ID: 933778550

View in Genome Browser
Species Human (GRCh38)
Location 2:85786507-85786529
Sequence CAGAGGAGCCTGCCACCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933778541_933778550 30 Left 933778541 2:85786454-85786476 CCTAGGGCAGCGCAAGGAAGCTG 0: 1
1: 0
2: 2
3: 18
4: 191
Right 933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 350
933778545_933778550 0 Left 933778545 2:85786484-85786506 CCATTCCAGTGGGACTGAGCCTG 0: 1
1: 0
2: 2
3: 14
4: 208
Right 933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 350
933778546_933778550 -5 Left 933778546 2:85786489-85786511 CCAGTGGGACTGAGCCTGCAGAG 0: 1
1: 0
2: 0
3: 82
4: 961
Right 933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG 0: 1
1: 0
2: 1
3: 34
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933778550 Original CRISPR CAGAGGAGCCTGCCACCCCA GGG Intronic
900138782 1:1130306-1130328 CACAGGAGCCTCCCAGCACACGG - Intergenic
900241466 1:1619516-1619538 CAGATGAGGCGGCCACTCCAGGG + Intronic
900479980 1:2893297-2893319 CACAGGAGACTGCTCCCCCAAGG - Intergenic
901693669 1:10990826-10990848 CCAAAGAGCCTGCCGCCCCAGGG - Intergenic
901815955 1:11793816-11793838 CAGAGCAGCCTGCCTCTCCTGGG - Intronic
902577818 1:17389431-17389453 GAGAGGAGGCAGCCACCCCAGGG - Intronic
903258846 1:22120460-22120482 CACAGGAGCCTGACACCCCGTGG + Exonic
903377652 1:22876697-22876719 CAGGGAAACCTGACACCCCAGGG + Intronic
903950354 1:26993031-26993053 CAGAGGAGCCCCGGACCCCACGG - Intergenic
903995878 1:27305246-27305268 CAGTGGAGCCTGCTAGCGCAGGG + Intronic
904040677 1:27583036-27583058 TACAGGTGCCTGCCACCACATGG + Intronic
904290563 1:29483160-29483182 CCAAGGAGCCTGCCTCCCCGTGG - Intergenic
904385492 1:30139196-30139218 CTGGGGAGCCTTCCACACCATGG + Intergenic
904625861 1:31801739-31801761 CAGAGGACCCAGCCACCCCATGG + Intronic
904716435 1:32471212-32471234 CTGCGGAGACTGCCACCCCTTGG + Exonic
906082368 1:43101786-43101808 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
906132403 1:43468562-43468584 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
907579233 1:55556905-55556927 CAGAGGTGCATGCCCACCCATGG - Intergenic
910347957 1:86262791-86262813 TACAGGTGCATGCCACCCCATGG + Intergenic
911025074 1:93427305-93427327 CAGAGGAGGCTCCCCCTCCAAGG + Intergenic
913218288 1:116638860-116638882 CAGATGAGTATGGCACCCCAAGG + Intronic
914392713 1:147236724-147236746 GAGAGGAGCTACCCACCCCAGGG - Intronic
915898701 1:159830908-159830930 CAGCTGGGCCTGCCAACCCACGG - Intronic
916444266 1:164857352-164857374 CACAGGAGCCTCTAACCCCATGG + Intronic
917789085 1:178488054-178488076 CAGAGGAGCCTGCAATTCCGAGG + Intergenic
917793084 1:178512383-178512405 CAGAGGAACATGGCACCCCATGG - Intergenic
920952372 1:210584582-210584604 CAGAAAAGCCTGACAGCCCAGGG - Intronic
921046127 1:211479181-211479203 CAGTGGAGCCTGCGGCCCCGCGG - Exonic
921372089 1:214434371-214434393 CAGAGGACACTGCCAGCCCTGGG - Intronic
