ID: 933758105

View in Genome Browser
Species Human (GRCh38)
Location 2:85656400-85656422
Sequence AAGAGAAGCCTGCCTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933758105_933758112 24 Left 933758105 2:85656400-85656422 CCTGTGAGAGGCAGGCTTCTCTT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 933758112 2:85656447-85656469 AGAATAAGTCCCCTCCTCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 107
933758105_933758106 -6 Left 933758105 2:85656400-85656422 CCTGTGAGAGGCAGGCTTCTCTT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 933758106 2:85656417-85656439 TCTCTTAGAAGCCCACACCCTGG 0: 1
1: 1
2: 0
3: 12
4: 141
933758105_933758111 23 Left 933758105 2:85656400-85656422 CCTGTGAGAGGCAGGCTTCTCTT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 933758111 2:85656446-85656468 AAGAATAAGTCCCCTCCTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933758105 Original CRISPR AAGAGAAGCCTGCCTCTCAC AGG (reversed) Intergenic
901255946 1:7827046-7827068 AAGAGAAGGATGCCACTTACAGG - Intronic
901815955 1:11793816-11793838 CAGAGCAGCCTGCCTCTCCTGGG - Intronic
902140656 1:14350908-14350930 AACAGACGCCTGCCACTCAGGGG - Intergenic
903277990 1:22233682-22233704 AAGAGCAGCCAGCCTCTACCGGG - Intergenic
903571489 1:24308811-24308833 AAGCGAAGCCTGCATCACAAAGG - Intergenic
904003489 1:27351236-27351258 ACGATAAGCCCGCCTCTCGCAGG + Exonic
906532220 1:46530451-46530473 AACAGAAACCTGCCTCCCAGAGG + Intergenic
906607405 1:47181707-47181729 AGGAGAAGCCTGCTTCTGCCTGG - Intergenic
907889270 1:58622168-58622190 AAGACAATCCTGCCCCTCAGGGG + Intergenic
914987091 1:152470324-152470346 AAGAGAACACTTCCTCTCAAAGG + Intergenic
915301476 1:154953956-154953978 CAGAGAAGCCAGCCTCTTCCAGG + Intronic
918790341 1:188817350-188817372 AAAATAAACCTGCCTCTCATAGG - Intergenic
920662785 1:207931906-207931928 AAGAAAAGACTGACTCTGACAGG - Intergenic
920682669 1:208084636-208084658 AAGAGGGGCCTGCCTGTCCCAGG - Intronic
920935924 1:210434379-210434401 AAGAGAATTCAGCCTCCCACTGG - Intronic
921859172 1:220023068-220023090 AAGAGTATCCTGCTTCTCATTGG - Intronic
921930481 1:220750218-220750240 AAGAAAAGCCTTCCTATTACTGG + Intronic
922773687 1:228205214-228205236 AAGAGAGGCCTGAGGCTCACAGG - Intronic
923436135 1:233969804-233969826 AAGAGGGGCCTGCATCTCACAGG - Intronic
1063071767 10:2673051-2673073 AAGAGAACACTGACTCTTACTGG + Intergenic
1063255366 10:4321370-4321392 AAGAGAAGCCTGCTTTTTGCTGG - Intergenic
1063795184 10:9506865-9506887 GAAAGAAGCGTGCCTCTCAGAGG + Intergenic
1065445027 10:25789275-25789297 AAGAGGAGACTGACTCTGACTGG + Intergenic
1067337624 10:45377956-45377978 AAGGGAAACCTGCAACTCACCGG - Intronic
1067554542 10:47259450-47259472 AAGATATGCCTGCCTATAACAGG + Intergenic
1067821931 10:49538467-49538489 AAGCGAGGGCTGCCTGTCACAGG + Intronic
1069698199 10:70403014-70403036 AAGAAAACCCAGCCTCACACAGG - Intergenic
