ID: 933762853

View in Genome Browser
Species Human (GRCh38)
Location 2:85685196-85685218
Sequence CCTTCCAGCTGGACTCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933762853_933762860 11 Left 933762853 2:85685196-85685218 CCTAAGGGAGTCCAGCTGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 169
Right 933762860 2:85685230-85685252 GAGGGTGAGAGAGTTGCCCGAGG 0: 1
1: 0
2: 4
3: 52
4: 439
933762853_933762859 -7 Left 933762853 2:85685196-85685218 CCTAAGGGAGTCCAGCTGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 169
Right 933762859 2:85685212-85685234 TGGAAGGAAGGTAAAATGGAGGG 0: 1
1: 0
2: 22
3: 403
4: 5558
933762853_933762858 -8 Left 933762853 2:85685196-85685218 CCTAAGGGAGTCCAGCTGGAAGG 0: 1
1: 0
2: 1
3: 27
4: 169
Right 933762858 2:85685211-85685233 CTGGAAGGAAGGTAAAATGGAGG 0: 1
1: 0
2: 7
3: 46
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933762853 Original CRISPR CCTTCCAGCTGGACTCCCTT AGG (reversed) Intronic
900330330 1:2131053-2131075 CCTTCCAGCTGGACTGCAGTGGG + Intronic
900359252 1:2280050-2280072 CCTTCCACCTGAACCCCCTCTGG + Intronic
900387081 1:2415630-2415652 CATTCCATCTGAACTCCCCTGGG + Intergenic
905484166 1:38284026-38284048 CTTTGCAGCTGGGCTCCCCTTGG - Intergenic
905705109 1:40050223-40050245 CTCTCCTGCTAGACTCCCTTAGG + Intronic
906566665 1:46805909-46805931 CCTTCAGGATGGACACCCTTAGG - Intronic
909931151 1:81501959-81501981 CCTTCTGGCAGCACTCCCTTAGG + Intronic
912181624 1:107225897-107225919 CCTTCCCCCTGTACTTCCTTAGG - Intronic
912468703 1:109892137-109892159 CATCCCAGCTGGGCTCCCTGAGG + Intergenic
912498094 1:110104210-110104232 CCTGCCAACTGGACTTCCTTGGG + Intergenic
913230482 1:116736871-116736893 CCACCTAGCTGGAGTCCCTTTGG + Intergenic
915138843 1:153753611-153753633 CCTACCAGCTGTACAGCCTTGGG - Intronic
916019108 1:160777102-160777124 ACTTACAGCTGGACACCCCTGGG - Intergenic
917476601 1:175374183-175374205 CTTGCCAGCTGGACTCCCTCTGG + Intronic
918206827 1:182316884-182316906 CTTTCCTGCTGGCATCCCTTGGG - Intergenic
919730116 1:200908483-200908505 CCTCCCAGATTGACTCTCTTGGG - Intronic
920022525 1:202966872-202966894 CCGTCCTGCTGGCCTCCCTGGGG - Exonic
920876087 1:209837207-209837229 CTTTCCTGCTGGACTCACCTTGG - Exonic
1065696327 10:28383778-28383800 TCTTCCAGCAGGGCTCTCTTTGG + Intergenic
1066228935 10:33413002-33413024 CCATCCAGCTGGATTACCTCTGG - Intergenic
1066504488 10:36027293-36027315 CCAGCCATCTGGAATCCCTTTGG - Intergenic
1066671508 10:37845128-37845150 CCTTCCACCTGAACTTCCTGAGG + Intronic
1068310072 10:55264514-55264536 CCTTCCACCTGGCATCCCTGAGG - Intronic
1069751623 10:70748804-70748826 CCTTCCACCTGGACACCCCAAGG + Intronic
1072566690 10:96622191-96622213 GCTTCCAGCTGGCTACCCTTGGG + Intronic
1073553403 10:104425024-104425046 CCTTACAGCTGGAGTCACTGGGG - Intronic
1076674173 10:132139778-132139800 CCTTCCAGCAAAACTCCCTCAGG - Intronic
1077807062 11:5601082-5601104 CCTTACATATGGACCCCCTTAGG + Intronic
1079390048 11:20014259-20014281 CCTTGGAGCTGGACTCCCATTGG + Intronic