923199197 1:231695038-231695060 CAGAGGAGCCTGCGGCCCAATGG - Intronic
1063469540 10:6273342-6273364 CCGAGGAGCTTGCCACCCGTGGG + Intergenic
1065407901 10:25389300-25389322 GAGAGGAGCTGCCCACCCCAGGG + Intronic
1065428677 10:25631654-25631676 CAGAGGAGGCTGCCAGCCATTGG - Intergenic
1066526259 10:36283109-36283131 CAAAGGACCCTGCCCTCCCAGGG + Intergenic
1067431671 10:46249639-46249661 CAGAGGAGCCTGACCCTCCCAGG + Intergenic
1067440840 10:46308494-46308516 CTGAGCAGCCTGCCTTCCCACGG + Intronic
1067441749 10:46312535-46312557 CAGAGGAGCCTGACCCTCCCAGG - Intronic
1069829984 10:71277182-71277204 CAGAGGCGGCTGTCACCCCGGGG + Intronic
1069939901 10:71948228-71948250 CAGGGGTGCCTGGCACCCCCTGG + Intergenic
1071464302 10:85925492-85925514 CACAGCCACCTGCCACCCCAGGG - Intronic
1072564728 10:96608026-96608048 CAGATGAGCCAGCCAACCCTGGG + Intronic
1073972594 10:109061382-109061404 TGGGGGTGCCTGCCACCCCAAGG - Intergenic
1074299764 10:112223112-112223134 CAGAGGAGCCTCAGACCACAGGG - Intergenic
1074545348 10:114398060-114398082 AGGAGGAGCCTGCCTCCCCCTGG - Intronic
1075426680 10:122347150-122347172 CAGAGGAGCTTTCTGCCCCAAGG - Intergenic
1076348751 10:129800128-129800150 CAGAGCTGCCTGCAGCCCCACGG + Intergenic
1076421906 10:130337883-130337905 CACAGGTGCCGGCCACTCCAAGG + Intergenic
1077409551 11:2397120-2397142 CAGAGCACCCTGGGACCCCAGGG - Exonic
1078086693 11:8237724-8237746 CTGAGCTGACTGCCACCCCATGG - Intronic
1078580055 11:12532729-12532751 ATGAGAAGCCTGCCACTCCAGGG + Intergenic
1078929276 11:15901079-15901101 CGGAGAAGCCCTCCACCCCAAGG + Intergenic
1079076440 11:17388017-17388039 CAGAGGACCCTGCCAAGCCCAGG - Exonic
1079184076 11:18220908-18220930 GAGAGGAGCCACCCACTCCAGGG - Intronic
1080115165 11:28614109-28614131 CAGAAGAGGCTGCCTCCACATGG - Intergenic
1080583935 11:33665337-33665359 GAGAGGAGCCACCCTCCCCAGGG - Intronic
1083491779 11:63019230-63019252 GAGAGGGACCTGCCAACCCAGGG + Intergenic
1084212247 11:67629649-67629671 CAGAGGTCCCTGCCAGCCCCGGG + Intronic
1084338304 11:68475495-68475517 CAGAGGTGCCCGCCACCTCCCGG + Intronic
1084356067 11:68639500-68639522 CAGTGCAGCCTGGAACCCCAGGG - Intergenic
1084403228 11:68956663-68956685 CAGGGGAGGCTGCCAGGCCAGGG + Intergenic
1085526137 11:77165366-77165388 CAGAGGAGGCTGCCACTCACAGG - Intronic
1085818067 11:79762496-79762518 CAGAGGAGCCTGCGATGTCAGGG - Intergenic
1088668938 11:112122347-112122369 CAAAGGAGCCTGCAAGCCTAAGG + Intronic
1088738165 11:112745679-112745701 CAGAGGATCCTGACAGCCCACGG + Intergenic
1089709502 11:120305041-120305063 AAGAGGATCCTGGCAGCCCAGGG - Exonic
1090137007 11:124209564-124209586 GAGAGGAGCTGACCACCCCAGGG - Intergenic
1092259573 12:6945866-6945888 CCCATGACCCTGCCACCCCATGG + Exonic
1092284374 12:7120379-7120401 CAGAGAACCCTGCCTGCCCAGGG - Intergenic
1092503015 12:9065949-9065971 GAGAGGAGCCAGCCACTCCAGGG + Intergenic
1094843949 12:34353320-34353342 CAGGGGACCCTGCGCCCCCAAGG - Intergenic
