ID: 933771764

View in Genome Browser
Species Human (GRCh38)
Location 2:85749145-85749167
Sequence GTGCTAGCACTGTGAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933771761_933771764 -3 Left 933771761 2:85749125-85749147 CCTGCTGGTTAATGGTGGCAGTG 0: 1
1: 0
2: 0
3: 16
4: 134
Right 933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
933771759_933771764 4 Left 933771759 2:85749118-85749140 CCAATGTCCTGCTGGTTAATGGT 0: 1
1: 0
2: 1
3: 5
4: 99
Right 933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
933771755_933771764 25 Left 933771755 2:85749097-85749119 CCTCATCACTGTCCTCTGGATCC 0: 1
1: 0
2: 3
3: 25
4: 327
Right 933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 103
933771756_933771764 13 Left 933771756 2:85749109-85749131 CCTCTGGATCCAATGTCCTGCTG 0: 1
1: 0
2: 1
3: 7
4: 162
Right 933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933771764 Original CRISPR GTGCTAGCACTGTGAATGGG AGG Intergenic
900595654 1:3479067-3479089 GTCCTGGCACTCAGAATGGGAGG + Intronic
901495843 1:9621297-9621319 GGGCTAACAGTGTGGATGGGAGG + Intergenic
904587453 1:31588133-31588155 GTGCTGGCACTGGGAATCTGAGG - Intergenic
905233337 1:36529259-36529281 CTGCTGGCACTGTGACTGTGTGG + Intergenic
913193374 1:116432443-116432465 GTGCTAGGAGAGTGAATGAGGGG - Intergenic
917185908 1:172354982-172355004 CGGCTTGCACTGTGAATGGAAGG + Intronic
922722515 1:227906082-227906104 GTTCTAGCACTGGGAGTTGGCGG - Intergenic
923986610 1:239388246-239388268 GTGTTTGCAATGTGAAAGGGCGG + Intronic
924541717 1:244986769-244986791 TTGCTTGCACTGTGGAAGGGTGG + Intronic
1074513098 10:114137374-114137396 GTCCTAGCACTGTCACTGAGGGG + Intronic
1079270911 11:18985119-18985141 ATGCTAACACTGTAAAGGGGTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085267016 11:75243024-75243046 GTGCCAGCATTGGGTATGGGGGG - Exonic
1085919998 11:80942453-80942475 GTGCTAGCTATGTGACTGGTTGG - Intergenic
1088618114 11:111653737-111653759 GTGCTGGCACTGAAAATGGATGG - Intronic
1091445555 12:542647-542669 GAGCCAGCACTCTGAGTGGGTGG - Intronic
1091613480 12:2031397-2031419 GTGGCAGCACGGTGAATGGGGGG + Intronic
1091752633 12:3032357-3032379 GAGCTCGCACTCTGGATGGGAGG + Intronic
1096978898 12:55717175-55717197 GTCCTAGCACTGGGCAAGGGAGG + Intronic
1097180843 12:57171040-57171062 GGGCTATCTCTGTGAAGGGGAGG + Intronic
1100736533 12:97540598-97540620 TTGCTAGCAATGTGACTAGGAGG + Intergenic
1101173231 12:102121040-102121062 ATGCAAGCACTCTGAATGGCAGG - Intronic
1107008577 13:35643859-35643881 GTGCAGGTCCTGTGAATGGGAGG - Intronic
1109600060 13:64613821-64613843 ATGCTTGCACTTTGAATGGCAGG + Intergenic
1114618417 14:24080923-24080945 GTGGTGACACAGTGAATGGGAGG - Exonic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1119537194 14:75412196-75412218 ATGTTATCACTGTGATTGGGTGG - Intergenic
1119709858 14:76813688-76813710 ATGCTAACAGTGTGTATGGGGGG - Intronic
