ID: 933774325

View in Genome Browser
Species Human (GRCh38)
Location 2:85762753-85762775
Sequence TTGGCACTATCGACATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 8, 3: 25, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933774318_933774325 5 Left 933774318 2:85762725-85762747 CCATGCTCTGGAATAGGGATTTC 0: 1
1: 0
2: 1
3: 25
4: 245
Right 933774325 2:85762753-85762775 TTGGCACTATCGACATTTGGGGG 0: 1
1: 1
2: 8
3: 25
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933774325 Original CRISPR TTGGCACTATCGACATTTGG GGG Intronic
902718573 1:18289626-18289648 TGGGCACTGTTGACATTTGGGGG + Intronic
903429607 1:23284286-23284308 TTGGCATAATAGACATTTTGAGG - Intergenic
903697175 1:25216403-25216425 TTGGCATTATCTTGATTTGGAGG + Intergenic
904347438 1:29882405-29882427 TTGGCTCTGTCTACATTTGGAGG - Intergenic
905615532 1:39395046-39395068 TCGGCACTATTGACATTTTTTGG + Intronic
905815716 1:40949244-40949266 TTGCCACTAATGACATCTGGTGG + Intergenic
908496274 1:64698055-64698077 TTGGCACTCTAGAAATTTAGTGG - Intergenic
912261893 1:108119172-108119194 TTGGCAATATCTACATTTGAAGG - Intergenic
915168323 1:153960973-153960995 TTGGAACTATTAACATTTTGGGG + Intronic
917552678 1:176051225-176051247 CTGGCACTCTGGACATTTGATGG - Intronic
917960294 1:180138284-180138306 GTGGCACTACTGACATTTAGTGG - Intergenic
923702259 1:236311102-236311124 TTGGCACTGTGGTCATTTTGGGG + Intergenic
1063086193 10:2820107-2820129 TTGGCCCTGTAGACATTTAGAGG - Intergenic
1064849171 10:19690991-19691013 GTGGCACTATCAACATTTAAAGG + Intronic
1066377309 10:34869011-34869033 TTGGCACCATTGACATTTTGGGG + Intergenic
1068059626 10:52051074-52051096 TCAGCACTATTGACATTTTGAGG - Intronic
1071836012 10:89417635-89417657 TGGGCACTCTTGAAATTTGGAGG + Exonic
1072178450 10:92953629-92953651 TCGGCACTATTGACATTTTAGGG - Intronic
1074287441 10:112111235-112111257 TTGGCACTATTGACATTTTTGGG - Intergenic
1074743859 10:116511464-116511486 TTGGCACTATTGACAGTTTTGGG + Intergenic
1075408046 10:122207601-122207623 TTGGCATTATGGTCATTTGGGGG - Intronic
1075443519 10:122497984-122498006 GTGGCACTGTTGACATTTTGTGG + Intronic
1075507482 10:123037203-123037225 TTGGCACTATTGACATTTTGGGG - Intronic
1075620230 10:123922045-123922067 TGAGCACAATTGACATTTGGGGG + Intronic
1076453248 10:130571539-130571561 TTGGCACTAGCAAGGTTTGGGGG - Intergenic
1079645848 11:22863239-22863261 TTGGCAATATCATCATTTAGTGG - Intergenic
1081114312 11:39180261-39180283 TTGGCACTATCAACAGTTTCAGG + Intergenic
1081371851 11:42313799-42313821 TTGGAAATATAGACTTTTGGGGG + Intergenic
1081474621 11:43414681-43414703 TTCACACTCTGGACATTTGGTGG - Exonic
1081722476 11:45300518-45300540 TTGGCACTACTGACATTTGGGGG - Intergenic
1084773762 11:71361709-71361731 TCGGCCCTATTGACGTTTGGGGG + Intergenic
1086468511 11:87080246-87080268 TTGGCACTATTGACATGTTTTGG + Intronic