1085176258 11:74491079-74491101 GCTTCCAGCTTGTCTCTCTTTGG + Intergenic
1085514966 11:77106531-77106553 CCTGCCAGCTGGATGGCCTTGGG + Intronic
1085619415 11:78026510-78026532 CCTCCCAGATCCACTCCCTTGGG - Intronic
1088912348 11:114201224-114201246 CCTCCCACCTCCACTCCCTTTGG - Intronic
1091626380 12:2124063-2124085 CCTTCCTGCTGTCCTCCCTCTGG + Intronic
1091955955 12:4642985-4643007 CCTTGAAGCTTGACTCCTTTGGG + Intronic
1092945862 12:13453404-13453426 CCTCCCAGCTGGACTCATTCAGG + Intergenic
1095163265 12:38941397-38941419 CCTTCCAGCTGTGCTGCCTGGGG - Intergenic
1096113636 12:49042631-49042653 TCTTGTAGGTGGACTCCCTTTGG - Exonic
1097579823 12:61441421-61441443 CATTCCAGCTTTACTCTCTTTGG - Intergenic
1097726948 12:63086365-63086387 CCTTCTAACTGGCTTCCCTTGGG + Intergenic
1100665363 12:96746308-96746330 CCTTCCAGCCAGACTCCTTAAGG + Intronic
1101643731 12:106608291-106608313 CCTTGTAGCTTGCCTCCCTTTGG - Intronic
1102023040 12:109697079-109697101 CTTTCCAGCTGTGCGCCCTTGGG + Intergenic
1102302798 12:111783195-111783217 CCTTCCAGCTGGGCTCACCTTGG + Exonic
1104527131 12:129534713-129534735 TCTTTCAGCTGGACTGGCTTAGG - Intronic
1106003718 13:25749423-25749445 CCTCGCATCTGGACTCCCCTCGG - Intronic
1108577047 13:51799683-51799705 CCTTACAGCTGGTCTTCCTGTGG - Intronic
1111379449 13:87427662-87427684 CCTTCCAGCTGGGCTGCCTTTGG + Intergenic
1114764195 14:25351611-25351633 CCTTCCAACTTGATTACCTTTGG + Intergenic
1117029104 14:51651468-51651490 GCCTCCGGCTGGACTCCCTCGGG - Intronic
1120754167 14:88226421-88226443 GCTTCCAGCTGATCTGCCTTTGG + Intronic
1129288399 15:74544114-74544136 CCTTCTGGCAGCACTCCCTTAGG + Exonic
1129538467 15:76332996-76333018 TCTTCCTGCTGGACTCCCTCTGG - Intergenic
1129662914 15:77563080-77563102 CCTTGAATCTGGACTGCCTTTGG - Intergenic
1132061694 15:98697590-98697612 CCTTCCATCTGGGTTCCCCTTGG + Intronic
1132300512 15:100772650-100772672 ACTTCCAGGTGGCCTCCCTGCGG - Intergenic
1133404959 16:5516167-5516189 CCATCAAGCTTGACTCCCTTTGG - Intergenic
1134670719 16:16052925-16052947 CCTGCCAGTTGGACTCACTTGGG + Intronic
1135220661 16:20611873-20611895 CCTCCCAGCTGGCCTCTCATTGG - Intronic
1136271894 16:29153525-29153547 CCTTCCAGCCGTACTCCCTCCGG + Intergenic
1136271907 16:29153559-29153581 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271918 16:29153593-29153615 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271929 16:29153627-29153649 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271939 16:29153661-29153683 CTTTCCAGCCGTACTCCCTCTGG + Intergenic
1136271960 16:29153729-29153751 CCTTCCAGCTGTACTCCCCCTGG + Intergenic
1136271972 16:29153763-29153785 CCTTCCAGCCGTACTCCCTCTGG + Intergenic
1136577867 16:31135036-31135058 CCTTCCAACTAGATTCTCTTAGG - Intronic
1137457284 16:48627567-48627589 TCTTCCTAGTGGACTCCCTTAGG + Intergenic
1140034140 16:71359930-71359952 CTTTCCCGTTGGCCTCCCTTTGG - Intronic
1141775955 16:86122644-86122666 ACTTCCTGCTGGACCCCCATTGG - Intergenic
1142075559 16:88115681-88115703 CCTTCCATCTGTACTCCCTCTGG + Intronic
