ID: 933764707

View in Genome Browser
Species Human (GRCh38)
Location 2:85698689-85698711
Sequence CAGCAGAGGGAGTCAGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1252
Summary {0: 1, 1: 0, 2: 6, 3: 124, 4: 1121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933764707 Original CRISPR CAGCAGAGGGAGTCAGGGGA GGG (reversed) Exonic
900422113 1:2560157-2560179 CAGGTGATGGAGGCAGGGGAAGG + Intronic
901221101 1:7584287-7584309 GAGCAGGGGGCATCAGGGGACGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901429142 1:9201817-9201839 CAGCAGAAGGAGTCAGCTGGAGG - Intergenic
901442054 1:9283883-9283905 CAGCAGAGGAATTTAGGGGTTGG - Intergenic
902005129 1:13225906-13225928 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902024354 1:13371700-13371722 CCCCAGAGGGAGGCAGGGGAAGG + Intergenic
902570208 1:17342273-17342295 CAGGGGAGGGGGTAAGGGGAAGG - Intronic
902727183 1:18344939-18344961 CTGCAGAGGGAGGCATGGGCTGG + Intronic
903031910 1:20469780-20469802 TAGCAGATGGAGTAAGTGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903556578 1:24198038-24198060 CAGCAGATGGAGACAGGGCTGGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904286936 1:29458979-29459001 CAGCAGAGGGACCCTGGGAAGGG + Intergenic
904538265 1:31215631-31215653 CAGGAAAGGGACTGAGGGGAGGG - Intronic
904598753 1:31662475-31662497 CTGAGGTGGGAGTCAGGGGAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904840251 1:33367932-33367954 CAGCAGAGGGCGCCAGGGACCGG - Intronic
904877565 1:33668192-33668214 CAGGAGAGGTAGGCAGGGGCAGG + Intronic
905332269 1:37213489-37213511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
905332414 1:37214611-37214633 CAGCAAAGGGAGATAGGGGTAGG - Intergenic
905556532 1:38889794-38889816 GAGCATAGGGAATTAGGGGATGG - Intronic
905920248 1:41714496-41714518 CAGCAGGGGGGATGAGGGGATGG + Intronic
905923160 1:41732444-41732466 CAGCAGGGTGACTGAGGGGAGGG + Intronic
905986756 1:42292005-42292027 CAGGAGTGGGAGCCAGGGGATGG + Intronic
906049245 1:42857024-42857046 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
906208505 1:43999578-43999600 CAGTGGTGGGAGGCAGGGGAGGG - Intronic
906378462 1:45316224-45316246 CAGCAAAGAGAGTTAGGGGTGGG - Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906783332 1:48591995-48592017 AAACAGAGGGTGTCAGGGGTGGG + Intronic
907270645 1:53288956-53288978 TAGCAGAGGCAGGCAGGGGGAGG - Intronic
907740751 1:57163434-57163456 CAGCAGAGCAAGCAAGGGGAAGG + Intronic
907786375 1:57617103-57617125 CAGGAAAGGGAGTCTGGGCAGGG - Intronic
907839725 1:58145010-58145032 AAGCATAGGCAGTCAGGGGATGG + Intronic
908068646 1:60434404-60434426 CAGCAGAGGGACTCTGGGTCTGG + Intergenic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908378572 1:63572801-63572823 CAGCAAAGGGAGATAGGGGTGGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908567946 1:65377998-65378020 CTGAAGAGTGTGTCAGGGGAGGG - Intronic
908768128 1:67572406-67572428 GAGCAGAGGGAAGGAGGGGAAGG + Intergenic
908813808 1:68011336-68011358 CAACATAGGGGATCAGGGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910003059 1:82360261-82360283 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
910666162 1:89727827-89727849 CAGCAGTGGGAAACTGGGGAAGG + Intronic
910703559 1:90102966-90102988 CAGCAGAGGGGGTCAGCAGCTGG + Intergenic
911072607 1:93844424-93844446 CAACAGAGGGAGTCAAAGCATGG - Intronic
911510113 1:98801154-98801176 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
911720804 1:101189327-101189349 CACCAGAGCCTGTCAGGGGATGG + Intergenic
912097477 1:106163125-106163147 GAGCTGAGGGAGTCAAGGGCTGG - Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912747091 1:112253963-112253985 CTGGTGATGGAGTCAGGGGACGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912815606 1:112825762-112825784 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
913273109 1:117113301-117113323 CAGCAGTGGGAATCAAGCGACGG - Intronic
913997251 1:143661587-143661609 CAGCGTAGCGAGTCAGGTGAAGG + Intergenic
914221536 1:145686438-145686460 GAGCAGGGGGAGGCAGGGGCAGG - Intronic
914474099 1:148009304-148009326 GAGCAGGGGGAGGCAGGGGCAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915003087 1:152611488-152611510 CAGCTGAGGGAGGTAGGAGATGG - Intergenic
915546643 1:156602637-156602659 CCGCTGTGGGAGTGAGGGGAGGG + Intergenic
915624674 1:157107329-157107351 GGGCAGAGGGAGGCAGGTGAGGG - Intergenic
915740274 1:158113753-158113775 GAGCAGAGGAGGGCAGGGGAGGG - Intergenic
915876281 1:159614696-159614718 CAGCAGAGAGAGTTAGGAAAGGG + Intergenic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
916866540 1:168865766-168865788 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918174675 1:182032637-182032659 CAGCAGATGGGGTCAGGGTGGGG - Intergenic
918567178 1:185948380-185948402 CAGCAAAGGGAGATAGGGGTGGG + Intronic
918568043 1:185953865-185953887 CAGCAAAGGGAGATAGGGGTGGG + Intronic
919091194 1:192980276-192980298 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
919759986 1:201091793-201091815 CTGCAGAGGCAGGCAGGGAAGGG + Intronic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920283048 1:204858630-204858652 GAGCGGAGGGAGTGAGGAGAGGG - Intronic
920457866 1:206114832-206114854 CAGCAGAGGGAATTAGAGGTTGG + Intronic
920559708 1:206930457-206930479 CAGTGGGTGGAGTCAGGGGAGGG + Intronic
920764766 1:208821648-208821670 CAGCAGATGGAATCCAGGGAAGG + Intergenic
921238820 1:213155237-213155259 TAGCTGAGGCAGTCAAGGGAGGG - Intronic
921284252 1:213594846-213594868 CAGCACAGGAAGTGAGTGGAGGG + Intergenic
921326501 1:213989711-213989733 CAGCAGGGGGAGTAACGGGCTGG - Intronic
921848077 1:219905172-219905194 CTGCAGAGGGAGGCAGAGGCAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922598707 1:226833818-226833840 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
922599408 1:226838280-226838302 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
923355582 1:233151934-233151956 CAGCAGAGAGAGGCAGAGGGAGG - Intronic
923373891 1:233340578-233340600 CCGGGGTGGGAGTCAGGGGAAGG + Intronic
923390214 1:233507475-233507497 CAGCAGAGGAATTCTGTGGAAGG - Intergenic
923719754 1:236456721-236456743 GTGCAGAGGGAGTGAGGGGGAGG - Intronic
923956759 1:239031139-239031161 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
923963266 1:239106941-239106963 CAGCAAAGGGAGATAGGGGCGGG - Intergenic
924181170 1:241439761-241439783 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
924258999 1:242210746-242210768 CAGCAAAGGGAGATAGGGGTGGG - Intronic
924688803 1:246324971-246324993 AAGGAGAAGGAGTCAGGGGGCGG + Intronic
924743719 1:246813485-246813507 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063153136 10:3354936-3354958 AGGCAGAGGGAGCCAGAGGAAGG - Intergenic
1063576310 10:7265174-7265196 GAAGAGAGGGAGGCAGGGGAGGG - Intronic
1063964657 10:11337713-11337735 CAGCCGAGGGCGTCATGGGTAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064636845 10:17377277-17377299 CAGCAAAGGGAGAGAGGGGTGGG - Intronic
1064637591 10:17385480-17385502 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1065758783 10:28962107-28962129 CAGCAGATGGAGTCTGGTGAGGG - Intergenic
1065983336 10:30925198-30925220 CAGCAGAGTAAGTCAGGGTCGGG - Intronic
1067360769 10:45575965-45575987 CAGCAAAGGGAGAAAGGGGTGGG - Intronic
1068522612 10:58094183-58094205 CAGCAGACGGAGATAGGGGTGGG + Intergenic
1068889182 10:62131075-62131097 CAGGAAAGTGAGTCAGGGAAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069594371 10:69661117-69661139 GGGCAGAGAGAGTCGGGGGAGGG + Intergenic
1069606692 10:69743373-69743395 CAGCAGAGGGCGACAGTGGGAGG + Intergenic
1070350184 10:75584141-75584163 GAGCAGGGGGTGGCAGGGGAAGG - Intronic
1070476490 10:76834314-76834336 CAGCAGTGGGAGTCAGAAGTGGG + Intergenic
1070774197 10:79100304-79100326 CAGCAGAAAGAGGCAGGTGAGGG + Intronic
1070863830 10:79694027-79694049 CAGCAGAGGGAGCCACGTGATGG - Intergenic
1070869509 10:79738160-79738182 CAGAAAAGGGAGTCAAGGGTGGG + Intergenic
1071187797 10:83063241-83063263 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1071450858 10:85790529-85790551 GGGCAGAGGGAGTGGGGGGAAGG + Intronic
1071499188 10:86191508-86191530 CAGGATAGGGAGTCTGGGAAGGG - Intronic
1071636429 10:87260367-87260389 CAGAAAAGGGAGTCAAGGGTGGG + Intergenic
1071658815 10:87477578-87477600 CAGAAAAGGGAGTCAAGGGTGGG - Intergenic
1071915884 10:90295291-90295313 CAGCAAAGGGAGGTAGGGGTAGG - Intergenic
1071916693 10:90300603-90300625 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1071960762 10:90807616-90807638 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1071961614 10:90813137-90813159 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1072187956 10:93060432-93060454 CGGCAGAGGGAGCCAGCGGCCGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072613723 10:97035755-97035777 GAGCAGAGGGAGGGAGGGGCAGG - Intronic
1073132791 10:101201102-101201124 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1073339571 10:102734899-102734921 CAACTGAGGGGGTCTGGGGAAGG - Intronic
1073495747 10:103889489-103889511 CAGAAGAAGGAGTCATGGGGTGG - Intronic
1073683264 10:105727879-105727901 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1074447025 10:113529068-113529090 CAGCTGAGCGAGTGAAGGGAGGG + Intergenic
1074508093 10:114088889-114088911 CAGCAAGGGGAGGCAAGGGAGGG - Intergenic
1074544523 10:114392282-114392304 CAGGAGACTGAGTCAGAGGATGG + Intronic
1074856634 10:117478923-117478945 CAGCAAAGAGAGGCAGGGAAGGG + Intergenic
1075453541 10:122569930-122569952 CAGCAGAGGAGGTGTGGGGAGGG + Intronic
1075582619 10:123633793-123633815 CAGGAGAGGAAGGCAGAGGAGGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1076018934 10:127054155-127054177 CAGAAGAAGGACTCAGGAGAAGG + Intronic
1076516789 10:131050179-131050201 CAGCAAAGGGAGAGAGGGGTGGG - Intergenic
1076738296 10:132468411-132468433 AAGGAGAGGGAGTTCGGGGAGGG + Intergenic
1076832670 10:133004490-133004512 CAGCAAAGGGAGCTAGGGGTGGG - Intergenic
1077366659 11:2163968-2163990 CAGCAGACAGTGTCAGGGAAGGG + Exonic
1077368598 11:2171293-2171315 GGGCAGAGGGAGGCAGGGGCAGG + Intronic
1077397300 11:2331346-2331368 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1077434620 11:2532839-2532861 CAGCAGAGGGAGGCTGTGCAGGG + Intronic
1077774832 11:5259011-5259033 CAGCAGAGGCAGTCAGGTGGTGG - Intronic
1077883068 11:6366315-6366337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077883875 11:6371537-6371559 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1077937387 11:6802132-6802154 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1078062858 11:8059680-8059702 CAGCAGAGCAAGGCAGGAGAGGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078329638 11:10409032-10409054 GGGCAGAGGGAGTGAGGGAAGGG - Intronic
1078466419 11:11553559-11553581 GAGGAGGGGTAGTCAGGGGAGGG + Intronic
1078498201 11:11841730-11841752 CGGCAGAGGGAGTCCCGAGATGG + Intronic
1078757868 11:14228424-14228446 CAGCTGTGGGAGGCAGGGGAAGG + Intronic
1078854096 11:15192183-15192205 CAACAGAGGGAGCCAGAGGGAGG - Intronic