1086486529 11:87308810-87308832 TTTGCACTATGGACAGTTGAAGG + Intronic
1088532307 11:110823845-110823867 TAGGCAGTAGTGACATTTGGAGG - Intergenic
1088572911 11:111240880-111240902 TTGGAGCTACAGACATTTGGGGG - Intergenic
1089886515 11:121829982-121830004 TTGGTATTATCAAAATTTGGGGG + Intergenic
1100039257 12:90293114-90293136 TTGTCACTATGTAAATTTGGAGG - Intergenic
1100673679 12:96843971-96843993 TTGGCACAATAGGCATTTGCAGG + Intronic
1103064968 12:117889905-117889927 TTGGCACTACTGATATTCGGGGG - Intronic
1106801526 13:33261331-33261353 TCCCCACTATCGACATTTGGGGG - Intronic
1107491819 13:40887444-40887466 GTGGCATTATTGACATTTTGGGG - Intergenic
1108192516 13:47956839-47956861 TTGGCACTATTGACATTTTAGGG - Intronic
1108669944 13:52675781-52675803 ATGGCATTATTGACATTTTGGGG + Intronic
1111878241 13:93922476-93922498 TTGGCACTGTTGTCATTTTGGGG + Intronic
1112026852 13:95419251-95419273 TTGGCACTATTGACATTTGGAGG - Intergenic
1112747051 13:102538369-102538391 TCAGCACTACCGACATTTGGGGG + Intergenic
1114500769 14:23166590-23166612 TTGGCAGGATTGGCATTTGGAGG + Intronic
1115483174 14:33882845-33882867 TTGGCACTATCTACAGTTTCAGG + Intergenic
1116400068 14:44495776-44495798 TGGTCACTTTCCACATTTGGGGG + Intergenic
1117585947 14:57204119-57204141 TTGTGATTATCGACTTTTGGGGG - Exonic
1121162211 14:91754248-91754270 TTGATACTATTGACATTTTGGGG - Intronic
1121718503 14:96092964-96092986 TCGGCACTATTGGCATTTTGGGG - Exonic
1121964490 14:98291413-98291435 TTGGCAATCTGGACACTTGGGGG - Intergenic
1133443051 16:5836634-5836656 TTTGCACTGTGGACGTTTGGGGG + Intergenic
1134115056 16:11541886-11541908 TTGGCACTATTGACACCTTGGGG - Intergenic
1135043763 16:19137643-19137665 TAGGCACTACTGACACTTGGGGG - Intronic
1135615376 16:23907058-23907080 TTGGCATTATTGACATTGGGGGG + Intronic
1138154837 16:54693475-54693497 TTGGCACTATTGACATTTTGGGG + Intergenic
1138824930 16:60307772-60307794 TTTGAACTATTGACATTTTGAGG - Intergenic
1140953318 16:79839614-79839636 TTGGCACTCTTGACATTTGGGGG + Intergenic
1141357127 16:83357709-83357731 TTGGCACTACTGACATTTTGAGG - Intronic
1151544024 17:74781147-74781169 TGGGCACTATGGAAATTTGGGGG - Intronic
1152995324 18:401201-401223 TTGGTACTATCTGCATTCGGAGG + Intronic
1155812060 18:30249412-30249434 TTGGCACAATCGACAATTTCAGG + Intergenic
1156247193 18:35312644-35312666 TTAGCACTATTGACATTTTGGGG + Intergenic
1157036583 18:43982385-43982407 TTTGCACTATCTACATTTTAAGG + Intergenic
1157864436 18:51168617-51168639 TTAGTACTATTGACATTTTGGGG - Intergenic
1158133028 18:54174103-54174125 TTGGCATTCTTGACATTTGGGGG + Intronic
1159887960 18:73927440-73927462 TTGGAACTGTTGACATTTTGGGG - Intergenic
1160695533 19:482511-482533 TTGACACCATTGACATTTGAGGG - Intergenic
1162822501 19:13231530-13231552 TCAGCACTGTTGACATTTGGGGG - Intronic
1164439696 19:28264275-28264297 TTGGCATTATGCACATTTGTGGG + Intergenic
1166438093 19:42786518-42786540 ATGGCACAATCTACATGTGGTGG - Intronic