1095145462 12:38721399-38721421 GAGAGGAGCTTCCCACTCCAGGG + Intronic
1095784564 12:46095116-46095138 TAGAAAAGCCTGCCAACCCATGG + Intergenic
1096157207 12:49347314-49347336 CTGAGGAGCCTCCCAATCCAGGG - Exonic
1096240867 12:49959704-49959726 CAAAGGAGCCTGGCCCCCAATGG + Intergenic
1097298932 12:57997779-57997801 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
1097339335 12:58419402-58419424 CCGGGGTGCCTGCGACCCCAAGG - Intergenic
1099856827 12:88178592-88178614 CAGATGTTCCTGCTACCCCAAGG - Intronic
1102588006 12:113936629-113936651 CAGAGGGCACTGCCACTCCAAGG + Intronic
1103624329 12:122206725-122206747 GAGCGGATCCTGCCACCCCTAGG - Exonic
1103712698 12:122924683-122924705 AAGAGGAGCACGGCACCCCAGGG - Intronic
1104746654 12:131215141-131215163 CAGAGGAGCCCCGCACCCCTGGG + Intergenic
1104785905 12:131447773-131447795 CAGAGGAGCCCTGCACCCCTGGG - Intergenic
1106627821 13:31438741-31438763 CAGCGGAGCCTGGCACCCATGGG + Intergenic
1107283408 13:38762286-38762308 CTGAGGAGCCTCCTAGCCCATGG + Intronic
1108016979 13:46086461-46086483 GAGAGGAGCCACCCACTCCAGGG - Intronic
1108105330 13:47002335-47002357 CAGAAGAGGCTCCCTCCCCAGGG - Intergenic
1110670215 13:78169018-78169040 TAGAGGAGCTTCCCACTCCAGGG - Intergenic
1110939481 13:81331023-81331045 GAGAGGAGCCACCCACTCCAGGG + Intergenic
1111123232 13:83880602-83880624 AAGAGGATCATGCCACACCAGGG - Exonic
1111512631 13:89287026-89287048 GAGAGGAGCCACCCACTCCAGGG - Intergenic
1111702838 13:91712643-91712665 CAGAAAAGCTTTCCACCCCACGG + Intronic
1112520600 13:100091467-100091489 CAGAGATGCTTCCCACCCCAAGG - Intronic
1112576268 13:100639469-100639491 CACATGAACCTGCCACCCCTTGG - Intronic
1113461584 13:110485779-110485801 CAGGGGGGCCAGCCACCCCAGGG - Exonic
1113480525 13:110616443-110616465 CAGGTGAGCCTCCCTCCCCAAGG - Intronic
1113617293 13:111689763-111689785 AAGAGGGGCCTCCCGCCCCAGGG - Intergenic
1113622822 13:111775033-111775055 AAGAGGGGCCTCCCGCCCCAGGG - Intergenic
1113924205 13:113931141-113931163 CAGACGTGACTGGCACCCCAGGG + Intergenic
1113936218 13:113996376-113996398 CCCAGGAGCCTCCCACCCGAGGG - Intronic
1114349547 14:21835431-21835453 GAGAGGAGCTACCCACCCCAGGG - Intergenic
1114680846 14:24482371-24482393 CAGAGGGGCCTGGCACTGCAGGG + Intergenic
1115622267 14:35152512-35152534 CAGAGGTGCCTCCCACCTCCCGG + Intronic
1116131445 14:40859569-40859591 GAGAGGAGCCTTCCACTCTAGGG + Intergenic
1118200074 14:63663490-63663512 GAGAGGAGCTACCCACCCCAGGG - Intergenic
1118213505 14:63787633-63787655 GAGAGGAGCCACCCACTCCAGGG - Intergenic
1118451352 14:65905343-65905365 CACAGGAGGCTGCCTCACCAAGG + Intergenic
1118725505 14:68625946-68625968 CCCAGGAGCCAGCCACACCATGG - Intronic
1118747154 14:68782567-68782589 CAGTAGATCCAGCCACCCCAAGG - Intergenic
1118795069 14:69135617-69135639 AAGATGAGCCTGTCACCTCAAGG + Intronic
1120405746 14:84091481-84091503 GAGAGGAGCTGCCCACCCCAAGG + Intergenic