1078934912 11:15941712-15941734 CAGCACAGGGAGCCTGGGCAAGG + Intergenic
1079121111 11:17685912-17685934 AAGTAGAGGAGGTCAGGGGAAGG - Intergenic
1080027423 11:27629171-27629193 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1080028263 11:27634578-27634600 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1081211203 11:40336678-40336700 CAGAAGAGCGAATCAGGGGCTGG + Intronic
1081468324 11:43345892-43345914 CAGCAGAGTGATCAAGGGGAGGG - Intergenic
1081594848 11:44452074-44452096 CATCAGAGGGAGCCAAGGGGAGG - Intergenic
1081594948 11:44452717-44452739 CCCCAGTGGGAGGCAGGGGAGGG - Intergenic
1081785683 11:45745245-45745267 CAGCCAAGGGAGACAGGAGAGGG + Intergenic
1081813562 11:45926612-45926634 AAGCAGAGAGGGGCAGGGGAAGG - Intronic
1081850904 11:46274651-46274673 CATCTGAAGGAGTTAGGGGATGG - Intergenic
1082189261 11:49223001-49223023 CAGCAGAGAGAGACAGAGAAAGG - Intergenic
1082211679 11:49510692-49510714 GAGGAGGGAGAGTCAGGGGAAGG + Intergenic
1082806026 11:57451121-57451143 CAGCAGAGTGAGGCTGGGAAAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083065557 11:59920228-59920250 CAGCAGAGGGCACCGGGGGAAGG - Intergenic
1083190696 11:61050020-61050042 GAGCAGAGGGAGCCAGGGCCAGG - Intergenic
1083255430 11:61492537-61492559 CAGCAGCAGGAGCCAGGGGTGGG - Intergenic
1083543218 11:63529418-63529440 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1083554209 11:63613538-63613560 CAGCAGAGGGATTCAGAGGATGG - Intronic
1083857706 11:65401324-65401346 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1083857712 11:65401337-65401359 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857718 11:65401350-65401372 CAGGGGAGGGAGGCAGGGGAGGG - Intronic
1083857729 11:65401376-65401398 CAGGGGAGGGAGGCTGGGGAGGG - Intronic
1084045360 11:66564871-66564893 GAGCAGAGTGAGTGAGGGGCAGG - Exonic
1084334054 11:68446655-68446677 GAGCAGAGGGAGGCAGGGCTGGG - Intronic
1084371997 11:68750889-68750911 CAGGTGAGGGGGTCAGGGGAGGG + Intronic
1084372081 11:68751105-68751127 CAGGGGAGGGAGTCAGGGGAGGG + Intronic
1084445685 11:69202281-69202303 CAGCACAGGGAACCAGGGCAAGG - Intergenic
1084582470 11:70032516-70032538 GAGCAGAGGGAGGCGGGAGAGGG + Intergenic
1084840877 11:71846195-71846217 CACCAGAGCCAGTCAGGGGATGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085511665 11:77091316-77091338 CAGCAGAGGGTGGCAGAGGCAGG - Intronic
1085514627 11:77105146-77105168 CAGCAGAGGGACTCAGGCCCCGG - Intronic
1085844334 11:80048513-80048535 TAGCTGTGGGAGACAGGGGATGG + Intergenic
1085934759 11:81127367-81127389 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1085987682 11:81806445-81806467 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1085988580 11:81812556-81812578 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1086115630 11:83246550-83246572 GAGCAGAGAGAGACAGGAGAGGG + Intronic
1086125088 11:83342081-83342103 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1086132827 11:83419423-83419445 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1086504891 11:87494774-87494796 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1086517447 11:87629147-87629169 CAGCAGATGGAGGCAGGGACTGG + Intergenic
1086550802 11:88049510-88049532 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1086677262 11:89623605-89623627 CAGCAGAGAGAGACAGAGAAAGG + Intergenic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087240290 11:95767497-95767519 AAGCAGAGGGAATCAGTGGAGGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087840181 11:102912270-102912292 CAGCAAAGGGAGACAGGTGTGGG - Intergenic
1088111816 11:106270483-106270505 AAGCAGGGGGTGTCAGGGGAAGG - Intergenic
1088146423 11:106685738-106685760 CAGAAGAGGGGGTCAGGCAAAGG + Intronic
1088719481 11:112579398-112579420 CACCAGTGGGGGTCAGGGCAGGG - Intergenic
1088754291 11:112872841-112872863 CTGCAGAGAGAGTGAGGGGAAGG - Intergenic
1088771657 11:113042048-113042070 TACCAGAGGAAGTCAGAGGAGGG - Intronic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1088858527 11:113778534-113778556 CAGCAAGGGGAGCCTGGGGAGGG + Intergenic
1089126441 11:116179731-116179753 CAGCAGATGGTGTCAGTGAAGGG + Intergenic
1089141075 11:116284793-116284815 GATCAGTGGCAGTCAGGGGATGG + Intergenic
1089189402 11:116643174-116643196 AAGCAGGGGGAGTGGGGGGAGGG + Intergenic
1089683191 11:120130841-120130863 CAGCAGATGTGGTCAGGTGAGGG + Intronic
1089690575 11:120184545-120184567 CAGCAGAGGAGGAAAGGGGAGGG - Intronic
1089770962 11:120802612-120802634 CAGCAGGGGGAGGCTGGAGAAGG + Intronic
1089828211 11:121298816-121298838 CAGCAAAAGGAGTTAGGGGTGGG + Intronic
1090075338 11:123577247-123577269 CAGCTCAGGGAGCCAGGTGAGGG - Intronic
1090162506 11:124510386-124510408 CTGCAATGGCAGTCAGGGGACGG + Intergenic
1090570359 11:128038226-128038248 CAGCAGAGGGGCTCTGTGGAAGG + Intergenic
1090854175 11:130597801-130597823 GAACAGAGGGAGGCAAGGGATGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090926459 11:131254630-131254652 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1091404264 12:199134-199156 CAGCAGGGGGAGGGTGGGGAGGG + Intronic
1091549775 12:1529117-1529139 CAGCAGGGAGGGTCAGGGAATGG - Intergenic
1091629934 12:2152420-2152442 CTGCAGAGGGAGAAAGGGAAAGG - Intronic
1091801432 12:3327031-3327053 CACCAGAGGGTGCCACGGGAGGG + Intergenic
1092039217 12:5368827-5368849 CTGCAGAGGGGGTCTGGGGCAGG - Intergenic
1092081852 12:5723179-5723201 TAGCAGAGGCAGTTAGGGAATGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092474950 12:8810457-8810479 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092734272 12:11565329-11565351 CAGCAGAAGGTGGCAGGGGGTGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092915687 12:13186978-13187000 CAGCATAGGGAGGAAGTGGAGGG + Intergenic
1092925138 12:13265219-13265241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1092930738 12:13313033-13313055 TAACAGAGGGAGCCATGGGAGGG - Intergenic
1093072913 12:14724991-14725013 CAGCAAAGGGAGGTAGGGGTGGG + Intergenic
1093083615 12:14841979-14842001 CAGCAGAGTGAGTCAAGGGTTGG + Intronic
1093213426 12:16334474-16334496 CTGCATAGAAAGTCAGGGGAAGG - Intergenic
1093812313 12:23505931-23505953 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094247941 12:28323895-28323917 CAGCATAGGATGTGAGGGGAAGG + Intronic
1094316388 12:29140456-29140478 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094329448 12:29275166-29275188 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1094466898 12:30763024-30763046 CAGAAGCAGGAGTGAGGGGAAGG + Intergenic
1094491137 12:30961475-30961497 CACCAGAGGGGGTCACGGGAGGG - Intronic
1094723688 12:33090522-33090544 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1094826611 12:34274134-34274156 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1095049870 12:37545881-37545903 CAGTAGGGGGCGGCAGGGGAGGG - Intergenic
1095200458 12:39378512-39378534 AAACTGAGGGAGTGAGGGGAGGG + Intronic
1095304499 12:40623905-40623927 GAGCAGAGAGAGTAAGGGGAAGG + Intergenic
1096411160 12:51378054-51378076 CAGCAGAGGAGGTCAAGGAAAGG - Intronic
1096459081 12:51812138-51812160 CAGCAGTGGGGGGCAGGGGCAGG - Exonic
1096749654 12:53750898-53750920 CGGCAGATGGAGCCAGTGGAGGG - Intergenic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1096789577 12:54036377-54036399 GAGCAGAGGGGCTCTGGGGAGGG + Intronic
1096842848 12:54390060-54390082 TAGCAGAGGGACTCAGGAGAGGG + Intronic
1096906657 12:54942640-54942662 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1096907450 12:54948079-54948101 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1097398218 12:59101952-59101974 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097416562 12:59323287-59323309 CAGCAAAGGGAGACAAGGGTGGG + Intergenic
1097592894 12:61592809-61592831 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1097690523 12:62730135-62730157 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1097726391 12:63080022-63080044 CAGCAGGGAGAGAAAGGGGAGGG - Intergenic
1098050968 12:66452255-66452277 CAGCACAGGCAGCCAGGGAAAGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098573717 12:72016934-72016956 ATGCAGAGGGAGTGAGAGGAGGG + Intronic
1099291620 12:80783224-80783246 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099292432 12:80788589-80788611 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1099677621 12:85782601-85782623 TAGCAAAGAGAGTCAGAGGAGGG - Intergenic
1099872552 12:88368351-88368373 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1100065692 12:90641425-90641447 AAGCAGATGGAGGCATGGGAAGG + Intergenic
1100263814 12:92957151-92957173 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1100302716 12:93322969-93322991 CTGCAGAGGAAGTCAGGGCAAGG + Intergenic
1101173358 12:102122466-102122488 TAGCAGAAGGAGTCAGGAAATGG + Intronic
1101593430 12:106141981-106142003 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1101963255 12:109265434-109265456 CAGCACTGGCAGGCAGGGGATGG + Exonic
1102117068 12:110410804-110410826 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1102423688 12:112824136-112824158 CAGCAGAGGAAGCTAGGCGAGGG + Intronic
1102893636 12:116581130-116581152 CAAGAGAGAGAGTGAGGGGAAGG - Intergenic
1103161020 12:118729481-118729503 CACCAGAGACAGTAAGGGGAAGG - Intergenic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1104188456 12:126455057-126455079 GAGCAGTGGGGCTCAGGGGAGGG - Intergenic
1104258157 12:127157943-127157965 CAGCAAAGGGAGATAGGAGAGGG - Intergenic
1104332690 12:127862199-127862221 ACGCAGAGGGAGTGAGGGGATGG + Intergenic
1104572285 12:129935639-129935661 GAGGAGAGGGAGACAGGGAAGGG - Intergenic
1106050768 13:26187482-26187504 CACCAGAGGGGGCCAGGGAAGGG - Intronic
1106068250 13:26380051-26380073 GAGCAGTGGGATGCAGGGGAAGG + Intronic
1106078891 13:26484411-26484433 GAGCAGAGGGTGTCACGGGAGGG - Intergenic
1106082742 13:26514102-26514124 CGTCAGAGGCAGTCAGGGGCTGG - Intergenic
1106587289 13:31068574-31068596 GTGCAGAGGGAATCAGGTGAGGG - Intergenic
1106682733 13:32024944-32024966 CAGCAGAGGGGGTTGGGGGTAGG + Intergenic
1106701044 13:32228921-32228943 CAGCAGATGGAGGCAGGAGATGG + Intronic
1106907700 13:34425778-34425800 AAGCACAGGGAGTCGGGGGTGGG + Intergenic
1107737880 13:43417187-43417209 CAACAGAGGGAGACGGGAGACGG + Intronic
1108196659 13:48001885-48001907 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108912937 13:55578327-55578349 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108913759 13:55583737-55583759 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1108977255 13:56462894-56462916 GTCCAGAGGGAGTCAGGGGAAGG + Intergenic
1109351473 13:61188006-61188028 CAGAAGAAGGAGGCAGAGGAAGG + Intergenic
1109498958 13:63213425-63213447 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1109709181 13:66141433-66141455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1109709979 13:66146706-66146728 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1110388663 13:74945542-74945564 CAACAGAGGCAGGGAGGGGAGGG + Intergenic
1110388698 13:74945634-74945656 CAACAGAGGCAGGGAGGGGAGGG + Intergenic
