ID: 933755813

View in Genome Browser
Species Human (GRCh38)
Location 2:85637635-85637657
Sequence CTGTGCTGGTTTAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933755807_933755813 27 Left 933755807 2:85637585-85637607 CCTGTCATACTAGTGCACTTTTT 0: 1
1: 0
2: 0
3: 5
4: 110
Right 933755813 2:85637635-85637657 CTGTGCTGGTTTAAGTGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 158
933755806_933755813 28 Left 933755806 2:85637584-85637606 CCCTGTCATACTAGTGCACTTTT 0: 1
1: 0
2: 1
3: 9
4: 128
Right 933755813 2:85637635-85637657 CTGTGCTGGTTTAAGTGTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933755813 Original CRISPR CTGTGCTGGTTTAAGTGTTC TGG Intronic
900480708 1:2897742-2897764 CTGTGCTGGTTTAGATGTCTTGG - Intergenic
902139897 1:14344482-14344504 CAGTGCTGGTTTAGGTGTTGGGG + Intergenic
903388954 1:22950335-22950357 CTGTGCTGGTGAAAATGTTCTGG + Intergenic
904620680 1:31773254-31773276 CTGTGCTGGGTCAACTGTGCTGG - Intergenic
904638199 1:31900960-31900982 CTGTGGTGATAAAAGTGTTCTGG - Intergenic
905497703 1:38406864-38406886 CTTTTCTGGTTTTAGTGTTAGGG - Intergenic
905855987 1:41314316-41314338 CTGTGCTGATTTAACCATTCTGG + Intergenic
907166840 1:52419665-52419687 CTGTGCTGTTTTATGTTTTGTGG - Exonic
908858252 1:68453280-68453302 CTGTGCTGCCTTTGGTGTTCTGG + Intergenic
909689421 1:78390412-78390434 CCATGCTGTTTTAATTGTTCTGG + Intronic
917171746 1:172184260-172184282 CTTTGCTTGTTTAACAGTTCAGG - Intronic
917852748 1:179079370-179079392 CTGTGCTCGTTTTAAAGTTCTGG - Intergenic
920895736 1:210047965-210047987 CTTTGCTTGTTTAAGTGGTGTGG + Intronic
921936946 1:220804304-220804326 ATGTGTTGGTTTAACTGTGCTGG - Intronic
1063477388 10:6340865-6340887 CAGTGGGGGTTCAAGTGTTCAGG + Intergenic
1066750039 10:38645340-38645362 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic
1068643085 10:59433000-59433022 CTCTGCTGTTTTAAATGTTTGGG - Intergenic
1070497103 10:77034613-77034635 CTGTGCTGGTTTAAGAGTGCAGG - Intronic
1072181111 10:92981164-92981186 TTCTTCTGGTTTAAGTTTTCTGG - Intronic
1073465304 10:103691852-103691874 GTGTCCTGGTTTATGTGTTGGGG - Intronic
1077648915 11:3951902-3951924 GTGTGTTGGTTTAATTCTTCTGG + Intronic
1077676365 11:4196987-4197009 CTGTGCTCCTTTGTGTGTTCTGG + Intergenic
1078605688 11:12773188-12773210 CTGGGCTGATTCCAGTGTTCAGG + Intronic
1080687085 11:34524747-34524769 CTGTGCGGGTCTGAGTGTGCAGG - Intergenic
1080898657 11:36467108-36467130 AAGTGCTGGTCTCAGTGTTCAGG + Intergenic
1081601339 11:44496945-44496967 CTGTGCTCTGCTAAGTGTTCTGG - Intergenic
1088349159 11:108865289-108865311 CTATGCTGCTTGAAGTGTCCAGG + Intronic
1088531905 11:110819614-110819636 TTGTGCTGGATTAAGTGTTATGG - Intergenic
1090471960 11:126988880-126988902 CTGTAATGGTTTCAGTGTGCTGG - Intronic
1090611255 11:128472917-128472939 CTGTGTTAGTTTGAGTGTGCCGG - Intronic
1093643944 12:21561338-21561360 CTATGAAGGTTTATGTGTTCTGG + Intronic
1093753066 12:22822437-22822459 CTGTTATGGTTTAATTGTTGTGG + Intergenic
1094529263 12:31258067-31258089 CTGTGCTGGTTCACTTGTTCTGG - Intergenic
1094743634 12:33317365-33317387 TATTGCTGGTTTAAGTTTTCAGG - Intergenic
1097767144 12:63538993-63539015 CTGTGCTGTTTTAAGGATCCAGG + Intergenic