1121273415 14:92652277-92652299 CAGCTCAGCCTGCCTCCCCAAGG + Exonic
1121576642 14:94994305-94994327 AAGAGAAGTCTGCCACCCCTGGG - Intergenic
1122924640 14:104894025-104894047 CAGAGGAGCCAGCGCCTCCAGGG + Intronic
1123058923 14:105585713-105585735 CAGAGAAGCCCTCCAGCCCATGG - Intergenic
1123073062 14:105651511-105651533 CAGAGGAGCCAGCCCCACCGAGG - Intergenic
1123083251 14:105705944-105705966 CAGAGAAGCCCTCCAGCCCATGG - Intergenic
1123107481 14:105849478-105849500 CAGAGGAGCCAGCCCCGCCAAGG + Intergenic
1124237709 15:28004222-28004244 CAGGGGATGCTCCCACCCCAGGG - Intronic
1124436331 15:29652238-29652260 GAGAGGGGCCACCCACCCCAGGG + Intergenic
1124515365 15:30362909-30362931 CAGTGGAGGCTGCTACCCCCAGG - Intronic
1124727557 15:32167820-32167842 CAGTGGAGGCTGCTACCCCCAGG + Intronic
1124820896 15:33044652-33044674 GAGAGGAGCTACCCACCCCAGGG + Intronic
1125085230 15:35721896-35721918 CAGTGGCACCTGCCACCACATGG - Intergenic
1125348125 15:38740349-38740371 CAGAGGCTCCTGTCCCCCCATGG + Intergenic
1125504001 15:40256458-40256480 CAGAGGACCCTGTCACCTCCAGG - Intronic
1125752401 15:42037387-42037409 GAGAGGAGCTTCCCACTCCAGGG + Intronic
1127525877 15:59791798-59791820 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
1127525888 15:59791869-59791891 GAGAGGAGCCACCCACTCCAGGG - Intergenic
1127974499 15:63987216-63987238 CAGAGGGCCCAGCCAACCCAAGG + Intronic
1128489862 15:68134923-68134945 CAGAGGCGCCCCCCACCCCCCGG + Intronic
1128490099 15:68135447-68135469 CAGAGGCGCCCCCCACCCCCCGG + Intronic
1128784849 15:70387303-70387325 CTGCGGCTCCTGCCACCCCAGGG + Intergenic
1129194145 15:73954239-73954261 CAGAGGAGGCTTTCACCCAAAGG + Intergenic
1129691869 15:77718349-77718371 CAGAGGAGCATGCCCACGCATGG + Intronic
1130696543 15:86137283-86137305 CACAGGGTCCTGCCACCCCATGG - Intergenic
1132540331 16:505460-505482 CAGAAGGGCCTGCACCCCCAAGG - Intronic
1133098120 16:3461367-3461389 GAGAGGTGCCAGTCACCCCAAGG + Intronic
1134231817 16:12435767-12435789 CAGCAGAGCCAGCCACTCCATGG + Intronic
1134365936 16:13579269-13579291 TAGGGGTGCCTGCAACCCCAAGG + Intergenic
1135434135 16:22413963-22413985 CAAGGGAGGCTGGCACCCCAAGG - Intronic
1135821991 16:25692761-25692783 CAGAGCAGCCAGCCGCCCCCGGG + Exonic
1136867482 16:33769155-33769177 GAGAGGAGCCTGGAGCCCCAAGG + Intergenic
1137232932 16:46585267-46585289 CTGAGGAGCCTGCCACTTCTGGG + Intronic
1138099999 16:54244676-54244698 CAGAGGAGCGTGACAGCCCGGGG - Intergenic
1138565680 16:57831177-57831199 CAGGTGAGCCTGCCCCGCCATGG + Intronic
1138574887 16:57901259-57901281 GAGGGGTGCCTGCCAGCCCAGGG - Intronic
1139366628 16:66437636-66437658 CAGCGGAGCCAGCCTGCCCACGG - Exonic
1139625802 16:68187662-68187684 GAGAGGAGCTACCCACCCCAGGG - Intronic
1139740749 16:69033043-69033065 TACAGGTGCCTGCCACCACACGG - Intronic
1139964414 16:70737554-70737576 GTGAGGAGCCTGCCAGCCCCTGG + Intronic