1110467077 13:75814463-75814485 CAGTAGAGGGATTGAGAGGAGGG + Intronic
1110467143 13:75814922-75814944 GAGCAGAGGGAGTGGGGGCATGG + Intronic
1110649997 13:77933322-77933344 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1111035019 13:82661107-82661129 CCGAAAAGGGAGTCAGAGGAGGG + Intergenic
1112054391 13:95677110-95677132 CAGCAGAGGAAGGCAGCGGTGGG - Intergenic
1112308306 13:98295312-98295334 CAGCAGAGGGAGCCCTGGGCAGG + Intronic
1112769422 13:102779831-102779853 CAGGGTAGGGAGTCAGTGGATGG + Intergenic
1112922767 13:104636110-104636132 CAGGAGAGATAGGCAGGGGAGGG - Intergenic
1113202639 13:107883969-107883991 CAACTGTGGGAGTGAGGGGAAGG + Intergenic
1113480335 13:110615779-110615801 CAGCAGAGGCGGTCAGCGGTCGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113739864 13:112704096-112704118 CAGGCGGGGGAGTCACGGGAGGG + Intronic
1113748985 13:112765428-112765450 AATCAGATGGAGTGAGGGGAAGG - Intronic
1113889959 13:113730531-113730553 CCGCAGAGGCTGTCACGGGATGG - Intronic
1114179786 14:20356496-20356518 TATAAGAGGGAGTCAGAGGAAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114533430 14:23409270-23409292 GAGCAGAGGGTAGCAGGGGAGGG - Intergenic
1114771288 14:25430641-25430663 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1115055005 14:29113633-29113655 CAGCACAGGGACTAAGGGTATGG - Intergenic
1115398464 14:32934449-32934471 CAGCTGAGGGAAGAAGGGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116277586 14:42856236-42856258 CAGCAGAGGAAGTCAGGCACTGG + Intergenic
1116650030 14:47578238-47578260 CATCAGAGCCAGTCAGGGGGTGG + Intronic
1116973459 14:51093072-51093094 GAGCAGAGGGAGTAAGTGGGAGG + Intronic
1117256739 14:53985794-53985816 CAGCAGAGGGACCCAGGGCCTGG - Intergenic
1117833339 14:59776679-59776701 CATCAGAGAGGGTAAGGGGAAGG - Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1119046004 14:71319894-71319916 CAGCATGGGGAGTGTGGGGATGG + Intergenic
1119168268 14:72513740-72513762 CAGCAGAGGGTGTCAAGCCAGGG - Intronic
1119247872 14:73128552-73128574 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1119520566 14:75281380-75281402 GAGCTGAGCGAGTCAGAGGAAGG - Exonic
1120250879 14:82061004-82061026 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
1120305121 14:82760252-82760274 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1120433107 14:84444293-84444315 GAGCAGGGGAAGGCAGGGGAGGG - Intergenic
1120618711 14:86736939-86736961 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120661291 14:87254174-87254196 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1120839962 14:89076885-89076907 CTGCAGAGGTAGGCAGGGGCTGG + Intergenic
1120942350 14:89960859-89960881 CAGCAGGGCGGGGCAGGGGAGGG - Intronic
1121192377 14:92041858-92041880 CAGCAAAGGGTGTTAGGGGTGGG + Exonic
1121258941 14:92552527-92552549 GAGCAGAGGGGGTAGGGGGAGGG - Intronic
1121389136 14:93559492-93559514 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1121432969 14:93900371-93900393 AAGGAGATGGAGTCAGGGGAGGG - Intergenic
1121704157 14:95978739-95978761 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1121980063 14:98446894-98446916 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1121980835 14:98452317-98452339 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1122014584 14:98783563-98783585 CAGGAGAGGAAGTCACAGGATGG + Intergenic
1122507368 14:102240198-102240220 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1122529009 14:102411619-102411641 CAGCAGAGGGAGATAGGGGTGGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122647940 14:103207404-103207426 GAGGAGAGGGAGGAAGGGGAGGG - Intergenic
1122778855 14:104135241-104135263 CACTGGGGGGAGTCAGGGGAAGG + Intergenic
1123008144 14:105334192-105334214 CAGGAGGAGGTGTCAGGGGAAGG - Intronic
1123198969 14:106643397-106643419 CAGCTGGTGGAGTCTGGGGAAGG - Intergenic
1123200411 14:106657990-106658012 CAGCTGGTGGAGTCTGGGGAAGG - Intergenic
1202900227 14_GL000194v1_random:32231-32253 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1124024242 15:25949887-25949909 AAGCTGAGGAAGTCAGAGGATGG + Intergenic
1124375842 15:29128204-29128226 CAGCAGAGGGAGAAAGGGCACGG - Intronic
1124904389 15:33855157-33855179 CAGGAGAGGGAGGGAGGTGATGG + Intronic
1125046400 15:35246134-35246156 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1125316966 15:38441929-38441951 CAGCTGAGTGAGTCCAGGGAGGG + Intergenic
1125647616 15:41285423-41285445 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1125724991 15:41863647-41863669 GAGCAAATGCAGTCAGGGGAGGG - Intronic
1125744373 15:41988753-41988775 CAGCATAGGTGTTCAGGGGAAGG + Intronic
1125968715 15:43894676-43894698 CAGGGGAGGGAGGCAGCGGAGGG + Intronic
1126154346 15:45551338-45551360 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127485273 15:59412753-59412775 CAGCAGAGACAGTCCAGGGAGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127756526 15:62097755-62097777 CAGCATAGGGGGACAGGGAAGGG - Intergenic
1127862597 15:63006855-63006877 CAGTAGTAGGAGTCAGGGGGAGG + Intergenic
1128317601 15:66671073-66671095 CAGGAAAAGGACTCAGGGGAGGG - Intronic
1128412606 15:67414429-67414451 CAGCAAGGGGAGGCAGAGGAGGG + Intronic
1128495444 15:68195895-68195917 CAGCAGGTGGAGTCAGCAGAGGG - Intronic
1128926142 15:71658058-71658080 CAGGAGAGGGACTCACTGGACGG + Intronic
1129125648 15:73438657-73438679 TAGCAGAGGGAGACAGGGTAGGG + Intergenic
1129327674 15:74809719-74809741 GAGCAGATGGAGGCAGGTGAGGG + Intergenic
1129608264 15:77035267-77035289 CTGCAGAGGGCGCCAGTGGAGGG + Intronic
1129912870 15:79242582-79242604 CAGCTCAAGGAGTGAGGGGAGGG + Intergenic
1130012387 15:80161756-80161778 CCCCAGAAGGATTCAGGGGAGGG + Intronic
1130015517 15:80183150-80183172 CAGCAGAGGAATTCAGGGAAAGG + Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130381478 15:83375920-83375942 CAGCAGAAGGAGCCATGAGAAGG + Intergenic
1130981499 15:88814876-88814898 CAGGAGAGGAGGACAGGGGATGG - Intronic
1131058754 15:89391636-89391658 CAGCTCAGGGAGACAGGGAAAGG - Intergenic
1131145142 15:90006089-90006111 CAGCAGAGGGAGGCTGGTCAGGG + Intronic
1131447368 15:92511646-92511668 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1131925803 15:97382733-97382755 GAGGAGATGGCGTCAGGGGAGGG + Intergenic
1132186679 15:99806946-99806968 CAGCTGAGGGAGGAAGGGGCGGG - Intergenic
1132429008 15:101745765-101745787 CAGCTGAGGGAGGAAGGGGCGGG + Intergenic
1132473127 16:117975-117997 CAGGAGTGGCAGTCAGGGGTAGG - Intronic
1132514585 16:360206-360228 AAGCAGAGGGAGGCGGCGGAGGG - Intergenic
1133161612 16:3915737-3915759 CAGCAGAGAGGGGCTGGGGAAGG - Intergenic
1133392829 16:5423013-5423035 AAGGAGAGGGAGGAAGGGGAGGG + Intergenic
1133395296 16:5442310-5442332 CTGCAGAGGGAGCCAGGGCCAGG + Intergenic
1133869943 16:9676921-9676943 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1134110792 16:11514390-11514412 CAGCAGACTGAGTGAGGAGAGGG + Exonic
1134430950 16:14205909-14205931 CAGCAGAGGCAGTCTGGCAATGG - Intronic
1134509003 16:14831346-14831368 CAGCTGAAGGGGGCAGGGGAGGG - Intronic
1134696704 16:16230180-16230202 CAGCTGAAGGGGGCAGGGGAGGG - Intergenic
1134757507 16:16681189-16681211 CAGATGAAGGAGTCAGGGGAAGG + Intergenic
1134975129 16:18564525-18564547 CAGCTGAAGGGGGCAGGGGAGGG + Intergenic
1134988561 16:18677977-18677999 CAGATGAAGGAGTCAGGGGAAGG - Intergenic
1135117877 16:19738993-19739015 CTGCAGAGGGAGCATGGGGAGGG - Intronic
1135471167 16:22732481-22732503 CAACAGAGGGAGGCAGATGAGGG - Intergenic
1135741588 16:24980059-24980081 CAGTGAAGGGAGTCAGGGGAAGG + Intronic
1135920026 16:26641554-26641576 CAGAAGAATGAGGCAGGGGAGGG - Intergenic
1136026080 16:27469883-27469905 CAGCACAGCGGGGCAGGGGAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137421251 16:48336523-48336545 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1138124662 16:54428871-54428893 CAGGAGTGGGAGTCAGAAGATGG - Intergenic
1138564919 16:57826073-57826095 CAGAGGAGGGAGGCAGAGGACGG - Intronic
1138659414 16:58508699-58508721 TAGGAGTGGGAGTCAGGCGAGGG - Intronic
1138805587 16:60085548-60085570 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1139109739 16:63875072-63875094 CAACAGAGGGAGGTAAGGGAAGG - Intergenic
1139230097 16:65275359-65275381 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1139462391 16:67132963-67132985 CAGCAGATGGTGTCATGGGATGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140223968 16:73064277-73064299 CTGGAGTGAGAGTCAGGGGAGGG - Intergenic
1140586200 16:76295160-76295182 GAGCAGTGGGAGTCAGTGAAAGG + Intronic
1140901421 16:79371506-79371528 GAGGAAAGGCAGTCAGGGGATGG - Intergenic
1141132088 16:81444189-81444211 CCGCAGTGGGAGACAGGGCAGGG + Intergenic
1141341714 16:83209818-83209840 CAGGAGAAAGGGTCAGGGGAAGG + Intronic
1141700162 16:85638762-85638784 TAGGACGGGGAGTCAGGGGAAGG - Intronic
1141866196 16:86751771-86751793 CAACAGAGGGTGCCGGGGGAGGG - Intergenic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1142142009 16:88476626-88476648 CAGCAGAGGAGGTGAGGGGTTGG + Intronic
1142242314 16:88953178-88953200 CAGCCGAGGGAGAGAGGCGATGG - Intronic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143887625 17:10076431-10076453 AAGGAGGGGGAGTCGGGGGAGGG + Intronic
1144069148 17:11651920-11651942 CAGGAGAGGGATTCACAGGAGGG + Intronic
1144104299 17:11972064-11972086 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1144959376 17:19036248-19036270 CAGCAGAGGCAGGCAGGAGCTGG + Intronic
1144975783 17:19138276-19138298 CAGCAGAGGCAGGCAGGAGCTGG - Intronic
1145014330 17:19386934-19386956 CAGGAGAGGGATTCAGGCAAGGG - Intronic
1145024594 17:19458433-19458455 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1145398221 17:22512381-22512403 GAGCAGGGGAAGTCAGGGAAGGG - Intergenic
1146165964 17:30588995-30589017 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146597544 17:34183499-34183521 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1146635355 17:34500111-34500133 GAGGAAAGTGAGTCAGGGGATGG - Intergenic
1146714633 17:35074837-35074859 CTTCAGTGGGAGTTAGGGGAAGG - Intronic
1147377633 17:40032376-40032398 CAGTAAAGGGAGCCAGGGAAAGG - Intronic
1147381515 17:40059078-40059100 CAAAAGAGGGAGCCAGGGAAGGG - Intronic
1147417924 17:40307124-40307146 CAGCAGAGAGCGTCAGGAGCGGG - Intergenic
1148208667 17:45795081-45795103 GGACAGAGTGAGTCAGGGGAAGG + Intronic
1148353575 17:46958652-46958674 CATCAGAGGGAGTGGTGGGAGGG - Intronic
1148468455 17:47878619-47878641 AAGCAGAGGGGGTCAGGGAGGGG + Intergenic
1149266752 17:54935174-54935196 CAGCAAAGGGAGTTAGGGGTGGG + Intronic
1149292574 17:55231737-55231759 CATGAAAGGGAGTCCGGGGATGG - Intergenic
1150005968 17:61469192-61469214 GAGCAGAGGGAGTTAAGGGCTGG + Intronic
1150369534 17:64624804-64624826 CAACAGAGCAAGACAGGGGAGGG + Intronic
1150692342 17:67377379-67377401 GAGCCGAGGGACTCGGGGGAGGG + Intronic
1151165269 17:72198034-72198056 GAGCAGAGGGATTCAGCTGAAGG - Intergenic
1151201193 17:72469215-72469237 CAAAAGATGGAGTCATGGGATGG - Intergenic
1151418488 17:73982298-73982320 GAGAAGAGGGAGCAAGGGGAGGG + Intergenic