1142075569 16:88115715-88115737 CCTTCCAGCCGTACTCCTTCTGG + Intronic
1142075579 16:88115749-88115771 CCTTCCAGCCATACTCCCTCCGG + Intronic
1142425287 16:89999326-89999348 CCTGCCAGGTGGACTCACTCAGG - Intergenic
1143508887 17:7384458-7384480 CCTTTCAGCTCCACTTCCTTCGG + Intronic
1143995550 17:11003499-11003521 TCTACCAGCAGGACTCCCATGGG - Intergenic
1144253157 17:13439853-13439875 CCTTCCAGCTTAAATCACTTGGG - Intergenic
1144776783 17:17788799-17788821 CCTCCCAGCTGGGCTCCCTCAGG + Intronic
1145283124 17:21482797-21482819 CATGCCAGCTGTGCTCCCTTTGG + Intergenic
1146000853 17:29129458-29129480 CCTTCCAGTGGCAGTCCCTTGGG - Intronic
1146392855 17:32438854-32438876 CCCTCCAACTGGGCTCCCTGAGG + Intergenic
1146402434 17:32510557-32510579 CTTTCCAGCTGCAGTCCCTGAGG + Intronic
1146985593 17:37213893-37213915 CCTTCCAGCTGAATTTCATTTGG + Intronic
1149194426 17:54102513-54102535 CCTGCCAGCTGGCCTCTCCTAGG + Intergenic
1152491569 17:80638252-80638274 CACACCAGCTGGGCTCCCTTTGG + Intronic
1157365291 18:47058855-47058877 CCTTCATGCTGGACTTCCTGGGG + Intronic
1157698658 18:49745344-49745366 CCCTACAGCTGGCCACCCTTTGG - Intergenic
1162458167 19:10798323-10798345 GCTCCCAGCTGGACTCACTGGGG + Intronic
1162788994 19:13053526-13053548 CCTTCCAGGTGGACTGTCTGAGG - Intronic
1162807693 19:13146877-13146899 CCTTCCAGATGTGCTGCCTTGGG - Intronic
1163711133 19:18847487-18847509 CCTTCCAGCAGGACTCTCCTTGG + Intronic
1165896743 19:39145926-39145948 CCTTCTAGCTGGACGGCCCTGGG + Intronic
1166325851 19:42050731-42050753 CCTTCTAGCTGGGCGACCTTGGG + Intronic
1166689104 19:44812260-44812282 CATACCAGCTGGACTCCCAGGGG + Exonic
1167503766 19:49861060-49861082 GGTCCCAGCTGGACTCCCCTCGG + Intergenic
1167649323 19:50720781-50720803 CCTTACAGCTGGATGACCTTGGG - Intergenic
925970537 2:9103653-9103675 CCCTCCAGCTTGGCTCCCTCAGG - Intergenic
927721466 2:25385617-25385639 CCTTCAAGCTGCACGACCTTAGG + Intronic
928859595 2:35841276-35841298 CCTTCTAACTGAACTCCATTTGG + Intergenic
929770012 2:44883854-44883876 TATTCCACCTGGACTGCCTTTGG - Intergenic
930273407 2:49282958-49282980 CCTTCTTGCTTTACTCCCTTGGG + Intergenic
930366382 2:50445154-50445176 CCATCCAGCAGGACTCTTTTAGG - Intronic
933097743 2:78209117-78209139 CCTTCCAACTCTTCTCCCTTTGG - Intergenic
933762853 2:85685196-85685218 CCTTCCAGCTGGACTCCCTTAGG - Intronic
933970706 2:87467818-87467840 GCTTCCGGCTGGACTCCCTGAGG - Intergenic
936323022 2:111482364-111482386 GCTTCCGGCTGGACTCCCTGAGG + Intergenic
936376545 2:111946062-111946084 CCTTCCATCTGTGCTCCCTGAGG - Intronic
938684643 2:133726240-133726262 TCTGCCAGCTTGACTTCCTTGGG - Intergenic
939183280 2:138828741-138828763 CTTTCCATCTGGGCTCCATTAGG - Intergenic
939999101 2:148949466-148949488 GCTTCCCTCTGGGCTCCCTTCGG + Intronic
940169554 2:150813368-150813390 TCTTCCTGCTGGACTTCCTACGG - Intergenic
941485845 2:166081214-166081236 CCTTACAGTTAAACTCCCTTGGG + Intronic
947185469 2:227451421-227451443 CCCTCCAGATGGACTCACTCTGG - Intergenic
