + Exonic
934296818 2:91749024-91749046 TGGCCGGGCCGCGGCGGCGGCGG - Intergenic
935622831 2:105144111-105144133 CTGCGCGGCCGCGGCGCCGCCGG - Intergenic
936433226 2:112482117-112482139 AGGCGGGGCCGCGCCGGCGGGGG + Intergenic
938058478 2:128234037-128234059 TTGCAGGGCCTCCTAGGCGCAGG - Intergenic
940009518 2:149038941-149038963 TCGCGGGGCCGCGGGGCCGCGGG + Intronic
940748450 2:157597196-157597218 ATGCAGGGCCGCGTCGCAGCAGG - Intronic
947674082 2:231961727-231961749 CTGCGGGACTGCGGCGGCGCCGG + Exonic
1172644551 20:36461622-36461644 TCGCGGGGCCGCGGCTGCTCCGG - Intronic
1178534967 21:33403593-33403615 TGGCGGGGCCGCGGCGGCGGCGG - Exonic
1178555769 21:33588731-33588753 AGGCGGGGCCGCGTCGGGGGCGG - Intronic
1179561579 21:42219186-42219208 CTGCGGGGCCGAGGCTGCGCTGG - Exonic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1181902679 22:26169319-26169341 TGGAGGGGCCGCGGCGGCGCCGG - Intergenic
1183301276 22:37060316-37060338 TTGCAGGGCAGCGTCAGCCCTGG - Intronic
950046629 3:9952104-9952126 TTGCGGGGCAGCCTCGGAGCTGG + Intronic
950902993 3:16513695-16513717 CGGCGGGGGCGCGTCGGGGCTGG - Exonic
954779001 3:53045749-53045771 TGGAGGGGCGGCGGCGGCGCCGG - Intronic
961222631 3:125212498-125212520 GTGCGGGTCCGCGTCTGCGTGGG - Intronic
967922343 3:194622788-194622810 TTGCGAGGCCGAGGCGGGGCGGG - Intronic
968850490 4:3074620-3074642 AGGCGGGGCCGCGCCGGCGGAGG - Intergenic
969113958 4:4859997-4860019 TGCCGTGGCCGCGGCGGCGCTGG - Exonic
970456348 4:16226985-16227007 TGGCGCGGCCGCGGCGGCGGGGG + Intronic
973137313 4:46724418-46724440 TCGCTGGGCCGCGGCGGCGGCGG + Intergenic
981093459 4:140756281-140756303 TCGCGGGGCGGCGACGCCGCGGG - Intergenic
986330621 5:6713928-6713950 GGGCGGGGCCGCGTCGGGGCGGG + Intergenic
989571617 5:42951181-42951203 TTACCGGGCGGCGGCGGCGCTGG - Intergenic
998501368 5:142635725-142635747 TTGCTGGGCTGAGTCGGGGCTGG + Intronic
1002754698 6:148157-148179 GTGCGTGCCCGCGCCGGCGCGGG - Intergenic
1020238527 7:6374704-6374726 TCGCTGGGCCGCGGCGGCGGCGG - Exonic
1025174004 7:56787650-56787672 TGGCGGGGCCGCGAGGTCGCCGG - Intergenic
1025698097 7:63790305-63790327 TGGCGGGGCCGCGAGGTCGCCGG + Intergenic
1025829776 7:65038687-65038709 TTACGGGGTCGGGTCGGGGCCGG + Intergenic
1032238004 7:130141245-130141267 GTGCGGGGCCGCCTCTTCGCGGG - Intergenic
1033657003 7:143381360-143381382 TCGGGTGGCCGCCTCGGCGCCGG - Exonic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1041552600 8:59118800-59118822 TGGCCGGGCCGCGGCGGGGCCGG - Intronic
1045443631 8:102239060-102239082 AGGCGGGGCCGGGCCGGCGCAGG - Exonic
1048980949 8:139703228-139703250 TGGCGGGGCAGGGGCGGCGCGGG + Intergenic
1049665439 8:143840797-143840819 TCCCGGGCCCGCCTCGGCGCCGG + Exonic
1051170110 9:14313318-14313340 TCGCGGGGCGGCGTGGGAGCCGG - Intronic
1053029326 9:34760678-34760700 TGGCGGGGCCGAGACGTCGCAGG - Intergenic
1062022520 9:134326234-134326256 TCGCGGGGCGGCGGCGGCGGAGG + Intronic
1062022726 9:134326844-134326866 TCGCGGGGCCGGGGCGGGGCTGG + Intronic
1187507289 X:19887799-19887821 GGCCGGGGCCGCGTCGGGGCAGG + Intergenic
1198767085 X:140091313-140091335 CTGCGGGGCCGCAGCGGCGGCGG + Intergenic
1198871050 X:141177247-141177269 TGGGGGGGCCGCGGCGGCGTGGG + Intergenic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1200267313 X:154653299-154653321 TGGCGGTGCCGCTTCTGCGCAGG - Exonic