ID: 933754667

View in Genome Browser
Species Human (GRCh38)
Location 2:85628838-85628860
Sequence CTTTAACCACAGAGGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933754667_933754671 11 Left 933754667 2:85628838-85628860 CCTAATCCCCTCTGTGGTTAAAG 0: 1
1: 0
2: 0
3: 13
4: 162
Right 933754671 2:85628872-85628894 TTCTGAGTTGTCTTCCTTAGAGG 0: 1
1: 0
2: 1
3: 21
4: 209
933754667_933754672 18 Left 933754667 2:85628838-85628860 CCTAATCCCCTCTGTGGTTAAAG 0: 1
1: 0
2: 0
3: 13
4: 162
Right 933754672 2:85628879-85628901 TTGTCTTCCTTAGAGGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146
933754667_933754673 19 Left 933754667 2:85628838-85628860 CCTAATCCCCTCTGTGGTTAAAG 0: 1
1: 0
2: 0
3: 13
4: 162
Right 933754673 2:85628880-85628902 TGTCTTCCTTAGAGGTGCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933754667 Original CRISPR CTTTAACCACAGAGGGGATT AGG (reversed) Intronic
900469527 1:2846784-2846806 CTAAAACCAAAGAGGGGCTTAGG + Intergenic
901496658 1:9626327-9626349 CTTTGACCACAGAGGAGAGAGGG + Intergenic
902405945 1:16183698-16183720 CTTTACTCAAAGAGGGGAGTGGG - Intergenic
902662143 1:17912588-17912610 GTTTCCCCACAGGGGGGATTAGG - Intergenic
902748842 1:18492530-18492552 CTTTAACCACAGGGATGAATGGG + Intergenic
904449408 1:30601321-30601343 CTTTCAGCAGAGAGGGGATGCGG - Intergenic
905417710 1:37815720-37815742 CTTTTACCTCAGAGGGCATGTGG - Intronic
907297980 1:53467655-53467677 CTTTATCAAGTGAGGGGATTGGG + Intergenic
907324690 1:53629307-53629329 TGTGAAGCACAGAGGGGATTGGG - Intronic
909640686 1:77868596-77868618 ATTTAAGTACAGAGGGAATTTGG - Intronic
914440400 1:147700433-147700455 ATTTAACCACAGAGGGTTTGTGG + Intergenic
915081774 1:153357539-153357561 CTTCAACCTCAAAGGGGATGGGG + Intergenic
915558671 1:156674237-156674259 CTTGAACCAAAGAGGGGAGCAGG + Intronic
917661101 1:177177951-177177973 CTTTAACCAAAGCAGGAATTTGG - Intronic
918397426 1:184128973-184128995 CTTGAACAACACAAGGGATTAGG + Intergenic
921896821 1:220410439-220410461 CTTTCACCAGACAGGGGATGTGG + Intergenic
924931094 1:248733074-248733096 TTTTAGCCACAGTGGGGACTTGG - Intronic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1065064564 10:21947671-21947693 CTTGAACAACAGAGGGGTTAGGG - Intronic
1067550707 10:47233703-47233725 CTTTAACAACTGAGGGGAATTGG - Intergenic
1067580157 10:47439672-47439694 CTTTATCCTAAGAGGGGCTTTGG + Intergenic
1069082261 10:64100995-64101017 CTATAATCCCAGAAGGGATTGGG - Intergenic
1072389892 10:94972511-94972533 TTTTTACTACAGATGGGATTTGG - Intronic
1075045256 10:119141241-119141263 CTTTTATCACAGAGGGGTGTAGG - Exonic
1075233199 10:120702154-120702176 ATTTAAGCCCAGAGGGCATTTGG + Intergenic
1076267669 10:129121497-129121519 CTGGAACCACAGTGGGGCTTGGG + Intergenic
1079420992 11:20287897-20287919 CTGGAACCACAGGGGGGATTAGG - Intergenic
1084475709 11:69387480-69387502 CTTTAACCTCAGATGGGCCTGGG + Intergenic
1086087473 11:82970397-82970419 TTTTAACCACTAAGGGAATTTGG - Intronic
1090083875 11:123633843-123633865 CTTTGACCAAAGAAGGGAGTTGG + Intronic
1093118259 12:15237006-15237028 TTTTAACCACAGAGGAAACTGGG + Intronic
1096154746 12:49335776-49335798 ATTTACCCACAGAGGAAATTGGG - Intronic
1098501767 12:71201304-71201326 CCTTGAACAAAGAGGGGATTAGG - Intronic
1098870856 12:75815361-75815383 GTTTAACCTCAGGGGGCATTTGG - Intergenic