1140959118 16:79895657-79895679 CAGGGGATGCTGCCAGCCCAGGG + Intergenic
1141608438 16:85168764-85168786 CGGAGGAACCCCCCACCCCAGGG - Intergenic
1141629091 16:85277125-85277147 CAGAGGCCCCTGAGACCCCACGG + Intergenic
1141856191 16:86682948-86682970 CAGTGGGGCCTGGCACCCCACGG - Intergenic
1142269066 16:89079702-89079724 CAGACGGGCCCGCCAGCCCAAGG - Intergenic
1203104676 16_KI270728v1_random:1347048-1347070 GAGAGGAGCCTGGAGCCCCAAGG - Intergenic
1203128838 16_KI270728v1_random:1615320-1615342 GAGAGGAGCCTGGAGCCCCAAGG + Intergenic
1142872338 17:2828943-2828965 GACAGGAACCTGCCCCCCCAGGG - Intronic
1143067939 17:4264343-4264365 CAGAGCATCCTACCTCCCCAGGG - Intergenic
1144518400 17:15937163-15937185 AATTGGATCCTGCCACCCCAGGG + Intergenic
1144632778 17:16882443-16882465 CACTGGGGCCTGCCACCCCGAGG - Intergenic
1145812847 17:27774864-27774886 CTGAGGAGGCTACAACCCCATGG - Intronic
1146380542 17:32324012-32324034 CTGAGGTGGCTGCCAGCCCAGGG + Exonic
1146698011 17:34926291-34926313 TACAGGAGCCTGCCACCGCCTGG - Intergenic
1146745258 17:35323345-35323367 TAGGGGTGCCTGCAACCCCAAGG + Intergenic
1146842947 17:36167543-36167565 CAGGGGGACCTGCCACCCCCAGG - Exonic
1146855252 17:36255484-36255506 CAGGGGGACCTGCCACCCCCAGG - Exonic
1146865368 17:36332891-36332913 CAGGGGGACCTGCCACCCCCAGG + Exonic
1146871158 17:36379395-36379417 CAGGGGGACCTGCCACCCCCAGG - Exonic
1146882466 17:36451623-36451645 CAGGGGGACCTGCCACCCCCAGG - Intergenic
1147079760 17:38013040-38013062 CAGGGGGACCTGCCACCCCCAGG + Intronic
1147253004 17:39164973-39164995 CAGAGGAGCCCGGGAACCCAGGG + Intronic
1147355683 17:39894506-39894528 TACAGGTGCCTGCCACCACATGG + Intergenic
1147875008 17:43614882-43614904 CAGAGGCACCTGGCTCCCCAGGG - Intergenic
1148124106 17:45228165-45228187 CCGAGGAGCCAGGCACTCCAGGG - Intronic
1148341533 17:46876280-46876302 CACAGGAGCCTGATACGCCATGG - Exonic
1148386260 17:47237301-47237323 CAGAGGAGCTGCCCACCCCAGGG - Intergenic
1148747260 17:49925664-49925686 CAGAGGAGCCAGACACCCAGTGG + Intergenic
1148860827 17:50603570-50603592 AAGAGGAGCCTGTCACCTCACGG - Intronic
1148870811 17:50657987-50658009 CAGAGGAGACTGATGCCCCAAGG + Intronic
1149127689 17:53255025-53255047 GAGAGGAGGCTGGCAGCCCAGGG + Intergenic
1149547076 17:57511557-57511579 GAGAGAAACCTGCCTCCCCAGGG - Intronic
1149555078 17:57567799-57567821 CAGAGAAGCCTGCTAGGCCAAGG - Intronic
1149846111 17:60010029-60010051 CAGGGGGACCTGCCACCCCCAGG - Intergenic
1150084460 17:62266609-62266631 CAGGGGGACCTGCCACCCCCAGG - Intergenic
1151657049 17:75500999-75501021 AAGAGGCCCCTGCCACCCTAGGG - Exonic
1155637738 18:27975568-27975590 GTGGGGTGCCTGCCACCCCAAGG + Intronic
1155830841 18:30513542-30513564 GAGAGGAGCCACCCACCCCAGGG - Intergenic
1155830858 18:30513649-30513671 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
1156450160 18:37262313-37262335 CAGCAGATCCTGCCACCCCAAGG + Intronic
1157042863 18:44060920-44060942 GAGAGGAGCTACCCACCCCAGGG - Intergenic