1151451481 17:74200735-74200757 CAGCAGAGTGAGGGAAGGGAAGG + Intergenic
1151468686 17:74304369-74304391 CAGCTGAGTGAGGTAGGGGAGGG - Intronic
1151503832 17:74513042-74513064 CAACACAGGCAGTCGGGGGAGGG - Intergenic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1151852243 17:76697884-76697906 CGGGAGAGGGAGAGAGGGGAGGG + Intronic
1151933113 17:77245222-77245244 GAGCAGAGGGAGTTGGGGAAAGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152396440 17:80036130-80036152 CTGCAGAGGGCGGCAGCGGAGGG - Intergenic
1152657865 17:81528311-81528333 CAGCAGAGGGCGGGCGGGGAGGG - Intergenic
1152904493 17:82962911-82962933 CAGCAGCAGCAATCAGGGGAGGG - Intronic
1152945071 17:83193689-83193711 CAGCTGAGAGGGCCAGGGGAGGG - Intergenic
1153543777 18:6185431-6185453 GAGGAGAGGGAGGCTGGGGAAGG + Intronic
1153706559 18:7751293-7751315 CAGCACAGTGAGTCAGGGGAGGG - Intronic
1153834835 18:8954637-8954659 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1155174376 18:23289923-23289945 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1155432722 18:25777768-25777790 CACCAGGGCGAGTCAGGGCATGG + Intergenic
1155892199 18:31284300-31284322 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1156252200 18:35361485-35361507 CAGCAAAGGGAGATAGGGGCGGG + Intergenic
1156450308 18:37262889-37262911 CAGCAGCGTGAGGCAGGGTATGG + Intronic
1156454316 18:37284472-37284494 AACCAGAGGGAGCCAAGGGAGGG - Intronic
1156843809 18:41639486-41639508 AAGAAGAGGGAGGGAGGGGAAGG + Intergenic
1156938301 18:42737315-42737337 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1157310986 18:46553025-46553047 CAGAGGAGGGAGTCATGGGTGGG - Intronic
1157443755 18:47729599-47729621 CAGGAGAGGGAGGAAGGGAACGG + Intergenic
1157896340 18:51471870-51471892 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1157905920 18:51570162-51570184 CAGCAAGGGGAGACAGGGGTGGG + Intergenic
1158046946 18:53167929-53167951 CAGAAGTGTGAGTCAGGAGAAGG + Intronic
1158172570 18:54616082-54616104 CAGCAGAGTGAGTGAGAGGAAGG + Intergenic
1158401973 18:57129175-57129197 CAGGATAGGGAGTCAGCTGAGGG + Intergenic
1158554540 18:58464600-58464622 GACCAGAGAGAGTCAGGGAAGGG - Intergenic
1158577015 18:58646440-58646462 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1159417610 18:68173295-68173317 GGGCAGCCGGAGTCAGGGGAAGG - Intergenic
1160225584 18:77008663-77008685 CAGCAGAGGAAGCCAGGGCTTGG - Intronic
1160765914 19:807837-807859 CAGCAGAGCAAGGCAGCGGAGGG - Intronic
1160770908 19:830679-830701 AAGGAAATGGAGTCAGGGGAGGG - Intronic
1160784221 19:892286-892308 AAGCAAAGGGGGTCAGGGGTGGG - Intronic
1160906529 19:1454023-1454045 CAGCAGAGGGAGGCAGGGTCTGG + Intronic
1161238819 19:3210719-3210741 GAGCAGAGGGAGTGAGGGTGGGG + Intergenic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161712648 19:5858153-5858175 CAGCAAAGGGAGATAGGGGGTGG - Intergenic
1161756427 19:6137453-6137475 CAGCAGAGTGAGGAGGGGGAGGG + Intronic
1161815688 19:6498537-6498559 AAGCAGAGTGAGGGAGGGGATGG - Intronic
1161961801 19:7527495-7527517 AAGGACAGGGAGTCAGGGAAGGG - Intronic
1161984480 19:7646205-7646227 CAGCAGGGGGATTGAGGGGAAGG - Intronic
1162261733 19:9539648-9539670 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162263378 19:9550447-9550469 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1162266795 19:9582521-9582543 CAGCAAAGGGAGATAGGGGTCGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163427216 19:17246112-17246134 GGGCAGAGGGAGGCGGGGGAGGG - Intronic
1163584518 19:18156545-18156567 GACCAGAGGGAGGAAGGGGAGGG + Intronic
1163607486 19:18282855-18282877 GATCAGAGAGAGTGAGGGGAAGG - Intergenic
1163766301 19:19165246-19165268 CAACAGGGGGAGGCAGTGGAGGG + Intronic
1163786170 19:19275966-19275988 CTGCAGAGGGAGGTTGGGGAGGG - Intergenic
1163943937 19:20518933-20518955 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1164004328 19:21134883-21134905 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
1164080542 19:21858384-21858406 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164082081 19:21867265-21867287 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1164148926 19:22532286-22532308 CATCAGAGGGATTCTGGGGCTGG + Intronic
1164231897 19:23296765-23296787 CATCAGGGCTAGTCAGGGGATGG - Intergenic
1164259261 19:23554930-23554952 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1164730028 19:30496626-30496648 CAGCAGAGGCAGTTGGGGGAAGG + Intronic
1164867155 19:31614121-31614143 CTGGAGAGAGTGTCAGGGGATGG - Intergenic
1164984675 19:32639615-32639637 CTGCAGAGAGATCCAGGGGATGG - Intronic
1165323872 19:35102800-35102822 GAGCAGAGTGAGTGAGGGGCAGG - Intergenic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1165847402 19:38827077-38827099 GAGGAGAGGGAGGGAGGGGAAGG + Intronic
1165847415 19:38827107-38827129 GAGGAGAGGGAGGGAGGGGAGGG + Intronic
1165859243 19:38898559-38898581 GAGCAGAGGGAGGGAGGGGACGG + Intronic
1166096267 19:40541376-40541398 CAGCAGAGGGAGCCCGAGGCAGG + Intronic
1166126958 19:40720704-40720726 CAGCAGAGGGGGTCAGGAGGAGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166297047 19:41894569-41894591 CAGCTGGGGAAGACAGGGGAGGG - Intronic
1166424385 19:42662894-42662916 CACCAGGTGGAGTCAGGGCAGGG - Intronic
1166499305 19:43329054-43329076 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1167080834 19:47275181-47275203 CAGGAGAGGGAGGCAGCGGCGGG - Exonic
1167247622 19:48383242-48383264 CAGCAGCGGGAGGCAGAGGAAGG - Exonic
1167270174 19:48501952-48501974 CAGGGGAGGGGGGCAGGGGAGGG - Intronic
1167367782 19:49064036-49064058 AAGCAGATGGAGGGAGGGGAAGG + Intronic
1167578620 19:50329397-50329419 CAGCACTGGTAGCCAGGGGAAGG + Intronic
1167729497 19:51243139-51243161 GAGGAGAGGGAGCCAGGAGAAGG - Intronic
1167773804 19:51541746-51541768 GAGCAGAAGGAGGCAGAGGAGGG - Intergenic
1167814099 19:51864378-51864400 CAGGGGCGGGAGTCAGGGGCAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167925625 19:52819143-52819165 GGGCAGAGGGAGTCAGATGAGGG + Intronic
1167929868 19:52855432-52855454 GGGCAGAGGGAGTCAGATGAGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168260242 19:55189476-55189498 GAGCAGAGTGAGGAAGGGGAGGG - Intronic
1168312030 19:55465214-55465236 CAGCAGAGTGAGGGAGGAGAGGG + Intergenic
1168320725 19:55508012-55508034 GAGGAGAGGGAGGCAGGGAACGG + Intronic
1168373062 19:55852358-55852380 CAGGTGAGGGAGTCTGGGAAGGG + Exonic
1168402793 19:56095604-56095626 CAACAGAGGAAGGCAGGAGAAGG - Intronic
925134960 2:1520398-1520420 CAGCAGAGAGAGACACGGGAGGG + Intronic
925247282 2:2395254-2395276 CAGAACAGAGAGGCAGGGGAAGG + Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925501673 2:4512164-4512186 TAGAAAAGGGGGTCAGGGGAAGG - Intergenic
926052503 2:9753891-9753913 CAGCAGAGGCAGCCGTGGGAGGG + Intergenic
926127695 2:10282066-10282088 CAGCAGAGGGAAGCTGGGGAGGG + Intergenic
926128487 2:10286114-10286136 CAGCAGAGGGAAGCTGAGGAGGG + Intergenic
926890407 2:17634599-17634621 GAGATGAGGGTGTCAGGGGACGG - Intronic
927333815 2:21897162-21897184 GAGGAGAGGGAGTAAGGGTAAGG + Intergenic
927424802 2:22970291-22970313 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
927484552 2:23479546-23479568 AAGCAGAGGGAGTGGAGGGAGGG - Intronic
927506111 2:23615919-23615941 AAGCAGAGGGGGTCTGGGGAGGG - Intronic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927554245 2:24021442-24021464 CAGCAGAGGGGGTGTGTGGAAGG + Intronic
927712145 2:25332638-25332660 AATCAGAGGGAGCCAGGGCACGG - Intronic
927723001 2:25398875-25398897 GAGCACAGGGATTCAGAGGATGG - Intronic
927948198 2:27149936-27149958 CAGCTGAGGAAGTTGGGGGAAGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928074457 2:28250283-28250305 GAGCACAGTGAGTAAGGGGAAGG + Intronic
928112701 2:28523601-28523623 CAGGAGAGGGGGTTGGGGGAAGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928905314 2:36361458-36361480 CAGCTGGGTGAGGCAGGGGATGG + Intronic
929076197 2:38080901-38080923 CAGCCAAGGGAGACAGGGGTGGG + Intronic
929092565 2:38233983-38234005 CAGTGGAGGGAGGCTGGGGAGGG - Intergenic
929383230 2:41378137-41378159 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
929384301 2:41385591-41385613 CAGCAAAGGGAGGTAGGGGTGGG - Intergenic
929580608 2:43079712-43079734 CACCAGAGAGAGCCATGGGATGG + Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929898319 2:45980427-45980449 CAGAAGAGGCAGTGAAGGGAGGG - Intronic
930272947 2:49277863-49277885 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
930487629 2:52027290-52027312 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
930958003 2:57227520-57227542 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
931630789 2:64296666-64296688 CATCATAGGGAGGAAGGGGAGGG + Intergenic
931697085 2:64879476-64879498 CAGCAGGGCGAGTCCAGGGAGGG + Intergenic
932060620 2:68494455-68494477 AGGGAGAGGGAGTGAGGGGAAGG + Intronic
932158896 2:69443112-69443134 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
932215258 2:69962129-69962151 CTGGAGAGGGAGGCAGAGGAGGG + Exonic
932603151 2:73144043-73144065 AAGCAGAGGGAGTCTGGTGGTGG - Intronic
932854536 2:75219188-75219210 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
933073869 2:77897512-77897534 CAGCAAAGAGAGTTAGGGGTGGG - Intergenic
933078040 2:77954280-77954302 CAGGAGACTGAGGCAGGGGATGG + Intergenic
933124434 2:78586550-78586572 GAGCAGAGGGAGTGAGGAGGAGG + Intergenic
933163414 2:79051675-79051697 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933369531 2:81397367-81397389 CAGCGAAGGGAGTTAGGGGTTGG + Intergenic
933417580 2:82005960-82005982 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
933447303 2:82398376-82398398 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
933764707 2:85698689-85698711 CAGCAGAGGGAGTCAGGGGAGGG - Exonic
933934544 2:87191463-87191485 CAGCAGAGGGAGAAAGGTTAAGG - Intergenic
934227093 2:90143703-90143725 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
935133753 2:100280447-100280469 CAGCAGCGGCATTCAGTGGAAGG - Exonic
935213998 2:100961748-100961770 CATCACAGTGAATCAGGGGAAGG + Intronic
935337996 2:102034762-102034784 AGGCTGAGGGAGTGAGGGGAAGG + Intergenic
935354728 2:102187668-102187690 CAGACGAAGGAGACAGGGGAAGG + Intronic
935455745 2:103265937-103265959 CACCCGAGGGAGTTGGGGGACGG + Intergenic
935601601 2:104927785-104927807 CAGGACAAGGAGTTAGGGGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935676376 2:105598077-105598099 AGGCAGAGGGAGGCAGGGAAGGG - Intergenic
935724968 2:106015741-106015763 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
936267663 2:111022754-111022776 CAGCAGAGGGAGGCGAGGGCAGG + Intronic
936358599 2:111774433-111774455 CAGCAGAGGGAGAAAGGTTAAGG + Intronic
936794545 2:116189401-116189423 CAGCAAAGGGAGATAGGGGTAGG + Intergenic
936870540 2:117130872-117130894 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
937122586 2:119451285-119451307 CAGCATAGGGGGACAGAGGAGGG - Intronic
937148906 2:119672395-119672417 AGGCAGAAGGAGCCAGGGGAAGG + Intergenic
937249210 2:120512622-120512644 CAGCAGAGGGAGGAAGCTGAGGG - Intergenic