1099414201 12:82367429-82367451 CTTAAACCACTGAGGTGATGAGG - Intronic
1100074118 12:90757408-90757430 TTGTAGCCACAGAGGAGATTAGG - Intergenic
1102233717 12:111281168-111281190 CATTATCAACAGAGGGGCTTTGG + Intronic
1103193978 12:119026061-119026083 CTTCAACCACAGAGGGCACCAGG - Intronic
1103360863 12:120352984-120353006 CTTCCACCAGAGAGGGCATTGGG - Intronic
1103505564 12:121440659-121440681 CTTCAGGCACAGAGGGGATCTGG - Intronic
1103775413 12:123363902-123363924 GTTTAACCGCTGAGGAGATTTGG - Intronic
1104751161 12:131240036-131240058 CTTAAACAACTGAGGGCATTGGG - Intergenic
1108463058 13:50686746-50686768 CTCTAACCACAGAGAAGATGAGG - Intronic
1109979490 13:69888253-69888275 ATATAACCACAATGGGGATTAGG + Intronic
1113147882 13:107229008-107229030 CTTAAACCACAGAGGATAATCGG - Intronic
1113301144 13:109020671-109020693 CATTAACTACAGCTGGGATTTGG - Intronic
1118004247 14:61551445-61551467 CTCTAACTACAGACGGGATAGGG + Intronic
1118375005 14:65169227-65169249 CTTTAGCCACAGAGGAGGCTGGG - Intergenic
1118718156 14:68574953-68574975 CTCTAACCTCAGAGTGGATTTGG - Intronic
1119751499 14:77081478-77081500 CTTTAGCCACAGAGAGTATCTGG - Intergenic
1120085255 14:80264658-80264680 CTTTAATCACTGAGGGGCTAAGG + Intronic
1122318167 14:100837717-100837739 CTTTAATCAAACAGAGGATTTGG + Intergenic
1122870459 14:104635854-104635876 CCTCAACCTCAGAGGGGATGTGG - Intergenic
1126221457 15:46219037-46219059 CTTTCACCACAGACATGATTTGG - Intergenic
1128028499 15:64460186-64460208 CTTCAACCACAGAGAGGAAAGGG - Intergenic
1128323949 15:66711506-66711528 CTTTAACTGTTGAGGGGATTTGG + Intronic
1128360768 15:66960014-66960036 CATTCACCACAGAGGGTCTTTGG + Intergenic
1133446799 16:5868206-5868228 CTTTAACCACACAGTGGCTCAGG - Intergenic
1135392959 16:22109459-22109481 CTAAAACCAAAGAGGGCATTTGG - Intronic
1136186677 16:28592512-28592534 CTCTAACCTCAGAGGGGAACTGG + Intronic
1136189302 16:28606306-28606328 CTCTAACCTCAGAGGCGATCTGG + Intronic
1136317732 16:29464088-29464110 CTCTAACCTCAGAGGGGATCTGG - Intronic
1136432307 16:30203433-30203455 CTCTAACCTCAGAGGGGATCTGG - Intronic
1141322054 16:83020388-83020410 CTTTTCCCACAGAGGGCAGTGGG - Intronic
1141836288 16:86541925-86541947 CCTTAGCCCCAGAGTGGATTTGG - Intronic
1143219800 17:5251988-5252010 CTTTAACAACACAGGGGTTAGGG - Intergenic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1153077607 18:1183163-1183185 CTTTATCCAAAGAGGAGATGGGG + Intergenic
1153792169 18:8588453-8588475 CTTTAACCACAGTGGGAAAGAGG - Intergenic
1155384386 18:25261341-25261363 CGTTGACCACAGAGGGTATGGGG - Intronic
1157814409 18:50720566-50720588 CTTCAACCACAGCGGGGGTGGGG - Intronic
1160614100 18:80110522-80110544 CTTTATCAAAAGAGGGGGTTTGG + Intronic
1164464433 19:28475562-28475584 CTTCCATCACAGTGGGGATTAGG - Intergenic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1166901854 19:46070600-46070622 TTTTCACCTAAGAGGGGATTGGG - Intronic
1167198045 19:48044194-48044216 CTTTATCCCCAGAGTGGAATTGG + Intergenic
1168112054 19:54198386-54198408 CTGTAACCCCAGGTGGGATTTGG - Intergenic
925707026 2:6695584-6695606 ATTTAACAATAGATGGGATTAGG + Intergenic
926054645 2:9767446-9767468 TTTGAACAACAGCGGGGATTAGG - Intergenic
930376747 2:50576867-50576889 ACTTAACCACAGAGGAGGTTGGG - Intronic