1097783492 12:63733938-63733960 CTGTGCTGTTTTAAGGATCCAGG + Intergenic
1100033235 12:90218890-90218912 CTTTGCAGGTTTAAAAGTTCTGG - Intergenic
1100818352 12:98407440-98407462 CTTTGCTGGTTTGACTGTTTGGG - Intergenic
1101868499 12:108542145-108542167 TTGTGCGTGTTAAAGTGTTCAGG - Intronic
1105452201 13:20509992-20510014 ATGTGGTGGTGTCAGTGTTCTGG - Intronic
1106362291 13:29042443-29042465 CTTTCCTGGTTTTAGTGTTAGGG + Intronic
1112950421 13:104988818-104988840 TTGTTCTGCTTTAGGTGTTCTGG + Intergenic
1115149043 14:30261858-30261880 CTGTTTTGGGTTAAGTTTTCAGG - Intergenic
1117205768 14:53441969-53441991 CTGTTTGGGTTTAAGTATTCAGG - Intergenic
1118020679 14:61710644-61710666 ATGTGATGTTTTAAGTATTCTGG + Intronic
1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG + Intergenic
1124174245 15:27407295-27407317 ATTTGCTGGTGTCAGTGTTCCGG - Intronic
1124499525 15:30214936-30214958 CTTTGCTGGATGAAATGTTCGGG - Intergenic
1124744054 15:32323725-32323747 CTTTGCTGGATGAAATGTTCGGG + Intergenic
1127817381 15:62623136-62623158 CTGTGCTGGTTAATCTGTGCGGG + Intronic
1128332500 15:66765018-66765040 CTTTGCTGGGTCAAGTTTTCAGG - Intronic
1129046245 15:72736854-72736876 GTTTGCTGGTTGAAGTGGTCTGG - Exonic
1129671455 15:77610148-77610170 CTGTGCTGCTTTCAGTCTCCTGG + Intergenic
1132119442 15:99164104-99164126 CTGTGCTGGTTTCTTGGTTCAGG - Intronic
1132472969 16:117020-117042 CTGGGGTGGTGAAAGTGTTCTGG + Intronic
1132950848 16:2561609-2561631 CTGTGCTGATTTCAGGGTACAGG + Intronic
1132963501 16:2638561-2638583 CTGTGCTGATTTCAGGGTACAGG - Intergenic
1135307549 16:21379988-21380010 CTCTGCTGGTTTAAAGCTTCTGG - Intergenic
1136304293 16:29359108-29359130 CTCTGCTGGTTTAAAGCTTCTGG - Intergenic
1136732670 16:32431749-32431771 CTTTGCTGGTTTTAGTTTTAAGG + Intergenic
1137506048 16:49054803-49054825 CTGTGCTGGCCTAAGGGTCCCGG + Intergenic
1138381361 16:56605019-56605041 CTGTGCTAGTTTCAGGGTCCAGG + Intergenic
1140654925 16:77130634-77130656 CTTTGTTGATTTAAGTTTTCTGG + Intergenic
1141536144 16:84681566-84681588 ATGAGTTGGTTTAACTGTTCTGG - Intergenic
1142087588 16:88192207-88192229 CTGAGCTGGTGGAAGCGTTCGGG + Intergenic
1203020412 16_KI270728v1_random:397853-397875 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic
1203038747 16_KI270728v1_random:671011-671033 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic
1146273081 17:31497390-31497412 TTGTGCTTGTTTAGGTGTTAAGG + Intronic
1149875085 17:60224573-60224595 CTGTGCTGGTTGCAGTCTTCTGG - Intronic
1153587429 18:6637569-6637591 CTGTGAGGGTTTAATTATTCTGG + Intergenic
1153691872 18:7602145-7602167 CTGTGCTCTTTAAAGTGGTCAGG + Intronic
1155575020 18:27235026-27235048 CTGAGCTGGGTTAAGAGTTTTGG + Intergenic
1157899607 18:51501804-51501826 CTGTCCTGGTTTTAGTGATGAGG - Intergenic
1158262518 18:55624410-55624432 CAGTGCATGTTCAAGTGTTCTGG + Intronic
1159146643 18:64463105-64463127 CTGTCCTGTTTAAAGTGTTTAGG - Intergenic
1160018299 18:75160690-75160712 CTGTCCGTGTTCAAGTGTTCAGG - Intergenic
1164508392 19:28877948-28877970 CTGTGCAGGTTGAGGTGGTCAGG - Intergenic
1164561731 19:29297031-29297053 CTGTGCTGGTATAAGTGGTGGGG - Intergenic
1167524498 19:49975226-49975248 CTGTGCTGGTTCAAGAGATGAGG + Intergenic
927617445 2:24613567-24613589 CTCTCCTGGATTAAGAGTTCAGG - Intronic