1070156721 10:73839902-73839924 AAGGGGCACCTGCCTCTCACCGG - Intronic
1073507631 10:104013718-104013740 AGGAGAAGCCATCCTCCCACAGG - Intronic
1073590261 10:104750523-104750545 AAGTGAAGCCTGCATCTCTTAGG - Intronic
1074545348 10:114398060-114398082 AGGAGGAGCCTGCCTCCCCCTGG - Intronic
1076014035 10:127013583-127013605 ACCAGAAGCCTGCCTCTGCCAGG + Intronic
1076363015 10:129902928-129902950 AAGAGACGGCGGCCTCTCTCAGG + Intronic
1077780703 11:5326191-5326213 AAAAGAAGCCTGCCCAACACTGG + Intronic
1078580055 11:12532729-12532751 ATGAGAAGCCTGCCACTCCAGGG + Intergenic
1079689450 11:23403679-23403701 AAGAAAAGCCTGCCTGTCCCTGG + Intergenic
1080698198 11:34621285-34621307 AAGAGAAGCCTGCTTTAAACTGG + Intronic
1081604320 11:44517910-44517932 CAGAGAAGCCTGCCTCCTGCAGG + Intergenic
1083826733 11:65208151-65208173 AGGAGAGGGCTGCCCCTCACAGG - Intronic
1084036670 11:66515584-66515606 AGGGGAAGGCAGCCTCTCACCGG - Exonic
1084167546 11:67382901-67382923 GCCAGAAGCCTGCCTCTAACAGG + Intronic
1085230918 11:74969370-74969392 AAGAGAAGCAAGGCTCTCTCTGG - Intronic
1085526137 11:77165366-77165388 CAGAGGAGGCTGCCACTCACAGG - Intronic
1089254910 11:117189073-117189095 AAGAGGGGCCTCCCTCACACAGG - Intronic
1091310534 11:134572420-134572442 AAGAGAATCGTGTCTCTCTCGGG + Intergenic
1094371325 12:29740649-29740671 AAGAGAACCCTGACTAACACAGG + Intronic
1094510405 12:31092949-31092971 AAGTGCTGCCTGCCTCTCAGAGG - Intronic
1096176254 12:49521533-49521555 ATGAGAATGCTGGCTCTCACAGG + Intronic
1098041060 12:66354426-66354448 AAGAAAAGCCTGCCTTCCAGAGG + Intronic
1098377872 12:69836740-69836762 CACAGAAACCTGCCTCTCTCAGG - Intronic
1098882879 12:75934726-75934748 AAAAAAAGCCTCCCTCTCTCAGG + Intergenic
1101446618 12:104741350-104741372 AGGACCAGCCTTCCTCTCACTGG + Intronic
1102216099 12:111162377-111162399 AAGAGAAGCAGGCTTATCACGGG + Intronic
1103075714 12:117980959-117980981 GAGTGAACCCTGCCTCTCAAAGG + Intergenic
1103617281 12:122162352-122162374 AAGAGAAGCCTGGGTCTCCCAGG - Intergenic
1104164788 12:126217055-126217077 CAGAGGAGACTGCCTTTCACTGG + Intergenic
1104413200 12:128576444-128576466 AAGAGAAGCTGCCCACTCACGGG - Intronic
1104613082 12:130245462-130245484 AGGAGGAGCCTGCCGCTCCCTGG + Intergenic
1105243635 13:18628777-18628799 AAGAGAGGCCGGCCTCTGTCCGG + Intergenic
1106173429 13:27308514-27308536 AAGAGAACTCTGCTTCCCACTGG - Intergenic
1107022284 13:35764364-35764386 AAGAGAGGCCAGGGTCTCACGGG - Intergenic
1109957689 13:69590069-69590091 GAGAGAAGCCTGATTCCCACAGG - Intergenic
1113911839 13:113845350-113845372 AAGAGACTCCTGCCTCTCCCAGG + Intronic
1114646759 14:24260328-24260350 AGGAGAAGCCAGCCTCCCATTGG - Intronic
1118814436 14:69299993-69300015 AAGAGAGGCCTGGCTCTCTGGGG - Intronic
1118957191 14:70492945-70492967 AAGAAAAGCCTGGCACTCAATGG + Intergenic
1121548565 14:94780897-94780919 AAGAGAAGCCTGAGGCTCAGAGG - Intergenic