931588432 2:63854280-63854302 CTTTAGACATAGAGTGGATTGGG - Intronic
932139903 2:69266314-69266336 CCTTAGCCTCAGAGGAGATTGGG - Intergenic
932150867 2:69370553-69370575 CTTTAAGCAGAGAAGTGATTCGG + Intronic
933444677 2:82364897-82364919 CTTTAAGCAGGGAGGGGATGTGG + Intergenic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
937181592 2:120001039-120001061 CAGTAACCACAGAGGCCATTGGG - Intergenic
937353722 2:121185134-121185156 CTTTAAGCACAGAGAGGATGTGG + Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
941730336 2:168910478-168910500 CATTACCCTCAGAGGGGACTGGG + Intronic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
943985445 2:194612089-194612111 CTTTCAGCAGAGAGGGGATGTGG - Intergenic
944940545 2:204620481-204620503 CTTTAACATCAGAGGGGACAGGG + Intronic
947291853 2:228584185-228584207 CTTTTATCCCAGAGGGGATTTGG - Intergenic
948261202 2:236605727-236605749 CTTTATACAAAGAGGGGATTTGG - Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170974970 20:21153906-21153928 TTTAAGCCACAGTGGGGATTGGG + Intronic
1171014089 20:21524003-21524025 TATTAACCACAGAGAGAATTTGG - Intergenic
1171267149 20:23781088-23781110 TTTTAACCACAGTGGGTGTTAGG + Intergenic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1174873734 20:54206557-54206579 ATTTAACCAAAGAGGAAATTGGG + Intergenic
1182519608 22:30877944-30877966 CTGTAACCACATAGGTGATATGG + Intronic
1182540325 22:31036730-31036752 CTTTACCCCCAGGGGGCATTTGG + Intergenic
1182609760 22:31537345-31537367 CTTTAGCTACAGAGGAGGTTTGG + Intronic
953167634 3:40479429-40479451 CTACAACCACAGATGAGATTGGG - Intronic
953735095 3:45487143-45487165 CTGTAACCACAGAATGTATTTGG - Intronic
954946603 3:54430826-54430848 CTTAAACAACACAGGGGCTTAGG + Intronic
956084000 3:65590263-65590285 CTTTACCCTCACAGGGGAATTGG - Intronic
956725800 3:72155588-72155610 CTTTAACAACAGATGTGATGTGG - Intergenic
959438375 3:106345769-106345791 CTTTAACTACACAGAGAATTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960225668 3:115165353-115165375 CTTTAACCAGAATGGGGATGTGG + Intergenic
961665823 3:128492719-128492741 CTTTAACCAGAGGGAGTATTTGG - Intronic
962506628 3:136052842-136052864 CTTTAACTTCAGAAGGGCTTGGG - Intronic
964786101 3:160398489-160398511 CTTTAACAATATAGGGAATTAGG + Intronic
966706376 3:182920316-182920338 CTTTAAAAACGGAGTGGATTTGG - Exonic
970008465 4:11432359-11432381 CTTTATCCACAAAGGAAATTGGG + Intergenic
970478592 4:16450554-16450576 CTTTAGGCACAGAAGGGCTTAGG - Intergenic
971498776 4:27296347-27296369 CTTTTAACACAGAAGAGATTGGG - Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972553805 4:40160944-40160966 CTTTATCCTCAGTGGGGATGGGG + Intergenic
981491006 4:145339452-145339474 CTTTCACCACAGAAGCCATTTGG - Intergenic
982967422 4:161930330-161930352 ATTCAACCATAGAGGGGTTTGGG - Intronic
983321949 4:166205989-166206011 CTTTAGCCCTAGAGGAGATTGGG + Intergenic
984423774 4:179557908-179557930 CTTAAACCACACAGGGGTTAGGG + Intergenic
989459533 5:41681689-41681711 TTTTAACCACATAGGTGGTTAGG + Intergenic
990519885 5:56568990-56569012 CTTTAATCACTGGGGAGATTAGG - Intronic
990797769 5:59564033-59564055 CTTTAGCTTCAGAGGGGCTTGGG + Intronic
994922300 5:106062909-106062931 CTTAAACAACATAGGGGTTTTGG - Intergenic
998432890 5:142081774-142081796 CTGCAACCACAGAGAGGAATGGG - Intergenic