1126232755 15:46345916-46345938 GTGGTTGCACTGTGAATGTGAGG - Intergenic
1126564128 15:50076912-50076934 GTGCTACCACAGTGTATGAGGGG + Intronic
1127854468 15:62943145-62943167 GTGCTAGCAGGCTGAGTGGGAGG + Intergenic
1130054826 15:80513406-80513428 GTGCTAGAACAGTGTATGGGAGG + Intronic
1132710534 16:1264280-1264302 AAGGGAGCACTGTGAATGGGTGG + Intergenic
1140684188 16:77417235-77417257 GTTTTAGAAGTGTGAATGGGAGG + Intronic
1141885710 16:86890847-86890869 GTGCCCTCACTGTGCATGGGAGG - Intergenic
1141912795 16:87071365-87071387 GAGGAAGGACTGTGAATGGGAGG - Intergenic
1142064697 16:88054555-88054577 GTGATAGCACTGGGAGTGGTGGG - Intronic
1142961015 17:3552679-3552701 GAGCTAAATCTGTGAATGGGGGG + Intronic
1145925225 17:28641980-28642002 CTGCTATCACTGTGGATGTGTGG - Exonic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149595720 17:57863452-57863474 GTTCTAGGAATTTGAATGGGGGG - Intronic
1151229917 17:72677178-72677200 ATCCTAGCACTGTGGATGGAAGG + Intronic
1154171921 18:12058685-12058707 GTACTAGGTCTGTGAATGTGTGG - Intergenic
1154175382 18:12084437-12084459 GTACTAGGTCTGTGAATGTGTGG + Intergenic
1156861717 18:41844337-41844359 GGGCTAGCAGTGGGCATGGGTGG - Intergenic
1167774372 19:51545082-51545104 GTTCTGGGCCTGTGAATGGGAGG - Intergenic
928702969 2:33917798-33917820 CTGCTAGCACAGGGAATGGCAGG - Intergenic
930664140 2:54085270-54085292 GTGGTGGCACTGTGAGTGAGTGG + Intronic
931060334 2:58521781-58521803 GTGCTGCTACTATGAATGGGTGG + Intergenic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
936659611 2:114528152-114528174 GTGCTTGCAGTGTGTATGGGAGG - Intronic
937395040 2:121527651-121527673 GTGCTAACACTGGGCAAGGGTGG + Intronic
941928337 2:170917350-170917372 GTGCTGGCACTTGGAATGGCTGG - Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
943117606 2:183692441-183692463 GGGAGAGCACAGTGAATGGGGGG - Intergenic
947124160 2:226849831-226849853 GAGCTATCACTGTGAATGACTGG - Intronic
947408599 2:229808953-229808975 GTGCTGACACTGTGAGTGGAGGG + Intronic
949021671 2:241744375-241744397 GTGCTGGTACTGTGAGTCGGAGG - Intronic
1170565799 20:17603584-17603606 GTGCAAGCAGTCTGAGTGGGAGG + Intronic
1172161293 20:32870253-32870275 GTGCCACCACTGTGTCTGGGAGG + Intronic
1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG + Intergenic
1175976431 20:62712645-62712667 GTGCCAGCAGGGTGACTGGGAGG + Intronic
1181172455 22:21017327-21017349 GTGAGAGCACTGTGAATTTGGGG - Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
954314709 3:49794890-49794912 GTGCTTGCAGTGGGAAGGGGTGG - Intronic
956161650 3:66360853-66360875 CTGCTAAGACTGTGATTGGGAGG - Intronic
956888580 3:73586488-73586510 GTGCTAGTACTGAGAATATGCGG + Intronic
957894733 3:86407317-86407339 GTGATAGAACAGTGAATGTGTGG - Intergenic
964503173 3:157370528-157370550 ATGCTAGCACTGTGAAGTTGGGG - Intronic