1166457049 19:42950312-42950334 ATGGCACAATCTACATGTGGTGG - Intronic
1166466994 19:43041171-43041193 ATGGCACAATCTACATGTGGTGG - Intronic
1166486797 19:43220796-43220818 ATGGCACAATCTACATGTGGTGG - Intronic
1166493909 19:43284243-43284265 ATGGCACAATCTACATGTGGTGG - Intergenic
1168048128 19:53808783-53808805 GTGGCACTATTGACACTTTGGGG + Intronic
1168048723 19:53812617-53812639 TTGGCACTGTTGGCATTTCGGGG - Intronic
926297158 2:11577327-11577349 TTGGCACCAGTGACATTTGCAGG - Intronic
926918221 2:17913934-17913956 TCGGCACTATTGACATTGTGGGG - Intronic
931451441 2:62370477-62370499 TCAGCACTACTGACATTTGGGGG - Intergenic
933594503 2:84269270-84269292 TTGGCATGATTGACATTTTGGGG - Intergenic
933774325 2:85762753-85762775 TTGGCACTATCGACATTTGGGGG + Intronic
935036252 2:99377381-99377403 TTGGCACTATTAAAATTTGGGGG + Intronic
937255518 2:120552686-120552708 ATGGCGCTAACGGCATTTGGAGG - Intergenic
937831929 2:126433736-126433758 TCTGCACTATCGGCATTTTGGGG + Intergenic
938588083 2:132711428-132711450 TAGGTATTATCGTCATTTGGTGG + Intronic
940714357 2:157202878-157202900 TTGGCATTACTGGCATTTGGGGG + Intergenic
941683221 2:168421323-168421345 TTGGAATAATCGCCATTTGGTGG + Intergenic
946957565 2:224948432-224948454 TTAGCACTAAAGACATATGGTGG - Intronic
1169035640 20:2449440-2449462 TTGGCACTTGCAACATCTGGAGG + Intergenic
1171330038 20:24329404-24329426 TGGGGACCATGGACATTTGGGGG + Intergenic
1174712209 20:52718956-52718978 TTGGAACCATTGACATTTTGGGG - Intergenic
1175501405 20:59453530-59453552 CTGGCATTATTGACATTTGGGGG + Intergenic
1181775035 22:25153425-25153447 ATGGCACTACGGACATGTGGTGG - Intronic
1183258891 22:36781460-36781482 TCGGCACTATTGACATTTGGGGG + Intergenic
949162621 3:898985-899007 TTTGCACTATTGATATTTTGGGG - Intergenic
951905862 3:27706967-27706989 TCAGCTCTATTGACATTTGGAGG - Intergenic
952000806 3:28783938-28783960 TTAGCACTATTGACATTTTGGGG + Intergenic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
956257849 3:67303717-67303739 TTAGCACTATTGACATTTGGAGG + Intergenic
963059818 3:141216340-141216362 TTGGCTGTATAGACATATGGAGG + Intergenic
964211160 3:154229561-154229583 TTGGCACGATTGACATTTTGGGG + Intronic
964515017 3:157498383-157498405 ATGGCACAACTGACATTTGGTGG + Intronic
966266795 3:178055729-178055751 TTGGCACTATCCACAGTTTCAGG - Intergenic
967718178 3:192787957-192787979 TTGGTACTGTTGACATTTTGGGG - Intergenic
968470123 4:776841-776863 GTGGCACTAAGGAGATTTGGGGG - Intergenic
970817303 4:20172409-20172431 TTGGCACAATGGACATTAGAAGG + Intergenic
971354095 4:25878910-25878932 TTGGCACTCGTGACATTTTGGGG - Intronic
980250309 4:130306652-130306674 CTGGCATTATTGACATTTGGGGG + Intergenic
982144576 4:152370609-152370631 TTAGCATTATCTACACTTGGAGG + Intronic
987174255 5:15291382-15291404 TTGGCACCATTGACATTAGTGGG + Intergenic
988675899 5:33432854-33432876 TCAGCACTATTGACATTTTGGGG - Intergenic