948131708 2:235605598-235605620 CTTTCCTTCTGGTCTCCCTTAGG - Intronic
948515964 2:238504178-238504200 GGGCCCAGCTGGACTCCCTTTGG - Intergenic
948523736 2:238558060-238558082 CCTTCCAGCCTGACCTCCTTGGG - Intergenic
1169310282 20:4532215-4532237 CCTTCCAGCTGTGCTCCCTCAGG + Intergenic
1171361217 20:24587637-24587659 ACTCCCAGCTGGCCTCGCTTAGG - Intronic
1172313428 20:33935170-33935192 TCTTCCTGCCGGACTCCCCTTGG - Intergenic
1173254034 20:41380766-41380788 CCTGGCCGCTGGATTCCCTTAGG + Intergenic
1175099060 20:56565245-56565267 ACTGCAAGCTGGTCTCCCTTAGG - Intergenic
1175162994 20:57022528-57022550 CCCTCTAGCTGGGCTCCCTCTGG + Intergenic
1175279708 20:57794851-57794873 CCCTCGAGCTGGACGCCTTTGGG - Intergenic
1176025039 20:62981519-62981541 GGTTCCTGCTGGACTCCCCTCGG + Intergenic
1179930539 21:44568420-44568442 CCTGTCTGCTGGCCTCCCTTGGG + Intronic
1180160463 21:45996846-45996868 GCTGCCTGCTGGACTTCCTTGGG - Intronic
1183199379 22:36375316-36375338 CTTTCCACCTGCTCTCCCTTAGG + Intronic
1183499063 22:38167578-38167600 CCTTCCAGCTGGACTCGATCAGG - Intronic
1184011372 22:41751171-41751193 CCTTCCAGATGGGCTCCTCTTGG - Intronic
1184922685 22:47616523-47616545 CTTTCCCGCTGGGCACCCTTGGG + Intergenic
949888189 3:8712820-8712842 CCTTCCTGCTGGATGCCCTATGG + Intronic
950810653 3:15647125-15647147 CCTTCCAGAGGGACTTCCTAGGG - Intergenic
955752810 3:62199457-62199479 CCTTCCAGCAGGGCACCATTCGG - Intronic
955784034 3:62517355-62517377 CTTGCCAGCTGGATTGCCTTGGG + Intronic
961958055 3:130824679-130824701 CCTTCCATATGGCCTCACTTTGG + Intergenic
965415242 3:168384774-168384796 GCTTCCAGCTGCACTGCCTGGGG + Intergenic
967217836 3:187225323-187225345 CCTTCCTGCTGGGGTCCCTCAGG + Intronic
967708609 3:192680397-192680419 CTTTCCTGCTGGAGTCCGTTGGG - Intronic
967748082 3:193082371-193082393 CGTTTCATCTGGACACCCTTTGG - Intergenic
967914035 3:194564918-194564940 CCTTCCTGATGGACTGCCCTGGG - Intergenic
968282677 3:197489212-197489234 CTGTCCAGCTGGCCTCCCCTTGG - Intergenic
969395388 4:6917399-6917421 CCTTCCTCCTGGGCTCCTTTTGG - Intronic
971037826 4:22714383-22714405 CCTTCCTGCTGGACTGCAGTGGG + Intergenic
971957146 4:33435315-33435337 CCTCCCAGCTGGCCTCCCAAAGG + Intergenic
972371841 4:38431483-38431505 CCTACCAGCTGGAAGACCTTGGG + Intergenic
973140437 4:46760974-46760996 CCTTCCTACTGGACTTCCTGGGG + Intronic
973643997 4:52931976-52931998 CCTTCCAGGTGGTCTTCTTTGGG - Intronic
981958784 4:150510615-150510637 CATTCCAACTTGACTTCCTTTGG + Intronic
982325340 4:154124028-154124050 CATGCCTGCTGGACTCTCTTTGG + Intergenic
983177776 4:164611577-164611599 GCTTCCAGCTGTATTCCCTTGGG + Intergenic
985460863 4:190105382-190105404 CATTTCATTTGGACTCCCTTAGG + Intergenic
986594302 5:9404802-9404824 CCTTCCAGGTGGACTGTCTCAGG + Intronic
986779740 5:11054363-11054385 TTTTCTAGCTTGACTCCCTTGGG - Intronic
987320363 5:16763429-16763451 CAGTCCAGCTGGACCCCCTTGGG + Intronic
988507355 5:31835188-31835210 CCTTTCAGCTCCACTACCTTTGG - Intronic
989449917 5:41574536-41574558 CCTATCAGCTGCACTCACTTGGG + Intergenic