1124143097 15:27094664-27094686 CAGAGATGCCTGTCTCTCAGAGG + Intronic
1124143114 15:27095051-27095073 CAGAGATGCCTGTCTCTCAGAGG - Intronic
1124216147 15:27808416-27808438 AAGTGAATCCTGCCTCCCAGCGG - Intronic
1125503970 15:40256302-40256324 AACAGAAGACAGCCTTTCACTGG - Intronic
1126264335 15:46734945-46734967 AGAAGAGGGCTGCCTCTCACAGG - Intergenic
1127823612 15:62683394-62683416 TAGCGAATCCTGCCTCTCATTGG + Intronic
1127932121 15:63603834-63603856 AAAAGCAGCCTGTGTCTCACAGG - Intergenic
1129681602 15:77661457-77661479 AAGAGAGGCCTGCCTCTGGGAGG - Intronic
1129737266 15:77973288-77973310 AAGAGCTGCCTGCCACTGACAGG - Intergenic
1129848806 15:78780337-78780359 AAGAGCTGCCTGCCACTGACAGG + Intronic
1129966164 15:79737714-79737736 AAGAGATGGCCTCCTCTCACTGG - Intergenic
1130736590 15:86556812-86556834 AAGGAAAGAATGCCTCTCACGGG - Intronic
1130956118 15:88628628-88628650 AACAGAACCGTGCCTGTCACTGG - Intronic
1131036785 15:89227616-89227638 AAGAGAGGCCTGCCTGTGTCAGG + Intergenic
1132495480 16:261291-261313 AACAGGAGCCTGCCTGTCACAGG + Intronic
1132780940 16:1625104-1625126 AAGAGAACCCTGGTTATCACAGG + Intronic
1133911051 16:10067039-10067061 AAGAGCACCCTACCTCTAACTGG + Intronic
1134899303 16:17921617-17921639 AAGAGAAGATGGCCTATCACAGG + Intergenic
1138332788 16:56228277-56228299 AGGAGAACCCTGCCACTCTCTGG - Intronic
1139514943 16:67447304-67447326 AAGAGGATTCTGCCCCTCACTGG - Intronic
1145807606 17:27745888-27745910 AAGAGAAGCCTGGCCCTGAGAGG - Intergenic
1147712627 17:42480752-42480774 AAGAGAGGCATGCCTCTACCAGG + Intronic
1148556947 17:48584437-48584459 AAAACAGGCCTGCCTCTCCCAGG + Intronic
1152026875 17:77815671-77815693 AATACCAGCCTGCCTCCCACTGG + Intergenic
1154003375 18:10505985-10506007 AAGTGAGGAGTGCCTCTCACAGG - Intergenic
1154499278 18:14987073-14987095 AAGAGAATCCTGCCTGGAACAGG - Intergenic
1155506542 18:26538926-26538948 AACGGAAGCCTGCCACACACCGG + Intronic
1156609716 18:38712039-38712061 AAGAGAAGCCAGCCTCAGCCTGG - Intergenic
1156970212 18:43145208-43145230 AAGAGATGCCTACCTCTCAGAGG + Intergenic
1157197014 18:45627675-45627697 AAGAGAAGTTGGCCTCGCACTGG + Intronic
1159367286 18:67484492-67484514 AGGCGAATCCTGCCTCTCAAAGG - Intergenic
1162763451 19:12903067-12903089 AAAAGAAGACTGCCTCTTTCTGG - Intronic
1163154164 19:15431101-15431123 AAGAAGAGCCTGCCTGTCCCTGG - Intronic
1164806536 19:31121314-31121336 AAGAGAAGCCTGGGCCTCAGAGG - Intergenic
1164861459 19:31565260-31565282 AATGGAACCCTGCCTCTCTCAGG + Intergenic
1165247080 19:34503925-34503947 CAGACAAGCCTGCCTCTCAGCGG + Exonic
1165611055 19:37153226-37153248 AAGAGAAGCCTTTCCCACACTGG + Exonic
1165837644 19:38769655-38769677 AAAAGAATCCGGCCTCTCCCAGG + Intronic
1165841917 19:38793044-38793066 GGGAGAAACCGGCCTCTCACAGG - Intergenic
1166257834 19:41619011-41619033 AAGAGGACCCTTCCTCTCATTGG - Exonic
1167436181 19:49480220-49480242 AAGAGAGGCCTGGCTGCCACTGG - Intronic