930316714 2:49805318-49805340 CTGTTCTAGTTTGAGTGCTCCGG - Intergenic
931270280 2:60695497-60695519 CTGTGCTTGGTTAAATCTTCCGG - Intergenic
933154539 2:78958688-78958710 CTGTGCTGGCTTGATTTTTCTGG - Intergenic
933755813 2:85637635-85637657 CTGTGCTGGTTTAAGTGTTCTGG + Intronic
934313044 2:91887507-91887529 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic
935314494 2:101818081-101818103 CTGTGCTGGTTTCATTGGTGTGG + Intronic
936247259 2:110839086-110839108 CTGTGCTGGTTAAAGGGGGCTGG - Intronic
937238568 2:120445639-120445661 CCGTGCTGTATTTAGTGTTCTGG - Intergenic
937353085 2:121179643-121179665 CTTTCCGGGTTCAAGTGTTCAGG - Intergenic
937369028 2:121285066-121285088 TTGTGCTGGTTGTAGTGCTCGGG + Exonic
943808128 2:192149482-192149504 CTGTGCTGATTAAAGACTTCTGG + Intronic
944262787 2:197695310-197695332 CTTTCCTGGTTTTGGTGTTCGGG + Intronic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947502277 2:230679989-230680011 CTGTGCTGATCTCTGTGTTCTGG - Intergenic
949019226 2:241731730-241731752 ATGTGCTGGTTTCAGCGTTGTGG - Intergenic
1170901157 20:20464894-20464916 AGGTGCTATTTTAAGTGTTCAGG + Intronic
1171099187 20:22366654-22366676 CCATGCTGGTTTTAGTTTTCTGG + Intergenic
1172277658 20:33688738-33688760 CTGTGCTGGTTTAACTGTGGTGG + Intergenic
1173248578 20:41352602-41352624 CTGTGCTGGTTGAATTTCTCTGG - Exonic
1173338449 20:42132649-42132671 CTGTGGTGGTGTCAGTGTTTTGG - Intronic
1178766651 21:35459514-35459536 TTGTGCTGGTGTAAGTGTAAAGG - Intronic
1179526926 21:41985090-41985112 CTGTGCTGCTGTGATTGTTCTGG - Intergenic
1179823185 21:43948997-43949019 CTGTGCTGTTTTAATTATTGAGG + Intronic
1180539775 22:16433371-16433393 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic
951704071 3:25526189-25526211 CTGGGCTGGAATAAGTCTTCTGG + Intronic
952021045 3:29020430-29020452 ATGTGCTGGTCTAATTGTTAGGG - Intergenic
952191603 3:31028732-31028754 ACGTCCTGATTTAAGTGTTCTGG + Intergenic
954927644 3:54250900-54250922 GTGAGTTGGTTTGAGTGTTCAGG + Intronic
955238705 3:57162053-57162075 CTGGCCTGGTTTAAGTGGTCAGG - Intronic
958728457 3:97934593-97934615 CTGTGCTGGTTTAAATATCTGGG + Intronic
959471121 3:106751546-106751568 CTCTACTGTTTTGAGTGTTCAGG - Intergenic
962263541 3:133929577-133929599 CAAAGCTGGTTTAAGTGTCCCGG + Exonic
964637023 3:158869345-158869367 CTGTGGAGGAGTAAGTGTTCTGG + Intergenic
964925321 3:161949366-161949388 ATGTGCTGATTTATTTGTTCTGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
976625066 4:87171545-87171567 CTGTGCTGATAAAAATGTTCAGG + Intronic
977095027 4:92731036-92731058 ATGTGGTGGTTTAAGCTTTCAGG + Intronic
977945237 4:102905561-102905583 CTTTGCTGGTTTTAGTTTTAAGG - Exonic
980619407 4:135279004-135279026 CTGTGCTGGGTTTAGGTTTCAGG + Intergenic
983823186 4:172222936-172222958 TTGTGCTGGTTTATGTCTTTGGG - Intronic
985979936 5:3454122-3454144 CTGTGCTAGTGTGAGTGTTAGGG - Intergenic
986007587 5:3681028-3681050 CTCTGATGGATTAAGTGATCAGG - Intergenic
989776772 5:45218554-45218576 GTTTGGTGGTTTCAGTGTTCTGG - Intergenic
990605398 5:57404384-57404406 CAGTGCTGCTGTAACTGTTCTGG + Intergenic
998169317 5:139863262-139863284 AAGTGCTGGCTTAAGTGTTCAGG - Intronic
998737449 5:145158752-145158774 TAGTTCTGCTTTAAGTGTTCAGG - Intergenic