989716634 5:44471019-44471041 CCTTCCAAGGGGTCTCCCTTGGG + Intergenic
990993367 5:61707000-61707022 CCTGCCAGCTGGCTTCCCATAGG - Intronic
993411119 5:87574346-87574368 CCTACCAGATGCACTCCCTTAGG - Intergenic
993852078 5:93023180-93023202 CCTTCCTGCTGCTCTCCATTGGG + Intergenic
995655906 5:114425809-114425831 CCTTCCACCTTGGCTCCCTGTGG + Intronic
996578033 5:124998334-124998356 CCATCCAGCTAGATTCCTTTTGG + Intergenic
1000058028 5:157626692-157626714 CCTTACAGTCGGCCTCCCTTTGG - Exonic
1000912402 5:167038022-167038044 CCTTCCAGGAGGTCTCCTTTGGG - Intergenic
1001328455 5:170745905-170745927 CATTCCAGCTGCACGCCCTTAGG + Intergenic
1001821650 5:174715038-174715060 CCTTCCAGCTGGGTGGCCTTGGG - Intergenic
1001884918 5:175280828-175280850 CCTTCCAGTTTTACTCACTTGGG + Intergenic
1003573025 6:7268431-7268453 CCTTCCAGCCGGGCTGCCTGAGG - Intronic
1004232429 6:13845606-13845628 CATTCCAAATGCACTCCCTTAGG + Intergenic
1006581380 6:35079559-35079581 CCTCCTGGCTGGACTCCCTGGGG + Exonic
1011502859 6:88010255-88010277 CCTTCAAACTGGTTTCCCTTTGG + Intergenic
1014627622 6:123748272-123748294 CCATTCATATGGACTCCCTTAGG + Intergenic
1017010098 6:150057750-150057772 CCTTCCAGCTGGGGTCCTTCGGG + Intergenic
1018723100 6:166588769-166588791 CTGCCCAGCTGGACTCTCTTCGG - Intronic
1019198107 6:170293979-170294001 CCCTCCAGCTCGAATCCCTAAGG - Intergenic
1019817029 7:3208872-3208894 CGTTCCAGCTCTACCCCCTTGGG + Intergenic
1022009996 7:26300512-26300534 CCTCCCAGCTGAACTGCCTAGGG + Intronic
1024221690 7:47293756-47293778 CCTTTCAACCGCACTCCCTTCGG + Exonic
1032138847 7:129308032-129308054 GCTTCAAGCTGCACTGCCTTGGG + Intronic
1032451568 7:132036188-132036210 CATGCCAGCTGGAGTCCCCTAGG + Intergenic
1034694734 7:153043539-153043561 CCTTCCTGCTGGACAGCCTCAGG - Intergenic
1040678360 8:49779704-49779726 TCTTCTAACTGGACTGCCTTGGG + Intergenic
1044614853 8:94129418-94129440 CCTTCAGTCTGGACTCCCTATGG - Intronic
1045475538 8:102549364-102549386 CCCCTCAGCTGGAGTCCCTTGGG - Intergenic
1046221925 8:111227828-111227850 CCTGTCATCTGGACTTCCTTAGG + Intergenic
1049799373 8:144510669-144510691 TCTTCCACCTGGACACCCTGGGG + Exonic
1055351721 9:75395712-75395734 CCTCCCTGATAGACTCCCTTTGG + Intergenic
1055435148 9:76285363-76285385 CCTTCCACTTTGACTCTCTTAGG - Intronic
1056445582 9:86663337-86663359 GGTTCCAGCTGTACTCCCATAGG - Intergenic
1058585043 9:106498701-106498723 CATTCCAACTGTACTCCTTTTGG + Intergenic
1059175966 9:112170473-112170495 CCTACCCTCTGGACTCCCCTGGG + Intronic
1062008790 9:134256143-134256165 CCTTCCTTCTGGAATCCCCTGGG - Intergenic
1062371635 9:136242295-136242317 CCTTCCAGCTGGAGGCTCCTGGG + Intronic
1186553041 X:10527320-10527342 CATCCCAGCTGGACTCTCTTCGG + Intronic
1199566499 X:149221295-149221317 TGTTCCAGCTGGACTGCCTTTGG - Intergenic
1200252826 X:154562804-154562826 TCTTCCAGCTGCATTCCCTAAGG - Exonic
1200264941 X:154641612-154641634 TCTTCCAGCTGCATTCCCTAAGG + Intergenic
1201074392 Y:10175804-10175826 CCTTCCAGCTGACCTGCCTAGGG - Intergenic