965635508 3:170776344-170776366 GTTATAGCACTGAGAATGGAAGG - Intronic
967232820 3:187356721-187356743 GTGCTAGCAGAGGGAATGGAAGG + Intergenic
967768935 3:193312897-193312919 TTGCTTGCACTGGGAATGTGGGG + Intronic
967980249 3:195061211-195061233 GTCCTGGCACTGGGCATGGGCGG - Intergenic
968981755 4:3853923-3853945 GTGCTGGCACTGGGCATGTGCGG - Intergenic
969537331 4:7764691-7764713 GTGCCAGCACTGTGAAAGCAGGG + Intronic
975040069 4:69735517-69735539 ATGTCATCACTGTGAATGGGTGG - Intronic
975114149 4:70660329-70660351 GTAAAAGCACTGTGAATGTGGGG + Intronic
975445000 4:74453252-74453274 GTGCTTGCACTGATAATGTGAGG + Intronic
979181270 4:117730576-117730598 GTGCCAGCACTGTGCATGTTAGG - Intergenic
979427853 4:120590105-120590127 GAGCTTGCACTATGAATTGGTGG - Intergenic
985333877 4:188870750-188870772 GTGCTATCACTGGGAATGAGAGG - Intergenic
985806263 5:2045748-2045770 GTGCCAGCAGTTTGCATGGGAGG - Intergenic
986008979 5:3695057-3695079 GAGCTGCCACTGGGAATGGGTGG + Intergenic
988068236 5:26250894-26250916 GTGCTAGGACCTTGAGTGGGAGG - Intergenic
988618040 5:32794136-32794158 CTGCTAGCACTGGGAGTAGGAGG - Intergenic
995449617 5:112286289-112286311 GTGCTAGCATGGAGAATGCGGGG - Intronic
995553270 5:113301115-113301137 GTGCTAGCTCTGTGAAAGCAGGG - Intronic
997631230 5:135370203-135370225 TTCCTGGCACTGTGAATGTGGGG - Intronic
1013444311 6:110206441-110206463 GTGCTAGCACAGTAAATGTTTGG - Intronic
1018927217 6:168214864-168214886 GTGAGAGCAGTGTCAATGGGAGG - Intergenic
1024248411 7:47488266-47488288 GTGTCAGCACTGGGAATGAGGGG - Intronic
1025190579 7:56892783-56892805 GTGCGTGCAGTGTGAATGGCAGG + Intergenic
1025681373 7:63684193-63684215 GTGCGTGCAGTGTGAATGGCAGG - Intergenic
1028432809 7:90767111-90767133 CTGCTGACACTGTGCATGGGGGG - Intronic
1034552175 7:151828086-151828108 GTGCTTGCTGGGTGAATGGGTGG - Intronic
1037726839 8:21489830-21489852 TGGCTAGCACTGTGTAAGGGTGG + Intergenic
1038425523 8:27461810-27461832 GTGCAGGGGCTGTGAATGGGGGG - Intronic
1038533183 8:28335237-28335259 GTGCTTGCAATATGAATTGGTGG - Intronic
1041253405 8:55956969-55956991 GCTGTAGCACTGTGAATGAGAGG + Intronic
1044311508 8:90698425-90698447 TTGATAGCACTTTGAAAGGGTGG + Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1048588459 8:135798225-135798247 GTTCTTGCCCTGTGGATGGGAGG - Intergenic
1048918959 8:139210513-139210535 GTACTTCCACAGTGAATGGGTGG - Intergenic
1049260693 8:141637557-141637579 GGGCTAGCACAGTGACTGGGTGG + Intergenic
1049316566 8:141972238-141972260 GTCCCAGCACTGATAATGGGCGG + Intergenic
1056829044 9:89899508-89899530 GTGCTAGCATTGTGCCTGGTGGG - Intergenic
1057217139 9:93235318-93235340 GTGTGAGCACTGGGGATGGGTGG - Intronic
1188977537 X:36692941-36692963 GTGCGAGCACTGTTTGTGGGAGG + Intergenic
1197886758 X:131226267-131226289 GTGCTAGCCCTCTGAATAGTGGG + Intergenic
1199387721 X:147242181-147242203 ATGGTAGCACTGAGACTGGGTGG - Intergenic