1000824069 5:166022388-166022410 CTGACCTGGTTTTAGTTTTCTGG - Intergenic
1006150238 6:31983166-31983188 CTGTGATGGTGTCAGTGCTCGGG - Exonic
1006156539 6:32015904-32015926 CTGTGATGGTGTCAGTGCTCGGG - Exonic
1007096240 6:39214940-39214962 CAGTGCTGGATTAAGGGTTGTGG - Intronic
1012676078 6:102114898-102114920 CTCTCCTGGATTAAGTGTTTAGG - Intergenic
1014172005 6:118288945-118288967 CTGTGCTGATGGAAATGTTCTGG - Intronic
1018434264 6:163746985-163747007 CTGTGCTGGCTGCAGAGTTCTGG + Intergenic
1019454948 7:1122151-1122173 CTGTGCTGGTTTCAGTCACCTGG - Intronic
1019825127 7:3278328-3278350 CAGAGCAGGTCTAAGTGTTCTGG + Intergenic
1020431163 7:8117556-8117578 CTGTGCTGTGTTAAGTATTTTGG - Intronic
1021141203 7:17028029-17028051 CTGTGTTGGTTCCTGTGTTCAGG + Intergenic
1023969983 7:44983809-44983831 CTGTGCAGGGGTAAGTGTGCAGG - Intergenic
1024181785 7:46902640-46902662 ATGTGATGGTTTAATGGTTCTGG - Intergenic
1024608942 7:51046413-51046435 CTGTGTTGGTGTGAGTTTTCAGG + Intronic
1026014550 7:66662723-66662745 GTGTGCAGGTGTAAGTGTGCAGG + Intronic
1027584328 7:80039012-80039034 CTGTGCTTTTAAAAGTGTTCAGG + Intergenic
1028869922 7:95758451-95758473 CTGTGCTGGATGTAGTGTTCAGG + Intergenic
1028924431 7:96342152-96342174 AACTGCTGGTTTAAATGTTCAGG - Intergenic
1036747329 8:11419128-11419150 ATGTGCTGGTCCAAGGGTTCAGG + Intronic
1037636436 8:20704626-20704648 TTGTGTTGTTTTAACTGTTCAGG + Intergenic
1042963198 8:74324014-74324036 ATGTGTTAGTGTAAGTGTTCAGG + Intronic
1045435121 8:102155126-102155148 ATGTTCTGGATTAAATGTTCTGG + Intergenic
1048431685 8:134376892-134376914 CTGTGCAGGTTTGGGTGTCCTGG + Intergenic
1048523677 8:135180960-135180982 CTGTGCTGGATTTACTTTTCTGG + Intergenic
1049415447 8:142492865-142492887 CTGTGCTGGTGGAAGTGCTGGGG - Intronic
1051245477 9:15106510-15106532 CTGTTCTTGTTTAATTGTTCTGG - Intergenic
1051272942 9:15372598-15372620 GTGTGGTGGGTTAAGTGTGCTGG - Intergenic
1052551895 9:29962503-29962525 CTCTGCTGATTGAAGTGTCCAGG + Intergenic
1055214271 9:73839625-73839647 CTGTACTGGATTATTTGTTCAGG - Intergenic
1055264908 9:74483888-74483910 ATTTGGTGGTTTCAGTGTTCTGG - Intergenic
1055265424 9:74490674-74490696 CTCTGCTGGCTTAAATGTTACGG - Intergenic
1056962943 9:91142717-91142739 CTGTGATGGATTCAGGGTTCAGG - Intergenic
1057867191 9:98690950-98690972 CTGTGCTGATATAACTGTTGTGG - Intronic
1058439843 9:104996540-104996562 ATGTGAGGGTTTAAGAGTTCAGG + Intergenic
1060718130 9:125953847-125953869 GAGTGCTGCCTTAAGTGTTCAGG - Intronic
1060734382 9:126057169-126057191 CTGTGCAGGTTCAAGTGGCCGGG + Intergenic
1185447473 X:266932-266954 CTCTGCTGGTTTGGGGGTTCAGG - Intergenic
1185461726 X:335854-335876 CTTTGCTGGTTTGTGTGTTTCGG - Intronic
1187029666 X:15472707-15472729 CTGGGCTGATGAAAGTGTTCTGG + Intronic
1193340207 X:80339435-80339457 CTTTGCTGGTTTCATAGTTCTGG + Intronic
1196420726 X:115518298-115518320 ATATGCTGATGTAAGTGTTCTGG + Intergenic
1197491925 X:127128540-127128562 CAGTGCAGGCTAAAGTGTTCGGG + Intergenic
1198574022 X:137990380-137990402 AAGTGCTGGTGAAAGTGTTCAGG - Intergenic
1198942976 X:141978707-141978729 CTTTGCTGGTTTTGGTGTTAGGG + Intergenic
1201180980 Y:11345015-11345037 CTTTGCTGGTTTTAGTTTTAAGG - Intergenic