937284450 2:120741411-120741433 CAGAAGAGAGAGAAAGGGGAAGG - Intronic
937419444 2:121741780-121741802 CAGCAAAGGGATTCTAGGGATGG + Intronic
938109835 2:128556523-128556545 CAGCAGATGGTGTCTGGTGAGGG - Intergenic
938150016 2:128874555-128874577 AGGCAAAGGGAGTCAGGGGTTGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938718024 2:134038915-134038937 CAGGAGAGAGAGTGAGGGAAGGG + Intergenic
938962868 2:136358786-136358808 CAGCAGTGGGCCTCGGGGGAGGG + Intergenic
939432617 2:142130602-142130624 AAGCCAAGGAAGTCAGGGGAGGG + Intronic
940182681 2:150953616-150953638 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940726681 2:157343170-157343192 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941528996 2:166641572-166641594 CAGCAAAGGGAGACAGGGGTGGG + Intergenic
942545864 2:177062957-177062979 AAGCAGAGGGAGGCACGGGATGG + Intergenic
942599810 2:177629228-177629250 CAGCAGAGAGAGCAACGGGAAGG - Exonic
943217087 2:185051669-185051691 CAGAAGAGGTAGACAGGGAAAGG - Intergenic
943676150 2:190718081-190718103 CACCAGAGGGACTCAGGGTGTGG - Intergenic
943739017 2:191390843-191390865 CTGCAGAGAGAATCAGTGGATGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943951603 2:194136244-194136266 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
945221399 2:207488158-207488180 CAGCAGAGGGACTCAAGGTTTGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945266410 2:207895516-207895538 CAACAAAGGAAATCAGGGGAAGG - Intronic
945362507 2:208908246-208908268 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
945554439 2:211262057-211262079 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
945555226 2:211267528-211267550 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945857868 2:215090182-215090204 CAGCAAAGGAAGTTAGGGGTGGG - Intronic
946196517 2:218035537-218035559 CAGCAGTGGGACACAGTGGAGGG - Intronic
946200796 2:218069701-218069723 CAGCAGTGGGACACAGTGGAGGG - Intronic
946893750 2:224302240-224302262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
947219196 2:227776781-227776803 CAGTGGAGGTAGTCAGGTGAAGG - Intergenic
947776997 2:232720883-232720905 CAGCTGAGAGAGGCAGGGCACGG - Intronic
948166345 2:235865588-235865610 CAGTGGAGGGAGTTGGGGGAGGG - Intronic
948390312 2:237607072-237607094 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948391169 2:237612531-237612553 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
948567029 2:238893920-238893942 CACCAGGGGGTGTCAAGGGAGGG - Intronic
948643341 2:239388786-239388808 CAGCGGAGGGAGTGTGTGGAGGG + Intronic
948674291 2:239587967-239587989 CAGCCGAGGAAGTGAGGAGAAGG - Intergenic
1169072581 20:2742523-2742545 CAGAAAAGGGAGTAAGGGAAAGG - Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169270501 20:4195653-4195675 CTGCAGATGGAGACATGGGAAGG + Intergenic
1169971115 20:11270453-11270475 CAGCAAAGTGAGACAGGGAAGGG + Intergenic
1170068380 20:12340370-12340392 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1170069179 20:12345609-12345631 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1170770960 20:19332151-19332173 TAGCAGAGGGAGTCCATGGAAGG + Intronic
1171145132 20:22774788-22774810 GAGCAGAGGGAGGCCGGTGAGGG + Intergenic
1171493084 20:25535853-25535875 CAGAAAAGGGAGCCAAGGGAAGG + Intronic
1172134309 20:32676694-32676716 CAGCAGAGGGAGTGCAGGCATGG + Intergenic
1172228789 20:33323240-33323262 CAGGAGGGCGAGTCAGGGCAGGG - Intergenic
1172575411 20:36004383-36004405 CAGAAGACATAGTCAGGGGAGGG - Intronic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1172624963 20:36341685-36341707 GAGCAGAGGGACTGAGGGGGTGG - Intronic
1172809530 20:37637331-37637353 CTGCAGAGGCAGTGAGGGGCAGG + Intergenic
1172932851 20:38598489-38598511 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1173285902 20:41671261-41671283 CAGCAGGCAGAGTCCGGGGAGGG + Intergenic
1173430994 20:42987113-42987135 CAACAGAGGGAGGCAGGGAGGGG - Intronic
1173558364 20:43983853-43983875 CAGCACAGAGAGGCAGAGGAGGG + Intronic
1173691373 20:44963735-44963757 CAGATGAGAGGGTCAGGGGAGGG + Intergenic
1173817603 20:45999767-45999789 CAGCTGAGGGAGTCAGCTGGTGG - Intergenic
1174002208 20:47383048-47383070 CAGAAGAGGAAGGCAGGAGAAGG + Intergenic
1174428107 20:50447801-50447823 GAGAAGAGTGAGTGAGGGGAAGG + Intergenic
1174489625 20:50883743-50883765 CAGCAGTAGGAGTGAGTGGAGGG + Intergenic
1174532003 20:51221728-51221750 GAGCAGAGGGAGCAAGGGGTGGG + Intergenic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175584312 20:60125955-60125977 GAGCAGCGGGAGCCATGGGATGG + Intergenic
1175613987 20:60376971-60376993 CAGCAGAGGGAAGAAGGTGAGGG + Intergenic
1175619510 20:60431501-60431523 CAGCCCAGGGAGGCAGGGCAGGG + Intergenic
1175800764 20:61799983-61800005 CAGCCGAGCGGGTCATGGGAAGG - Intronic
1176024369 20:62978344-62978366 CAGCAGAGGGAGATGGGGGTGGG - Intergenic
1176044515 20:63085424-63085446 CAGCAGAGGGAGGGAGGCCACGG + Intergenic
1176236546 20:64056304-64056326 CAGCAGAGGAGGGCAGGGGATGG - Intronic
1176619599 21:9047009-9047031 CAGCAGAGGAAGACCGGGGTAGG + Intergenic
1177116018 21:17088063-17088085 CAGCAAAGGGAGACAAGGGTGGG - Intergenic
1177445994 21:21196955-21196977 GAGCAGGAGGAGTGAGGGGAAGG - Intronic
1178001680 21:28166801-28166823 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1178368075 21:32004291-32004313 CTGATGAAGGAGTCAGGGGAAGG - Intronic
1178422748 21:32455483-32455505 CAACAGAGAGAGTTAGGGGTAGG - Intronic
1178777404 21:35565383-35565405 AGGCTGAGGGAGTGAGGGGAAGG + Intronic
1178855972 21:36250747-36250769 CAGCAGATGGAGTCAGGCTGAGG + Intronic
1179133720 21:38661156-38661178 GAGGAGAGGGGGTCAGGGGAGGG + Intronic
1179532404 21:42028867-42028889 CAGCATAGGGAGGCTGGAGAGGG + Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179843569 21:44093873-44093895 AGGCAAAGGGAGTCAGGGCAGGG + Intronic
1179893002 21:44346595-44346617 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1179900796 21:44392791-44392813 CAGCAGTGGGGCTCAGGGCAGGG - Intronic
1179959325 21:44759324-44759346 CAGCAGAAGGAGCCAGGTCAGGG - Intergenic
1180010925 21:45050694-45050716 CAGCAGAGCTCGGCAGGGGACGG + Intergenic
1180874887 22:19170608-19170630 CAGGAGAAGGAGTCAGGGTTGGG - Intergenic
1181332065 22:22100494-22100516 CAGAAGAAAGAGTCAGAGGAAGG - Intergenic
1181371955 22:22425819-22425841 CAGCAGAGGGATTCAGGCCATGG - Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182372287 22:29819720-29819742 CAGCAGCAGGAGACGGGGGAGGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182696805 22:32203809-32203831 CAGCGGCGGGGGTCAGTGGAGGG - Intergenic
1182731950 22:32503062-32503084 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183046938 22:35227883-35227905 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1183270122 22:36856720-36856742 CAGCAGAGGGAGACAGAAAAGGG + Intergenic
1183392272 22:37552382-37552404 CAGCAGAAGGGGTCAGGGCCAGG - Intergenic
1183636441 22:39066197-39066219 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1183727073 22:39596112-39596134 GAGCAGAGTGAGCCAGGGCAGGG + Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184220759 22:43098279-43098301 CAGCTGAGGGAGCCAGGGAAGGG + Intergenic
1184310024 22:43635217-43635239 CTGACGAGGGAGACAGGGGAGGG + Intronic
1184317812 22:43710840-43710862 TAGGGTAGGGAGTCAGGGGAGGG + Intronic
1184457826 22:44621527-44621549 CAGGAGATGGAGCCAGGTGAAGG + Intergenic
1184596282 22:45516127-45516149 CAGGAGAGGGTGACAGGGCATGG + Intronic
1184695629 22:46137405-46137427 CAGGAGGAGGAGTCGGGGGAGGG - Intergenic
1184856314 22:47148635-47148657 CAGGAGAGGAACCCAGGGGAGGG - Intronic
1184856332 22:47148684-47148706 CAGGAGAGGAACTCAGGGGAGGG - Intronic
1184883823 22:47329821-47329843 GAGCAGAAGGAGGAAGGGGAGGG + Intergenic
1184986656 22:48140530-48140552 CAGCAGAGGGAATCAGCTCAAGG - Intergenic
1185059324 22:48597845-48597867 CAGAAGGGGGAGTTAAGGGATGG + Intronic
1185161668 22:49233672-49233694 GAGCAGAGGGAGGTGGGGGATGG + Intergenic
949950083 3:9221761-9221783 CAAAAGATGGAGTCAGGAGAGGG - Intronic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950182846 3:10927272-10927294 TGGCAGAGGGAGGCAGGGGCTGG + Intronic
950357684 3:12425538-12425560 CACCAGACGGATTCAGGGCATGG + Intronic
950798466 3:15530513-15530535 CATCAGAAGAAGACAGGGGAGGG - Intergenic
950879538 3:16311992-16312014 CAGCAGAGGAAGCCAGGCTACGG - Intronic
951093497 3:18601614-18601636 TAGCAGAGGTAGTCAGGTGGAGG + Intergenic
951298349 3:20967642-20967664 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951299133 3:20972921-20972943 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
951315815 3:21189121-21189143 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
951775587 3:26307073-26307095 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
951793713 3:26515481-26515503 CAACAGAGGGAGACGGGAGAGGG - Intergenic
952266136 3:31788407-31788429 CAGCAGATGGAATCAGGAAAAGG - Intronic
952343047 3:32461036-32461058 CAGCAAAGGGAGATAGGGGTGGG + Intronic
952975087 3:38687060-38687082 AAGCACAGGGAGTGAGTGGAGGG + Intergenic
952995873 3:38881779-38881801 ATGCAGAGGGTGCCAGGGGAAGG - Intronic
953139450 3:40213929-40213951 CAGCTGAGGCAGTCAGTGCATGG - Intronic
953177664 3:40566551-40566573 CAGCAAAGGGAGATAGGGGTGGG - Intronic
953404244 3:42652767-42652789 CAGCATCAGGAGCCAGGGGAAGG - Intergenic
953598889 3:44344756-44344778 GAGCAGAGGGAGTTAGGGGTGGG + Intronic
953599701 3:44350129-44350151 CAGCAAAGGGAGTTAGGGGTGGG + Intronic
953782952 3:45887615-45887637 CAGGAAAGGGAGTAAGGAGATGG - Intronic
954162063 3:48729903-48729925 CAGCAAAGGGAGTTAGGGATGGG + Intronic
954163858 3:48740520-48740542 CTGCAGAGGGAGGAAGGGGTAGG + Intergenic
954293435 3:49661625-49661647 CAGCAGTGGGCGTCCAGGGAAGG + Exonic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954464317 3:50645799-50645821 CAGGAGATGGAGGCAGGGGGTGG - Intronic
954582777 3:51712044-51712066 CATCAGATTGATTCAGGGGAAGG + Intronic
954605864 3:51908728-51908750 CAGCACAGGGAGCCAGGGGCTGG + Intergenic
956233757 3:67043853-67043875 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956426922 3:69145329-69145351 CTGCAAAGGGAGCCTGGGGAGGG + Intergenic
956548476 3:70434773-70434795 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
956642248 3:71426205-71426227 CAGGCAAAGGAGTCAGGGGAGGG + Intronic
956709740 3:72028783-72028805 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
956774060 3:72550359-72550381 AAGCTGGGGGAGGCAGGGGATGG - Intergenic
957154746 3:76533677-76533699 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957155364 3:76537780-76537802 CAGCAAAGGGAGATAGGGGAGGG + Intronic
957316344 3:78581313-78581335 CAGCAGAGGGAGATAGGGGTGGG + Intergenic
957317652 3:78588573-78588595 CAGCAGAGGGAGATAGGGGTTGG + Intergenic
957394583 3:79621318-79621340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
958084555 3:88789731-88789753 GAGCAGAGGGACACAGGGGATGG - Intergenic
958181857 3:90071419-90071441 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
958421689 3:93938318-93938340 CAGCAAAGGGAGATAGGGGTGGG - Intronic