1157570536 18:48709475-48709497 CCGAGGAGGCTGGCACCCCCTGG + Intronic
1157802498 18:50632188-50632210 AAGAGGAGGCCGCCGCCCCAGGG - Intronic
1158873527 18:61711258-61711280 CACAGAAGCCTGCCATCCCTAGG - Intergenic
1160980779 19:1815725-1815747 CAGAGGTGCCGGCCACCACCCGG + Exonic
1161090658 19:2358369-2358391 GAGAAGAGCCTGTGACCCCATGG - Intergenic
1161136048 19:2620420-2620442 CCGGGAAACCTGCCACCCCAGGG + Intronic
1161160007 19:2756683-2756705 CAGGGGAGCCTCCCACCCCTGGG + Intronic
1161320512 19:3638643-3638665 TGGAGGAGCTTCCCACCCCATGG + Intronic
1161588496 19:5118162-5118184 CAGATGAGCCTGCCCCACCTTGG + Intronic
1162180297 19:8864302-8864324 CACAGGAGACAACCACCCCAGGG - Intronic
1162693216 19:12450708-12450730 CAGGGCAGCCTTCCACCCCTTGG - Intronic
1162833473 19:13301373-13301395 CAGAAGAGCCTGGCATCCGATGG + Intronic
1163374283 19:16920982-16921004 CAGAGGCCCCGCCCACCCCAGGG - Intronic
1163479550 19:17546821-17546843 CAGAGGAGCCTGGCGTCCCTTGG + Intronic
1164207551 19:23070963-23070985 CAGGGGAGCCCCCCAACCCAAGG + Intergenic
1165642630 19:37403180-37403202 AGGAGGAGCCTCCCACCCCTGGG + Intergenic
1165852963 19:38861332-38861354 TACAGGTTCCTGCCACCCCATGG + Intergenic
1167805267 19:51778794-51778816 CACAGGAACATGCCACCACACGG + Intronic
1168018885 19:53594694-53594716 CAGAGGGGCTTGCCACCTCCTGG - Intergenic
925087235 2:1117694-1117716 CAGAGGTTCCTGCCTCCCCAGGG + Intronic
925178928 2:1804046-1804068 CAGAGGCCCCAGCAACCCCAGGG - Intronic
925515338 2:4674934-4674956 GAGAGGAGCCACCCACCGCAGGG + Intergenic
926075317 2:9938123-9938145 CAGAGGCCCCCGCCACCCCCAGG + Intergenic
926625481 2:15086257-15086279 GAGAGGAGCTTCCCACTCCAGGG + Intergenic
927850704 2:26497241-26497263 TATAGGCGCCTGCCACCGCACGG + Intronic
928723590 2:34147387-34147409 GAGAGGAGCCACCCACTCCAGGG - Intergenic
929492497 2:42408533-42408555 AAGAGGAGCTTCCCACCCCAGGG + Intronic
930004868 2:46888670-46888692 CAGCGGAGACGGCCACCCCAGGG - Intergenic
930018048 2:46984357-46984379 CAGAGTGGCCTCCAACCCCAGGG - Intronic
931500111 2:62855888-62855910 AAGAGGAGCAAGCCACTCCACGG + Intronic
931864951 2:66399550-66399572 CTGACCAGCCTGCCACCCCTGGG + Intergenic
933093341 2:78147053-78147075 GAGAGGAGCTTACCACTCCAGGG + Intergenic
933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG + Intronic
934615415 2:95767769-95767791 CAGAGGGGCCGGCCACCCAGAGG - Intergenic
934645487 2:96056789-96056811 CAGAGGGGCCGGCCACCCAGAGG + Intergenic
934838891 2:97612878-97612900 CAGAGGGGCCAGCCACCCAGAGG + Intergenic
934919858 2:98334165-98334187 CAGAGAAGCCCTCCTCCCCAGGG + Intronic
935518719 2:104078085-104078107 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
935559694 2:104547449-104547471 CACAGGAGGCTGCCAGCCCAGGG + Intergenic
935698187 2:105787679-105787701 CAGTGCACCCTGACACCCCATGG - Intronic
936462980 2:112725368-112725390 CCGAAGAGCCTGCCCCACCAAGG - Exonic