924970316 2:120576-120598 AAGGCAATCCTGCCACTCACAGG + Intergenic
931484041 2:62672094-62672116 AAAAGCAGCCTGCCTGTGACTGG + Intergenic
932719647 2:74129744-74129766 AACAGACTCCTGCCTCTCTCTGG - Intergenic
932723655 2:74158970-74158992 AAGAGAAGCTTGCCTGTAATTGG + Intronic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
933769348 2:85733452-85733474 CAGAGAAGCTGGCCTCTCCCTGG - Intergenic
938498488 2:131817441-131817463 AAGAGAATCCTGCCTAGAACAGG - Intergenic
940127608 2:150344392-150344414 AGGAGAAGCTAGCCTTTCACAGG + Intergenic
940657116 2:156501224-156501246 CAGAGAAGACTGCCTCTTTCTGG + Intronic
941527818 2:166628408-166628430 AAAAAAGGCCTGTCTCTCACAGG - Intergenic
945407428 2:209466842-209466864 AAGAGCTACCTGGCTCTCACTGG + Intronic
947073883 2:226320246-226320268 AAGAAAAGCCTGCCTGTTCCAGG + Intergenic
947537957 2:230952777-230952799 GAGAGAAGCCTGCCTCCAAGAGG - Intronic
947810052 2:232998498-232998520 AAGGCAAGCCTGGCTCTCTCTGG + Intronic
1171890875 20:30713757-30713779 AAGACAAGCATGGCTCTCAAAGG + Intergenic
1173174924 20:40757317-40757339 AAGAAAAGGCTTCCTCTCTCTGG - Intergenic
1178233053 21:30809417-30809439 AAGAGGAGCCTTCCTAGCACAGG - Intergenic
1178413785 21:32387435-32387457 AAAAAAACCCTGCCTCTCTCTGG + Intronic
1178438124 21:32577327-32577349 GAGAGAAGTCCGCGTCTCACAGG + Intronic
1182021177 22:27083017-27083039 AAGAAATGCCTTCCTCTCCCTGG + Intergenic
1182456784 22:30456838-30456860 TTGGGAAGCCTGCCTCTTACTGG + Intronic
1184498795 22:44859736-44859758 GAGAGCAGCCTGCGTGTCACTGG + Exonic
1184798979 22:46748669-46748691 AAGGGAAGCCTGGGTCTCAGCGG + Intergenic
950056119 3:10026214-10026236 AAGAGAAGCTCGCCCATCACCGG - Intergenic
950326877 3:12119165-12119187 AAAAGAAGCCTGCTTCTCTAAGG - Intronic
950332462 3:12167340-12167362 TAAGGAAGCCTCCCTCTCACTGG - Intronic
951158427 3:19384288-19384310 AAGAGAAGCATGCCTTTTTCTGG - Intronic
953470396 3:43161484-43161506 AAGGGAAGCCAGCATGTCACAGG + Intergenic
955562053 3:60201960-60201982 AAGAGATGGCTGCCTGTCCCAGG + Intronic
955596170 3:60593034-60593056 AAGAGAAGCCTGCCCATCGCTGG + Intronic
962429703 3:135307813-135307835 AAGAGAGCTCTGCCTCTCTCAGG + Intergenic
963219986 3:142798525-142798547 ATGAGAAGCCTGCCTGGCAAAGG + Intronic
967791275 3:193551716-193551738 ACGGGAGGCCTGGCTCTCACCGG - Intronic
967963162 3:194941345-194941367 AGGAGAAGCTTGCCTCTGGCAGG + Intergenic
968916040 4:3497459-3497481 TAGAGAAGCCTGGCAGTCACTGG + Intronic
972549818 4:40120981-40121003 TAGACAAGTCTGACTCTCACAGG - Exonic
974095015 4:57353347-57353369 AAGAGAAGCGAGCCTCTCTCGGG - Intergenic
974476875 4:62393481-62393503 AGAAGCAGCCTGCCTCTCTCAGG + Intergenic
975930476 4:79515731-79515753 AAGACAAGCCTAACTCTCAAAGG - Intergenic
977410811 4:96660113-96660135 AACAGAAGCCTTCCTCTTCCTGG + Intergenic
978203521 4:106051180-106051202 AACAGAATCATGTCTCTCACTGG + Intronic