958878773 3:99645532-99645554 CAGTAGAGGGAGCCAGGGGCTGG + Intronic
959287877 3:104440031-104440053 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959559827 3:107767052-107767074 CAGGATAGGGAGCTAGGGGAGGG + Intronic
959970181 3:112400529-112400551 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960855822 3:122101120-122101142 GAGGAGAGGGAGTCTGAGGAGGG + Intronic
960863066 3:122171398-122171420 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
961343750 3:126247647-126247669 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
961346486 3:126266760-126266782 CAGCCCAGGGAGCCAGGGGCTGG + Intergenic
961355704 3:126338788-126338810 CAGCTGAGGGAGGCCAGGGAAGG - Intergenic
961453776 3:127014458-127014480 CAGCTGAGGGAGGCAGAGGCTGG - Exonic
961666118 3:128493918-128493940 CAGAAGTGGGAGTCAGGAGGGGG + Intergenic
961731064 3:128965275-128965297 CAGCAAAGGGAGATAGGGGTGGG - Intronic
961755766 3:129126546-129126568 CAGCAGATGGGGTGAGGGTAGGG - Intronic
961849702 3:129803330-129803352 CAGAACAGAGAGTGAGGGGAGGG + Intronic
961880691 3:130059440-130059462 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
962599383 3:136979456-136979478 CAGCAAAGGGAGGCAGGTGTTGG + Intronic
962895443 3:139709845-139709867 CAGGAAAGGGACTCAGTGGATGG - Intergenic
963058261 3:141205185-141205207 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963059264 3:141211608-141211630 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963810466 3:149771837-149771859 CAGCAGGGGGAGTCTGGAGCTGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963955781 3:151252109-151252131 CTGCATAGGGAGGGAGGGGATGG - Intronic
963970301 3:151421984-151422006 CAGCAGGACAAGTCAGGGGATGG - Intronic
964300766 3:155282879-155282901 CAGCAAAGGGAGATAGGAGAGGG + Intergenic
964944667 3:162205822-162205844 CAGCAGAGGGATTTGGGGGTGGG - Intergenic
965409028 3:168306488-168306510 CAGGAAGGGGAGTAAGGGGATGG + Intergenic
965458340 3:168931016-168931038 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
965458602 3:168933054-168933076 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
966055239 3:175678954-175678976 CAGCAAAGGGAGACAGGGATGGG + Intronic
966233084 3:177670782-177670804 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
966278895 3:178207690-178207712 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
966560906 3:181319398-181319420 CAGGAGTGGGAGGCAAGGGAAGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967496705 3:190150081-190150103 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
967770086 3:193325122-193325144 GAGCATAGGGAGCCATGGGAAGG - Intronic
967954841 3:194870137-194870159 CAGCAGTGAGAGGCAAGGGAGGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968741357 4:2333210-2333232 CAGCAGGGGGGGTCAGGGAAGGG - Intronic
969094083 4:4719057-4719079 AGGCAGAGTGAGTGAGGGGAGGG - Intergenic
969226078 4:5799167-5799189 CAGCAGAGGCGGCCAGGGGCAGG - Intronic
969339030 4:6528893-6528915 CAGCAAAGGGAGATAGGGGTGGG - Intronic
969344921 4:6564292-6564314 CAGCAGGGCGGGTCTGGGGAAGG - Intergenic
969480593 4:7445013-7445035 GAGCAGAGGGAGGGCGGGGAGGG + Intronic
969530961 4:7729912-7729934 CGGCAGAGGTAGTCGGGGGGAGG + Intronic
969597984 4:8159538-8159560 CAGGAGAGGGAGTCAGGGAACGG + Intergenic
969653536 4:8482500-8482522 CAGCAAAGGGAGATAGGGGTGGG + Intronic
969781974 4:9412189-9412211 CACCAGGGCCAGTCAGGGGATGG - Intergenic
969923990 4:10568542-10568564 CAGAAGAGGAAGTCAGAGAAAGG + Intronic
970028725 4:11653668-11653690 CAGCTAAGGGAGACAGGGGTGGG + Intergenic
970148943 4:13068856-13068878 CTGCAGAAGGAGCCAGGAGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970723589 4:19016639-19016661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
970972976 4:22006165-22006187 CAGAGGAGGGAGTGAGGGGATGG + Intergenic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971753285 4:30678187-30678209 CAGCAGAGGGAGCCTGGGCCCGG - Intergenic
971980795 4:33747553-33747575 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
972583180 4:40413362-40413384 CATCAGTGGGATTCAGGGAAGGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973015768 4:45135117-45135139 CAGCAGAGGGAGCCTGGGCCTGG + Intergenic
973169587 4:47122857-47122879 CAGTAGAGGGAGCTAGAGGAAGG - Intronic
973894203 4:55396021-55396043 AAGCAGCGGGAGTGAGGTGAGGG - Exonic
975250534 4:72173484-72173506 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
975391468 4:73822890-73822912 AAGAAGAGGGAGAAAGGGGAGGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975715574 4:77202636-77202658 CAGGAAGGTGAGTCAGGGGATGG - Intronic
975905765 4:79210161-79210183 CTGAAAAGGGAGTCAGTGGAGGG + Intergenic
976389708 4:84496350-84496372 CAGCCGAGGGGGAGAGGGGAAGG + Intronic
976966318 4:91045890-91045912 CAGCAAAGGGAGATAGGGGTGGG + Intronic
976983922 4:91268650-91268672 CAGCAAAGGGAGATAGGGGTGGG + Intronic
978031187 4:103941600-103941622 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
978360631 4:107927903-107927925 CAAAAGAGGGGGGCAGGGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978552174 4:109939337-109939359 CAGCTGAGCCAGGCAGGGGAGGG + Intronic
978573025 4:110160371-110160393 CAACACAGGAAGTCAGGGGTGGG - Intronic
978764472 4:112390159-112390181 CAGCAGGGGCAGCCAAGGGAAGG - Intronic
978847294 4:113288816-113288838 GAGGAGAAGGGGTCAGGGGAGGG - Intronic
978873400 4:113607689-113607711 CAGCAAAGGGAGATAGGGGTGGG - Intronic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979278840 4:118841772-118841794 GAGCAGAGGAAATGAGGGGAAGG + Intergenic
979641105 4:123013052-123013074 CAGCAAAGGGAGATAGGGGTGGG + Intronic
979850649 4:125567107-125567129 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
980454588 4:133022666-133022688 CAGAAGAGGGAGCCAGGAGCAGG + Intergenic
980803155 4:137779318-137779340 CAGAAGAGGGAGGCAGGGACCGG - Intergenic
981682381 4:147414528-147414550 CAGCAGAGATTGTGAGGGGATGG - Intergenic
981756241 4:148144164-148144186 TAGCAGAGGAAGTGAGAGGAGGG - Intronic
981892540 4:149755380-149755402 CAGGAGAGGGATTGAGGGGCTGG - Intergenic
982015097 4:151145545-151145567 CAGCAAAGGGAGACAGGAGTGGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982202619 4:152974911-152974933 CAGCAGAGGGACCCAGGGAGAGG - Exonic
982774198 4:159425490-159425512 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
982791358 4:159595294-159595316 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
983359535 4:166710314-166710336 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983638281 4:169920063-169920085 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984262004 4:177453470-177453492 GAGCAGAGGAAGGGAGGGGAGGG - Intergenic
984393922 4:179170219-179170241 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
984436955 4:179720810-179720832 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984645024 4:182210013-182210035 CGGCACAGGGAGGCTGGGGAGGG - Intronic
984700283 4:182814618-182814640 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
986195315 5:5532786-5532808 GAGCAGAGTCAGTCAGGGAAGGG - Intergenic
986228858 5:5843109-5843131 AAGAAGAGGAAGTCATGGGAAGG + Intergenic
986662890 5:10074866-10074888 GAGGTGAGGGAGGCAGGGGAAGG + Intergenic
986664638 5:10090098-10090120 CAGAAGAGGGAGGCAGAAGAGGG + Intergenic
987024265 5:13908361-13908383 AAGGAGAGGGAGGCAGTGGAAGG - Intronic
987755459 5:22094939-22094961 CAGCAAAGGGAGATAGGGGTGGG - Intronic
988906469 5:35795891-35795913 CAGCAGAGGAATTGAGGGGCAGG - Intronic
989199527 5:38750031-38750053 CAGCAGAGGAAGTTGGGGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989651640 5:43696875-43696897 CAGCAGAGGGACTCTGGGCCTGG + Intronic
989661056 5:43798059-43798081 TAGCAAAGGGAGTTAGGGGTGGG - Intergenic
990504734 5:56433104-56433126 CAGCAGAGGGAGAGAGGGGTGGG + Intergenic
991275665 5:64843897-64843919 CAGCAGTGGGAGGCAGGGCATGG - Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991674249 5:69075753-69075775 AAGCCGAGGGGGTCAGAGGAAGG - Intergenic
992146807 5:73858895-73858917 GAGCAGAGGGAGTAAGGGAGGGG - Intronic
992960497 5:81953540-81953562 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
992961343 5:81959112-81959134 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
994325519 5:98441213-98441235 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
994545116 5:101156140-101156162 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
994550766 5:101232005-101232027 GAGGGCAGGGAGTCAGGGGAGGG - Intergenic
994775373 5:104031995-104032017 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
995198556 5:109400476-109400498 CAGCAGGGGGAGGGGGGGGAAGG + Intronic
996118589 5:119646318-119646340 CAGCAGAGGCAGCTAAGGGAAGG + Intergenic
996222364 5:120949698-120949720 CAGCAGAGGGACTCTGGGCCTGG - Intergenic
996509593 5:124304091-124304113 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
996715611 5:126585375-126585397 GAGCAGTGGGAGTTAGGGGGAGG - Intronic
996810067 5:127506757-127506779 GAACAGAGGGAGTGAGGGAAAGG + Intergenic
997770006 5:136545069-136545091 CAGCAAAGGGAGTTAAGGGTGGG + Intergenic
998473871 5:142404708-142404730 GAGAAGAGGGGGTCAGTGGATGG + Intergenic
998834444 5:146190324-146190346 CAGCAGAGGTAGGCAGGGTCAGG + Intergenic
999111040 5:149121631-149121653 CAGCAGTGGGAGTTAGGGGGAGG - Intergenic
999194304 5:149771529-149771551 CAGCAGAGGTGGGCAGGGGATGG + Intronic
999275776 5:150329119-150329141 CCAAAGAGGCAGTCAGGGGAAGG - Intronic
999663698 5:153891535-153891557 CAGCTCAGGGAGTCAGGGACAGG + Intergenic
999937325 5:156501373-156501395 TGACAAAGGGAGTCAGGGGAAGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000885619 5:166744350-166744372 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1000935089 5:167297732-167297754 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1001016866 5:168149800-168149822 TAGCAGAGTGAGTGAGGGGTAGG - Intronic
1001023991 5:168207633-168207655 CAGCAGAGGGAGGGAGGGGGAGG + Intronic
1001329063 5:170749461-170749483 GGGCAGAGGGATTCAGAGGAAGG - Intergenic
1001397017 5:171424839-171424861 CAGCAGAGGGGGAAGGGGGAGGG + Intronic
1001933885 5:175691255-175691277 CTGGAGAGGAAGTCAGGGGAAGG + Intergenic
1002063039 5:176637723-176637745 CAGCAGAGGGAGGGAGAGGAGGG + Intronic
1002094351 5:176822396-176822418 CAGCAGTGGGCGTCAAGGGCAGG + Intronic
1002600623 5:180352543-180352565 CACGAGAGGGAGTCCGGGGCGGG - Intronic
1003100612 6:3173733-3173755 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003924098 6:10860673-10860695 CAAGAGAGGGAGTTGGGGGAAGG + Intronic
1004330450 6:14716006-14716028 AAGCAGAGGGCATCAGGGGAGGG - Intergenic
1004768097 6:18754245-18754267 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1004768927 6:18759581-18759603 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005033129 6:21530025-21530047 CTGCAGAAGGAGACAGGGCAAGG - Intergenic
1005040684 6:21596730-21596752 CAGCAGCGGGAGCTAGGGGCGGG + Exonic