1001132673 5:169077707-169077729 CTTGAACAACACAGGGGTTTGGG - Intronic
1002966564 6:1971809-1971831 TTTTAGCCACAGAGGCGAATTGG + Intronic
1005532696 6:26723242-26723264 CTTTAAAGACAGATGGGATCTGG - Intergenic
1005538099 6:26778423-26778445 CTTTAAAGACAGATGGGATCTGG + Intergenic
1006415749 6:33902963-33902985 CTGTGAGCCCAGAGGGGATTGGG - Intergenic
1006454851 6:34125788-34125810 CTCTCACCACAGTGGGGGTTTGG + Intronic
1009294720 6:61932179-61932201 CTTAAACAACATAGGGGCTTAGG - Intronic
1009990736 6:70840031-70840053 ATTGAAACACAGCGGGGATTGGG + Intronic
1009996490 6:70901034-70901056 ATTTGAACACAGAGGTGATTTGG + Intronic
1010490201 6:76466550-76466572 CTCTCAGCAAAGAGGGGATTTGG - Intergenic
1010658299 6:78538726-78538748 TTTTGAACACATAGGGGATTTGG + Intergenic
1011880593 6:92019561-92019583 CTTTAAGGAAAGAGAGGATTGGG - Intergenic
1016601593 6:145867712-145867734 CTATAACCACAGAGGTAGTTTGG + Intronic
1017866623 6:158449560-158449582 CTTTAATAACATTGGGGATTTGG - Intronic
1021927837 7:25550416-25550438 CTTTAATCCCAGAGGGGAGAAGG - Intergenic
1022035640 7:26531597-26531619 CTTTGACCACAGACTGGATGAGG - Intergenic
1022321910 7:29295834-29295856 CTTTGCCAGCAGAGGGGATTAGG + Intronic
1024413455 7:49075488-49075510 CTTGAACGACAAAGGGGGTTAGG + Intergenic
1026365616 7:69645669-69645691 TTTTCAACACTGAGGGGATTGGG - Intronic
1026913388 7:74105863-74105885 CCTTACCCACAGAGTGGATCCGG + Exonic
1030732020 7:113001773-113001795 TTTTAACCACTGTGGGTATTAGG + Intergenic
1031242943 7:119269603-119269625 CTTTAACAACAGATTGGATCAGG - Intergenic
1034309803 7:150077404-150077426 CTTTAACCACAGAGGTCACATGG - Intergenic
1034641686 7:152608950-152608972 ATTCACCCACAGAGGGGATGAGG + Intergenic
1036619755 8:10416717-10416739 CTCTAACCTCACATGGGATTCGG + Intronic
1036914224 8:12789267-12789289 ATGTAACCACAGAGGAGAATTGG - Intergenic
1040587669 8:48758472-48758494 CTTTAACTTCAGAGGGGCTATGG + Intergenic
1044845856 8:96380415-96380437 CTTTAACCTCAGTGTGGATTAGG - Intergenic
1045043706 8:98253667-98253689 CCTTTACCCCAGATGGGATTCGG - Intronic
1046150676 8:110220645-110220667 CCTTAATCACAGAGAGGATCAGG - Intergenic
1046157564 8:110312951-110312973 CTGTAAAAATAGAGGGGATTGGG + Intergenic
1046865791 8:119149087-119149109 CATGAAGCACAGAGTGGATTTGG + Intergenic
1047291287 8:123532504-123532526 CTATGAACACAGAGGGAATTGGG + Intronic
1047554595 8:125915424-125915446 CCTTATACACAGAGGGGACTCGG - Intergenic
1048246383 8:132806798-132806820 CTTTTACTACTGAGAGGATTGGG + Intronic
1048728997 8:137417047-137417069 ATTGAACAAGAGAGGGGATTAGG + Intergenic
1051390238 9:16555924-16555946 CTATAACAACAGAGGTGAATAGG - Intronic
1053376787 9:37614202-37614224 CTTGAATCAAAGATGGGATTAGG + Intronic
1057336446 9:94159333-94159355 CCTTAACCACAGAGGTGAGTGGG - Intergenic
1057825219 9:98368017-98368039 CTTCATGCACAGAGGGGATCAGG - Intronic
1059492359 9:114679331-114679353 CTTAAAGAACAGAGGAGATTTGG - Intergenic
1060245771 9:121945129-121945151 CTGTACCCACAGAGAGGAGTCGG + Intronic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1190159919 X:48024374-48024396 CTTTATGCACAAAAGGGATTTGG + Intronic
1191853066 X:65600371-65600393 GTTTAACCACAGCATGGATTAGG - Intronic
1191991968 X:67047867-67047889 ATGTAACTACAGAGGGGATAAGG - Intergenic
1192314816 X:70043368-70043390 GTTTCACACCAGAGGGGATTGGG + Intronic