978389808 4:108213625-108213647 AAGAGGGGCCTGTATCTCACTGG - Intergenic
978927921 4:114272397-114272419 AAGACAAGCCTTACTTTCACAGG - Intergenic
980113158 4:128653931-128653953 AAGAGAAGACGGTCTCTCCCAGG + Intergenic
981004402 4:139860315-139860337 AAGAGAAGCCCCTCTCTCAAGGG - Intronic
981624458 4:146739940-146739962 AATAGAAGTGTGCCTCTTACAGG + Intronic
981641186 4:146945642-146945664 AAGAACAGCCTGCCTCTCCAAGG + Intronic
985292535 4:188401263-188401285 AAGAGACTCCTTCCTCTCTCAGG + Intergenic
985359210 4:189154787-189154809 AGGAGACCCCTGCCTTTCACAGG + Intergenic
985874750 5:2586192-2586214 AAGGCAAGCCAGCCTCTCAAGGG + Intergenic
990538786 5:56751347-56751369 AGGAGAAGTCTGCCTTTCCCAGG + Intergenic
990806882 5:59673394-59673416 AAGTGAAGCATGCCTCTAAGAGG - Intronic
993078012 5:83259499-83259521 AAGAAAATCCAGCCTCACACAGG - Intronic
993836022 5:92821501-92821523 AACAGAAGCCAGCCACTCCCTGG + Intergenic
996943752 5:129042432-129042454 AAGAGAAGCCTTGCTGTCCCTGG + Intergenic
999282039 5:150372364-150372386 AAGAACAGCCTGCTTCCCACAGG + Intronic
999309272 5:150541396-150541418 AAGTGGAGCCTGCCTGTCAGTGG + Intronic
1002094693 5:176823984-176824006 ATGAGAACCCAGCCTCTCCCTGG + Intronic
1002509420 5:179703527-179703549 AGGAGAAGCCTGAGTCTGACAGG - Intronic
1002879966 6:1242539-1242561 AAGAGAAGCCTGGAGCTCTCTGG + Intergenic
1003640141 6:7869265-7869287 CAGGGAAGCCTGCCTGTCACTGG + Intronic
1003762981 6:9202388-9202410 AGGAGAAGCCAGCCTGACACAGG - Intergenic
1004463589 6:15862270-15862292 AAGAGAAGCCTCCTTCTTCCTGG + Intergenic
1006679257 6:35785629-35785651 ATTAGAAGCCTGTCTCTCCCTGG + Intronic
1006767936 6:36525390-36525412 TAGAGAAGCCTTCCTCTCCTAGG + Intronic
1007012588 6:38432055-38432077 AAGTGAATTCTTCCTCTCACGGG + Intronic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1017869548 6:158475234-158475256 AGGAGAAGCCTGCCCCTCCATGG + Intronic
1018940642 6:168307392-168307414 AAGAGAAGCCTGCTGCACACAGG - Exonic
1019211009 6:170404850-170404872 AAGCGAGGCCTGGCTCCCACAGG - Exonic
1020063651 7:5170982-5171004 AAGAGAAACATGCATCTTACAGG - Intergenic
1020764395 7:12302470-12302492 AAGAGAGGCCTTCCCCTGACAGG + Intergenic
1021981329 7:26058516-26058538 GTGGGAAGCCTGCATCTCACAGG + Intergenic
1022107978 7:27210401-27210423 AAGAGAAGCCTCTCTCTCCCTGG - Intergenic
1022473906 7:30698147-30698169 AAGCCCAGCCTTCCTCTCACGGG - Intronic
1024534310 7:50417393-50417415 CAGAGAAGCCTGCCTCATTCAGG - Intergenic
1025604411 7:63029101-63029123 AAGAGAAGCTGGCCCTTCACAGG - Intergenic
1026613230 7:71879468-71879490 AAGGGAAGCCTCCACCTCACAGG - Intronic
1030987430 7:116258897-116258919 AATAAAAGTCTGCCTCTGACAGG + Intergenic
1032970409 7:137156491-137156513 ATGAGAAACCTGCCTCTAACAGG + Intergenic
1033230791 7:139595905-139595927 AAGGGAGGCCTGCCCCTCCCAGG - Intronic
1033603277 7:142905818-142905840 AAGAAAATCCTGCCTCACACAGG + Intergenic