1005672581 6:28122326-28122348 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1005786848 6:29252469-29252491 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1006167186 6:32071919-32071941 CAGCAGAGGGAGTGAAGAGAAGG + Intronic
1006233289 6:32604106-32604128 AAGCAGGGGGAGTCAGGAAATGG + Intergenic
1006368921 6:33632684-33632706 CAGCAGAGGGAGCAGGAGGATGG - Intronic
1006507918 6:34502357-34502379 AAACAGAGGGAAACAGGGGAAGG + Intronic
1006597197 6:35202110-35202132 CAGCAGGGGGAGTCATGCCAAGG + Intergenic
1006798177 6:36743976-36743998 CAGCCCTGGGAGTCTGGGGAGGG - Intronic
1006832308 6:36976366-36976388 TAACAGAGGGAGCCAGTGGAAGG + Intronic
1007012772 6:38433609-38433631 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1007059208 6:38921858-38921880 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007633996 6:43287241-43287263 CAGCAGAGGGAGTGGAGGAAGGG + Exonic
1007720849 6:43884758-43884780 CAGCAGGGGCAGGCAGGGGAGGG - Intergenic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008849984 6:56012761-56012783 CAGCTGAAGGAGCCAGGGAACGG + Intergenic
1008875206 6:56318557-56318579 GGGTAGAGGTAGTCAGGGGAGGG - Intronic
1009371960 6:62916248-62916270 TAGAAGGGGGAGTGAGGGGAGGG + Intergenic
1009378868 6:63005760-63005782 TAGCAAAGGGAGTTAGGGGTAGG - Intergenic
1009749661 6:67867731-67867753 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1010826481 6:80482903-80482925 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1010909349 6:81535098-81535120 CAGATGAGGTAGTCAGAGGATGG + Intronic
1011409869 6:87056846-87056868 CAGGAGAGAGGGTCACGGGAGGG - Intergenic
1012436440 6:99219943-99219965 CAGCAGGGGGAGTCCTGGGCTGG - Intergenic
1013530951 6:111018185-111018207 CATCAGGGGGAGACCGGGGAGGG + Intronic
1013751705 6:113414693-113414715 CAACAGAGGGAGCCTGGAGATGG + Intergenic
1014168703 6:118254034-118254056 CAGCAGATGGGGAGAGGGGACGG + Intronic
1014547539 6:122750662-122750684 CAGCAGTGGGGCCCAGGGGAGGG - Intergenic
1014987443 6:128029202-128029224 CAAGAGAGGGAGACAGGAGAGGG - Intronic
1015270120 6:131329014-131329036 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1015801725 6:137066812-137066834 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016113672 6:140257597-140257619 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016650696 6:146456139-146456161 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1016750966 6:147630627-147630649 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1016865182 6:148759205-148759227 CAGGAGAGGGAGAAAGGGCATGG + Intronic
1017028774 6:150202758-150202780 CAGCAGAGCCAGTCACAGGAAGG + Intronic
1017241691 6:152177322-152177344 TAGCAGTGGCAGTCAGGGGGAGG - Intronic
1017243960 6:152201776-152201798 CAGCAGAGGCACACAGGTGACGG + Intronic
1017270429 6:152497045-152497067 CAGCAAAGGGAGACAGAGGTGGG - Intronic
1017286596 6:152683271-152683293 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1018441303 6:163815962-163815984 CAGCACAGAGAGCCTGGGGAAGG - Intergenic
1018516319 6:164583654-164583676 GGGAAGGGGGAGTCAGGGGAAGG - Intergenic
1018521002 6:164652241-164652263 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1018521855 6:164657755-164657777 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1018624103 6:165760805-165760827 CAGCTGATGGTGTCAGGGAAGGG + Intronic
1018804476 6:167248358-167248380 CAGCAGAGGGAACCAGAGGGAGG - Intergenic
1019174187 6:170151713-170151735 CAGCAGAAGGAGACAGGGGCAGG - Intergenic
1019196175 6:170284414-170284436 CAGGGGAGGGAGGGAGGGGAAGG + Intronic
1019315080 7:380554-380576 GGACAGAGGGAGGCAGGGGAGGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019501224 7:1365656-1365678 CAGCACAGGGAGTGAGAGGAAGG + Intergenic
1019516102 7:1440835-1440857 CCGGGCAGGGAGTCAGGGGAGGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019742827 7:2683285-2683307 CTGCAGAGGGCTCCAGGGGAAGG + Intronic
1019748051 7:2711665-2711687 CAGCACAGGGAGGCAGAGGCAGG - Intronic
1019779539 7:2931204-2931226 CAGCAGAGGGAGGCCAGGGCGGG - Intronic
1019806460 7:3129922-3129944 TAGCAGAGGAAGTGAGGGGAAGG + Intergenic
1019942034 7:4299316-4299338 CAGCAGAGGGTGGGAGGTGAGGG + Intergenic
1019942753 7:4304178-4304200 CAGCAGAGGGTGGCAGGGGGAGG - Intergenic
1019950491 7:4368319-4368341 GAGCACAGGGTGTCAGGGGGAGG + Intergenic
1020150909 7:5680991-5681013 CATGAGAGGGAGTGAGGGGTGGG - Intronic
1020315716 7:6904078-6904100 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1020540550 7:9457801-9457823 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1020541437 7:9463868-9463890 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1020660467 7:10974693-10974715 CAGCAAAAGGGGTCAGGAGAAGG - Intronic
1020954126 7:14718635-14718657 CAGGAGAAGTAGTCCGGGGAGGG + Exonic
1021173322 7:17420639-17420661 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1021393329 7:20121042-20121064 CAGCGAAGGGAGACAGGGGTGGG - Intergenic
1021661135 7:22918804-22918826 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021825288 7:24544780-24544802 CAGCAGAGGGGCTGAGGGGAGGG + Intergenic
1022447950 7:30485159-30485181 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
1022466061 7:30653868-30653890 TGGCAGAGTGAGTCAGGGAAGGG - Intronic
1022479704 7:30734732-30734754 CAGCAGAGGGAGCTAGGAGAGGG - Intronic
1022522576 7:31017586-31017608 CAGCAGAGGGAGGAAGGGAGAGG + Intergenic
1022704104 7:32787156-32787178 CAGCAGTGGGGGTCAGTGGGTGG + Intergenic
1022778649 7:33554969-33554991 CAGCAGATGGAGCAAGGTGAGGG + Intronic
1023054865 7:36283332-36283354 CAGGTGAGGGAGGCAGAGGAAGG + Intronic
1023705845 7:42941196-42941218 CAGCAGAGGAACACAGGGGCAGG - Intronic
1024263174 7:47587048-47587070 CAGGAGAGGGAGCCTGGGGAGGG + Intergenic
1024402514 7:48941289-48941311 TAGCAAAGGGAGTTAGGGGTGGG - Intergenic
1024569388 7:50711262-50711284 CAGGAGAGGGTTTCAGGGGGTGG - Intronic
1024738093 7:52327356-52327378 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1025775000 7:64553609-64553631 CATCAGAGGGAGACAGGAGAGGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026039853 7:66859076-66859098 CAGGAGAGAGAGTCAGGTAATGG + Intergenic
1026201493 7:68218394-68218416 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1028915187 7:96251264-96251286 CAGCAGATGAAGTGAGGGGCTGG + Intronic
1029374680 7:100170523-100170545 AAGCAGAGGGAGACAGAGGGAGG + Intronic
1029524271 7:101085609-101085631 GAGCGGAGGGAGTAGGGGGAGGG + Intronic
1029661165 7:101963088-101963110 CAGCAGGGGGAACCAGGAGATGG - Intronic
1029947779 7:104551490-104551512 AAGCAGAGGCAGCCAAGGGAGGG - Intronic
1030193166 7:106829949-106829971 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1030838426 7:114317698-114317720 AAGCAAAGGGAGGGAGGGGATGG - Intronic
1031193145 7:118580830-118580852 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1031296354 7:120009506-120009528 CAGCACAGGGAGATAGGGGTGGG - Intergenic
1031608210 7:123794486-123794508 GAGCAGAGGGGGTCAGGGGATGG - Intergenic
1032395651 7:131587965-131587987 CAGCGAAGGGAGACAGGGGTGGG + Intergenic
1032689926 7:134275363-134275385 CAGAAGAGAAAGTGAGGGGAAGG + Intergenic
1032781288 7:135167035-135167057 GTGAAGAGGGGGTCAGGGGAAGG - Intronic
1032784627 7:135191127-135191149 CAGCAAAGGCAGCCAGAGGATGG + Intronic
1032972207 7:137177768-137177790 AGGCATAGGGAGTGAGGGGAGGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033894532 7:146054541-146054563 CGGCAGTGGCAGTCAGGAGAGGG + Intergenic
1033943771 7:146688436-146688458 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034018041 7:147608812-147608834 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1034204294 7:149302364-149302386 CAGTGCAGGGAGCCAGGGGAAGG - Intergenic
1034291140 7:149932741-149932763 CAGCAGGGCGAGACAGGGCAGGG + Intergenic
1034420247 7:150986782-150986804 CAGGAGAGGGAGACAGGAGGAGG + Intergenic
1034447008 7:151118895-151118917 CAGCAGAGGGCATCGGGGTAGGG - Intronic
1034540561 7:151755389-151755411 GAGCAGAGGAAGACAGGGGGTGG + Intronic
1034567219 7:151924735-151924757 CTGCAGAGGGATTAAAGGGACGG + Intergenic
1034738219 7:153448853-153448875 GAGCACAGTGAGTCAAGGGAAGG + Intergenic
1034859875 7:154585946-154585968 AAGGAGAGGAAGGCAGGGGAAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035186521 7:157130246-157130268 CAGGAGAGTCAGTCAGGGAAGGG + Intergenic
1035548861 8:504412-504434 CAGTGGGGGGAGGCAGGGGAAGG + Intronic
1035783670 8:2247411-2247433 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783683 8:2247449-2247471 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783696 8:2247487-2247509 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783707 8:2247525-2247547 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783733 8:2247601-2247623 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783746 8:2247639-2247661 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783771 8:2247715-2247737 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783823 8:2247867-2247889 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783836 8:2247905-2247927 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783849 8:2247943-2247965 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783887 8:2248056-2248078 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783900 8:2248094-2248116 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783913 8:2248132-2248154 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783937 8:2248208-2248230 CAGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035783949 8:2248246-2248268 CAGGAGGAGGAGTCAGGGGAAGG + Intergenic
1035783960 8:2248284-2248306 CAGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035783973 8:2248322-2248344 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035783997 8:2248398-2248420 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784019 8:2248474-2248496 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784081 8:2248664-2248686 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784164 8:2248930-2248952 CAGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035784202 8:2249044-2249066 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784215 8:2249082-2249104 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784265 8:2249234-2249256 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784290 8:2249310-2249332 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035784358 8:2249538-2249560 CAGTAGGAGGAGCCAGGGGAAGG + Intergenic
1035784474 8:2249918-2249940 CAGGAGGAGGAGCCAGGGGAAGG + Intergenic
1035808335 8:2471795-2471817 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808369 8:2471909-2471931 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808382 8:2471947-2471969 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808395 8:2471985-2472007 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808418 8:2472061-2472083 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808444 8:2472137-2472159 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035808457 8:2472175-2472197 CAGGAGGAGGAGCCAGGGGAAGG - Intergenic