994406263 5:99349320-99349342 TTCGTTCTATGGACATTTGGAGG - Intergenic
996968805 5:129338357-129338379 TTGGCACTACTGAAATTTTGGGG - Intergenic
1001916231 5:175563173-175563195 TTGGCTCTTTTGGCATTTGGGGG - Intergenic
1009551326 6:65096929-65096951 TTGGCCCTATCAACATTTCTTGG + Intronic
1013750885 6:113404859-113404881 TTGGCACTGTTGACATTTTAGGG + Intergenic
1014189882 6:118483082-118483104 TCGGCACTATTGACATTTGGAGG - Intronic
1014818366 6:125958868-125958890 TTGGCACTTCTGACATTTTGAGG - Intronic
1015572817 6:134639317-134639339 TTGGCACGATTGAAGTTTGGAGG + Intergenic
1020688891 7:11330130-11330152 TTGGCACTATTGACATTTTTGGG + Intergenic
1022282792 7:28927757-28927779 TTGGCACTATGAACATCTGCAGG - Intergenic
1022288368 7:28976950-28976972 TTGGCACTATTGACATTTACGGG + Intergenic
1022331686 7:29385359-29385381 TTGGCACTATTGACCTTTTAGGG + Intronic
1030198531 7:106877404-106877426 TTGGCACTGTTGCCATTTTGGGG - Intronic
1038746343 8:30258484-30258506 TTGGCACTCCTGACATTTGTAGG - Intergenic
1039081087 8:33734621-33734643 TTGGCACCACTGACATTTTGAGG - Intergenic
1039851164 8:41366416-41366438 TTGGCACTAGTGAAGTTTGGGGG + Intergenic
1043424451 8:80134759-80134781 TTGGGGCTGTCGTCATTTGGAGG - Intronic
1043526311 8:81100409-81100431 TTAGCACTCTAGACATTTTGAGG + Intronic
1046257134 8:111715305-111715327 TTGGCACTATTGACATTTTGGGG - Intergenic
1046288142 8:112122737-112122759 TTGTTACTATCTACCTTTGGTGG - Intergenic
1046892384 8:119436964-119436986 ATGGCATTATTGACATTTGGGGG - Intergenic
1050662219 9:7895043-7895065 TTGGCACCATTGACATTTTTGGG + Intergenic
1052569857 9:30206086-30206108 TTGGCACTAGCGAAATTAGTTGG + Intergenic
1052869714 9:33492351-33492373 GTGGCATTATTGACATTTTGGGG - Intergenic
1056697805 9:88874748-88874770 ATGGCACTATTCACTTTTGGGGG + Intergenic
1057688681 9:97262727-97262749 GTGGCATTATTGACATTTTGGGG + Intergenic
1058359561 9:104127760-104127782 TTAGTTCTATCAACATTTGGAGG - Intronic
1061527326 9:131176993-131177015 CTGGCACTACTGACATTTTGGGG - Intronic
1061598391 9:131647840-131647862 TTGGCACTACTGACATTTTGGGG + Intronic
1186486561 X:9938136-9938158 TTGGCACTAGGGACACGTGGGGG - Intronic
1186628822 X:11325951-11325973 TCAGCTCTATTGACATTTGGGGG - Intronic
1188360588 X:29247928-29247950 TTGGCATTTTAGACATTTAGTGG + Intronic
1190230912 X:48581233-48581255 TTGGCTCCTTCGGCATTTGGAGG - Intergenic
1195042768 X:101029282-101029304 TCAGCACTACTGACATTTGGGGG + Intronic
1196056902 X:111365861-111365883 TTGGCACTATTGACATTTTTGGG + Intronic
1196695204 X:118603998-118604020 TTCGCACTATTGACATTTTGAGG + Intronic
1196908958 X:120467278-120467300 TTGGCACCATTGACATTTTCAGG + Intronic
1198957882 X:142151484-142151506 TTGGCTTTCTCTACATTTGGGGG + Intergenic
1200412124 Y:2871058-2871080 CTGGCACTATTGACTTTTAGGGG + Intronic
1201253115 Y:12080657-12080679 CTGGCACTGCTGACATTTGGGGG + Intergenic