1034255491 7:149722551-149722573 AAGGAAAGCCCGCCTCTCACCGG - Exonic
1034646162 7:152649826-152649848 GAGAGCAGCCTGCATCTCACTGG - Intronic
1034954495 7:155326249-155326271 AATAGAAACCTCCTTCTCACAGG + Intergenic
1035970032 8:4237909-4237931 ATGTGAAGCTTTCCTCTCACTGG + Intronic
1037701644 8:21280657-21280679 GAGAGAAGCCTGCCTGATACAGG - Intergenic
1037743291 8:21624073-21624095 ATGGGAAGCCTGTCTCTCCCTGG - Intergenic
1038408831 8:27342572-27342594 AAGGCAAGACTGCCTCTCCCAGG + Intronic
1040017811 8:42714137-42714159 AAGGGAAGGCTGCCTGTAACAGG + Intronic
1042748399 8:72132703-72132725 AAGAGAAGCCTGTCCCAGACAGG + Intergenic
1043912731 8:85881808-85881830 AAGGGAAGCATATCTCTCACTGG + Intergenic
1046036752 8:108852123-108852145 AAGGTAAGCCTCCTTCTCACAGG - Intergenic
1047256944 8:123221193-123221215 TAGTGAAGCTTGGCTCTCACTGG - Intronic
1047771691 8:128035088-128035110 AAGAGAAGCCTGCAAATAACTGG - Intergenic
1047957000 8:129983940-129983962 AGGAGAAGCCAGCCTCTGATTGG + Intronic
1049350995 8:142164660-142164682 AAGAGAAGGCAGTTTCTCACAGG + Intergenic
1049563511 8:143325279-143325301 AAGAAAAGCCAGCCTCACCCGGG + Intronic
1050141800 9:2523812-2523834 AAGAGATGCTGGCTTCTCACAGG + Intergenic
1050583483 9:7085589-7085611 AACACCAGCCTTCCTCTCACAGG - Intergenic
1054357980 9:64081999-64082021 AAGACAAGCATGGCTCTCAAAGG - Intergenic
1056941472 9:90960268-90960290 GAGAGAAGCCTGCCCCACATGGG - Intergenic
1057216142 9:93229971-93229993 AAGAGGAGACAGCCTCCCACAGG - Intronic
1059329217 9:113524513-113524535 AAGAGAAGCAAGGCTCACACTGG + Intronic
1059723674 9:116985791-116985813 AGGAGAAGCCAGCCTCTCACCGG - Intronic
1059907859 9:119008313-119008335 ATGAGAATCATGCCTCTCCCTGG + Intergenic
1061093936 9:128443496-128443518 AATAGAATCCTGCCCCACACAGG - Intergenic
1061177123 9:129004385-129004407 AAGAGAAGCCTGCCTGGCTCTGG - Intronic
1061504844 9:131025999-131026021 CAGAGATGGCTGCCTCTCAGGGG + Intronic
1062083172 9:134635138-134635160 AAGAGATGCCTCCCACTCAATGG - Intergenic
1062197901 9:135284829-135284851 CAGAGAAGCCTGCCTCCCTGGGG + Intergenic
1062281609 9:135754411-135754433 AAGAGAAGCCGCCACCTCACTGG - Intronic
1062501422 9:136853612-136853634 AAGAGGAGGCTGCCTCTCGCAGG - Exonic
1203560482 Un_KI270744v1:51522-51544 AAGACAAGCATGGCTCTCAAAGG + Intergenic
1186063954 X:5741583-5741605 AAGAGAAGTCTGCTTCTGCCTGG - Intergenic
1189198879 X:39174907-39174929 GAGAGAAGCCTGGCTCTTACTGG - Intergenic
1192437867 X:71153927-71153949 AAGAGACCCCTGTGTCTCACAGG + Intronic
1193108404 X:77704055-77704077 AAGAGAAGCCACCCACTCTCAGG - Intronic
1195524002 X:105864959-105864981 AATAGAACCCTGCTTTTCACTGG - Intronic
1197260155 X:124308782-124308804 AACAGAAGCCTCTTTCTCACAGG - Intronic
1198880501 X:141275984-141276006 AAGAATAGCCTGCTTGTCACTGG + Intergenic
1201293148 Y:12441426-12441448 AATAGAAGGCTGTCTCTCCCAGG - Intergenic