1035879853 8:3234152-3234174 CAGCAGAGGCAATCAGGGCAGGG + Intronic
1035911185 8:3567763-3567785 TAGCAGAGGGTGTGAGGGAAGGG - Intronic
1036472684 8:9064895-9064917 CAGCGAAGGGAGACAGGGGTGGG + Intronic
1036550226 8:9809173-9809195 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
1036747655 8:11421303-11421325 AACCAGATGGAGGCAGGGGAGGG - Intronic
1036837167 8:12082243-12082265 CACCAGGGCCAGTCAGGGGATGG + Intergenic
1037167368 8:15847160-15847182 AAGCAGGGAGAGGCAGGGGAAGG + Intergenic
1037747644 8:21659680-21659702 CTGCAGAAGGAGACAGGGAAGGG - Intergenic
1038285180 8:26200157-26200179 CAGCACAGGAATTTAGGGGAGGG - Intergenic
1038412383 8:27368427-27368449 AAGGTGAGGGAGTCAGTGGAGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039266409 8:35829124-35829146 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1039499261 8:38003800-38003822 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1039671613 8:39606785-39606807 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040394827 8:46987229-46987251 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1040416590 8:47201166-47201188 CAGGAGACAGACTCAGGGGAGGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1040880760 8:52201762-52201784 CAGCCCAGGGAGTCTGAGGACGG - Intronic
1041442903 8:57917462-57917484 GAGAAGAGGGAGTCAGGGTTGGG + Intergenic
1042130477 8:65582724-65582746 AAGGAGAAGGAGGCAGGGGAAGG + Intergenic
1042399607 8:68330892-68330914 CAGCAGCAGGAATCAGGGGGCGG - Exonic
1042829614 8:73012154-73012176 GAAGAGAGGGAGTAAGGGGAAGG + Intronic
1042916252 8:73878652-73878674 CAGCTCAGGGCGTCGGGGGAGGG - Intronic
1043721504 8:83550544-83550566 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1044019081 8:87082321-87082343 CAGCAAAGGGAGATAGGGGTGGG - Intronic
1044025642 8:87168565-87168587 TAGCAGAGGGAGTCGGGGGTGGG - Intronic
1044115479 8:88328553-88328575 CGGCTGCGGGAGCCAGGGGAAGG + Intergenic
1044248932 8:89984258-89984280 AGGGAGGGGGAGTCAGGGGAGGG + Intronic
1044448569 8:92307163-92307185 CAGCAGCGTGATTCAGGAGACGG - Intergenic
1044587143 8:93878456-93878478 CAGCAAAGGGAGTTAGGGGTGGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045508474 8:102795156-102795178 AAGCAGAGGGAGGCAGCTGACGG - Intergenic
1045778736 8:105838601-105838623 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1046439733 8:114241931-114241953 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046440493 8:114246962-114246984 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046869050 8:119184372-119184394 CAGAAGAGGGAGTTTGGGGAGGG + Intronic
1047314830 8:123723171-123723193 CATCAGTGGGAGGCAGGGGGAGG + Intronic
1047449534 8:124952529-124952551 CAGCTAAGGGAGTGAAGGGAAGG - Intergenic
1048097081 8:131308515-131308537 CAGCAATGGGAGTTAGGGGTGGG - Intergenic
1048257403 8:132915484-132915506 CAGCAGCTGGTGTCAGGGCACGG + Intronic
1048270204 8:133022219-133022241 GAGCAGGGGCAGTGAGGGGATGG - Intronic
1048584955 8:135767292-135767314 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1049149788 8:141027183-141027205 CAGCAGAGGGAGACAAGGCCAGG + Intergenic
1049195388 8:141312928-141312950 CAGAGGAGAGAGCCAGGGGAGGG - Intergenic
1049521150 8:143092090-143092112 CAGGAGGGGGATTCAGGCGAGGG + Intergenic
1049543017 8:143216981-143217003 CAGCAGAAGGAGGAAGGAGAAGG - Intergenic
1049591801 8:143466119-143466141 CAGGTGAGGGACTCAGAGGAGGG - Intronic
1049624234 8:143612966-143612988 CTGCAGAGGCAGGCAGGTGAGGG + Intronic
1049796906 8:144501094-144501116 GAGGAGAGGGAGTGAGGGGAAGG - Intronic
1049815709 8:144598340-144598362 CAGCTGTGGGTGTCAGTGGAGGG + Intronic
1050037648 9:1454212-1454234 CAGCAGAGGCAGTGAGGAGAGGG + Intergenic
1050343231 9:4662144-4662166 CAGGTGAGGGAGTGAGGTGATGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051341019 9:16110673-16110695 AAGAAAAGGGAGTCAGGGTAAGG - Intergenic
1051459316 9:17294766-17294788 CCGCGGGGGGAGTGAGGGGAGGG + Intronic
1051679556 9:19593445-19593467 GGGCTGAGGGAGACAGGGGAGGG + Intronic
1052060753 9:23958421-23958443 CAGAAGAGAGAGTCAGAAGAAGG + Intergenic
1052844479 9:33322883-33322905 CATCAGAGAGAATCAGGGAAAGG + Intronic
1052947392 9:34179225-34179247 CAGCAGCGGCATTCAGGTGAGGG + Exonic
1053077990 9:35151324-35151346 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1053139513 9:35673976-35673998 CAACAGAGGGAGCCAGGGGCTGG - Exonic
1054257980 9:62834072-62834094 CAGCAGAGGAAGACTGGGGCAGG - Intergenic
1054903468 9:70393440-70393462 CAGCTCAGGGAGTCTGGGGAGGG - Intronic
1055605034 9:77960303-77960325 AGGCAGAGGGAGTGAGGAGAAGG + Intronic
1055881446 9:81009362-81009384 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1056257340 9:84813627-84813649 CAGCAAAGGGAGACAGCTGAGGG - Intronic
1056464614 9:86841573-86841595 CAGAAGAGGGACTCAGGAGATGG + Intergenic
1056496282 9:87158431-87158453 CAGCACATGGTGGCAGGGGAAGG - Exonic
1056656536 9:88514240-88514262 CAGCAAAGGGAGCTAGGGGTGGG + Intergenic
1056681647 9:88724638-88724660 CAGCAGAGACGGCCAGGGGAGGG + Intergenic
1057004714 9:91547060-91547082 CAGGAAAAGGAGTCAGGGGCAGG + Intergenic
1057389066 9:94627936-94627958 CAGGGGAGGGAGGTAGGGGAAGG - Intronic
1057444337 9:95103452-95103474 CAGCAGCAGGAGGCAGGAGAAGG + Intronic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1057784010 9:98073229-98073251 GAGAACAGGGAGTCAGGGGAAGG - Intronic
1057919773 9:99087583-99087605 CAGGAGAGGGAGTCCTGTGATGG - Intergenic
1058425313 9:104870766-104870788 CAGCAAAGGGAGATAGGGGTGGG + Intronic
1058935714 9:109767633-109767655 GGGCAGAGGGAGCGAGGGGAGGG - Intronic
1059350634 9:113662454-113662476 CAGGAGAAGGAGGCAGGAGAAGG - Intergenic
1060060217 9:120453250-120453272 AGACAGAGGGAGTGAGGGGAAGG + Intronic
1060181496 9:121537576-121537598 CAGAAGAGGAAGTCAGTGGGAGG - Intergenic
1060297026 9:122349902-122349924 CACCTGCGGGGGTCAGGGGAGGG - Intergenic
1060318767 9:122535847-122535869 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1061231673 9:129319243-129319265 CAGCAGAGGGGGCCAGGGGAGGG - Intergenic
1061326429 9:129867477-129867499 GAGCAGGGGGAGCCAGAGGAAGG + Intronic
1061614922 9:131773324-131773346 AGGCAGAGGGAGCCAGGGGAAGG - Intergenic
1061675038 9:132210794-132210816 CAGCAGAGGGAGCGTGGGGTGGG + Intronic
1061873561 9:133533081-133533103 CAGAAGAGAGAGGAAGGGGATGG + Intronic
1061959084 9:133978954-133978976 GAGCTGAGGGGGTCAGGGCAGGG + Intronic
1062001982 9:134220738-134220760 CAGCAGAGGGCTCCGGGGGAAGG + Intergenic
1062438626 9:136558602-136558624 CAGGAGAGGGAGACAGCGAAGGG - Intergenic
1062596765 9:137303019-137303041 CAGCAGAGGGAGGCAGGCCGCGG - Intergenic
1062631098 9:137463519-137463541 CACCACAGGGAGCCTGGGGAGGG + Exonic
1202800793 9_KI270719v1_random:174308-174330 CAGCAGAGGAAGACTGGGGCAGG + Intergenic
1185683209 X:1906066-1906088 CAGGGCAGGGGGTCAGGGGAAGG + Intergenic
1185889177 X:3809245-3809267 CAGCAAAGGGAGACAGGGGTGGG - Intergenic
1185961047 X:4545974-4545996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1186116307 X:6308240-6308262 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1186375222 X:8991400-8991422 CACCAGAGTAAGTCAGGGTATGG - Intergenic
1186490944 X:9971562-9971584 CAGGACAGGGAGTAAGGGTAGGG - Intergenic
1186612037 X:11146745-11146767 CAGCAGAGGCAGTTAGGGTTGGG + Intronic
1187104610 X:16228153-16228175 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1187217559 X:17291531-17291553 AAGCAGGGGGAGATAGGGGAAGG + Intergenic
1187267296 X:17747071-17747093 GAGCTGAGGTAGGCAGGGGATGG - Intronic
1188200076 X:27286324-27286346 CAGCAAAGGGAGTTAGGGATGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188552369 X:31378051-31378073 CAGCAAAGGGAGACAGGGGTGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190061542 X:47214919-47214941 GAGCAGACGGGGTCAGCGGATGG - Exonic
1190334973 X:49256862-49256884 GGACAGAGGGTGTCAGGGGAGGG + Intronic
1190502558 X:51094268-51094290 CAGTAGAGGCTGTCAGAGGAAGG - Intergenic
1190928793 X:54931319-54931341 CAGCTGAGGGTGTCATGTGATGG + Exonic
1191805266 X:65129403-65129425 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1191806071 X:65134814-65134836 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1192207284 X:69104993-69105015 CAGAAGAGAGAGGCAGGGGGAGG + Intergenic
1192350313 X:70350463-70350485 CAACAGAGGGAGACGGGAGAGGG + Intronic
1192428267 X:71096039-71096061 GGGAAGGGGGAGTCAGGGGAGGG + Intergenic
1192707897 X:73546441-73546463 CAGGGGTGGGGGTCAGGGGAGGG + Intergenic
1192730872 X:73801560-73801582 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1192914394 X:75637387-75637409 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1193455272 X:81724385-81724407 CAGCTGGGGCAGCCAGGGGAGGG + Intergenic
1193851106 X:86538023-86538045 CAGCAAAGGGAGATAGGGGTAGG - Intronic
1194180436 X:90704967-90704989 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1194874139 X:99164886-99164908 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1195016499 X:100786719-100786741 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1195017229 X:100791605-100791627 CAGCAAAGGGAGTTAGGGGTGGG + Intergenic
1195841140 X:109178671-109178693 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1195841977 X:109184037-109184059 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1196175248 X:112632980-112633002 CAGCGGAGTGAATCAAGGGAGGG - Intronic
1196226633 X:113176232-113176254 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196295176 X:113988701-113988723 CAGCGAAGGGAGTTAGGGGTGGG - Intergenic
1196300744 X:114047604-114047626 CTGAAAAGGGAGTCAGCGGAGGG + Intergenic
1196774182 X:119323143-119323165 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196783239 X:119400787-119400809 CTGCAGAGGGACTCATGGGTGGG + Intronic
1196992305 X:121343997-121344019 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1196993015 X:121348369-121348391 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1197793759 X:130280069-130280091 CAGCAAAGGGAGTTAGGGGTGGG - Intergenic
1198400285 X:136262263-136262285 CAGCTGAGGAAGGTAGGGGAAGG - Intergenic
1199073192 X:143502299-143502321 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1199974568 X:152885524-152885546 TGGGAGAGGGAGTCAGAGGAGGG - Intergenic
1200076822 X:153555294-153555316 CAGGAGTGGGAGCCAGGGGTAGG - Intronic
1200167254 X:154045344-154045366 CAGCAGCTGGAGTCAGGGTGGGG - Intronic
1200234545 X:154461949-154461971 CTGCGGAGGGAGACAGAGGAGGG - Intronic
1200533189 Y:4360884-4360906 CAGCGAAGGGAGTTAGGGGTGGG + Intergenic
1200546824 Y:4527974-4527996 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1200659962 Y:5945913-5945935 CAGCAAAGGGAGATAGGGGTGGG - Intergenic
1201233484 Y:11888585-11888607 CAGCAAAGGGAGATAGGGGTGGG + Intergenic
1201483400 Y:14465816-14465838 CAGCAAAGAGAGACAGGGGTGGG - Intergenic
1201725060 Y:17141824-17141846 CAGCAAAGGGAGTTAGTGGTAGG + Intergenic
1201725159 Y:17142609-17142631 CAGCAAAGGGATTTAGGGGTGGG + Intergenic
1202062864 Y:20905607-20905629 CAGCAAAGGGAGATAGGGGCGGG - Intergenic