ID: 933752437

View in Genome Browser
Species Human (GRCh38)
Location 2:85611703-85611725
Sequence TTGCGGGGCCGCGTCGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933752426_933752437 18 Left 933752426 2:85611662-85611684 CCTCACCTCGGTGTCGCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103
933752434_933752437 -9 Left 933752434 2:85611689-85611711 CCTGCAGGTCTGGCTTGCGGGGC 0: 1
1: 0
2: 0
3: 16
4: 138
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103
933752428_933752437 13 Left 933752428 2:85611667-85611689 CCTCGGTGTCGCGGCAGGTACAC 0: 1
1: 0
2: 0
3: 3
4: 25
Right 933752437 2:85611703-85611725 TTGCGGGGCCGCGTCGGCGCGGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933752437 Original CRISPR TTGCGGGGCCGCGTCGGCGC GGG Exonic