937543770 2:122989748-122989770 GAGAGAAGCCTCCCACTCCAGGG + Intergenic
937907636 2:127060035-127060057 CACAGGAGCCAGTTACCCCATGG - Intronic
937927896 2:127182056-127182078 CAGAGGAGCCTGAGAGCCTAGGG + Intergenic
938828876 2:135033450-135033472 CAGAGGCGCCCCCCACCCCCCGG + Intronic
938828962 2:135033654-135033676 CAGAGGCGCCCCCCACCCCCCGG + Intronic
941273592 2:163461489-163461511 CAGGGGAGCCTGGCACTTCATGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946121134 2:217515840-217515862 CAGGAGAGCCTGCCAGCCAAGGG - Intronic
946434317 2:219641801-219641823 CTGAGGAGCCCCCCAGCCCAGGG - Exonic
948280928 2:236747622-236747644 CTGAGGGGCCTCCCATCCCACGG - Intergenic
949008586 2:241665607-241665629 CAGAGGACACTGCCACCCAGAGG - Intronic
1168794047 20:599307-599329 TACAGGCGCCTGCCACCACAGGG + Intergenic
1169923159 20:10756674-10756696 TACAGGTGCCTGCCACCACACGG - Intergenic
1170417617 20:16161251-16161273 CAGAGATGCCTGTGACCCCAGGG - Intergenic
1172182408 20:33011419-33011441 CAGAGGGTCCTGCCAGCCCTGGG - Intronic
1172937335 20:38629594-38629616 CAGAGGAGCAGGCCATCCCGGGG + Exonic
1173884522 20:46445716-46445738 AAGAGGAGCTTCCCACTCCAGGG - Intergenic
1175283522 20:57821099-57821121 CAGAGCAGCCTCCCAGCCCCAGG - Intergenic
1175867910 20:62191207-62191229 CTGAGGAACCTTCCAGCCCAAGG + Intronic
1175872436 20:62214798-62214820 AAGACCAGCCTGCCACACCAGGG - Intergenic
1175997956 20:62819791-62819813 GAGAGGAGGCTGCCACCCTAAGG + Intronic
1176088981 20:63310569-63310591 CCTTGGAGCCTGACACCCCAGGG + Intronic
1177736145 21:25092631-25092653 CCCTGGAGCCTGCCACCCTAGGG - Intergenic
1179967366 21:44815297-44815319 CAGAGCACCATGCCTCCCCAGGG - Intronic
1180029982 21:45200329-45200351 CATGGGAGCCTCTCACCCCATGG - Intronic
1180178886 21:46109053-46109075 GAGAGGAGCCACCCACTCCAGGG - Intronic
1180593381 22:16958736-16958758 CAAAGGAGCCTGCCAGCACGAGG + Intergenic
1180982323 22:19884686-19884708 AAGAGGAGCCAGCCACACCCTGG + Intronic
1181597835 22:23928726-23928748 CAGGGCAGCCTTCCACCCTATGG - Intergenic
1182044368 22:27262728-27262750 CTGAGGAGGCTGCCTCCCAAAGG + Intergenic
1182147482 22:28005605-28005627 CAGAGGGGCCTGCCCAGCCACGG + Intronic
1183024941 22:35058040-35058062 AAGAGGAGCTACCCACCCCAAGG - Intergenic
1183440799 22:37822225-37822247 CAGAAGAGCCTGCCACCTGGGGG + Intergenic
1183743684 22:39681583-39681605 CAGAGCAGGAAGCCACCCCAGGG + Intronic
1184417324 22:44359872-44359894 GAGAGGAGCCATCCTCCCCATGG + Intergenic
950452482 3:13073146-13073168 TGGAGGAGCCCGCCACCCCCGGG - Intergenic
952901941 3:38116584-38116606 CAGAGGAGGCAGCCACCCTCAGG - Exonic
954132639 3:48568254-48568276 CAGAGGTGACTCCCACCCCATGG - Intronic
954811318 3:53250107-53250129 CAGAGAACCAAGCCACCCCAGGG + Intronic
955748165 3:62160548-62160570 CAGAGGAGCCGGACAACACATGG + Intronic
958807920 3:98834047-98834069 CAGAGGAGCCTCCCCCACCCAGG - Intronic
958973352 3:100638019-100638041 GAGGGGTGCCTGCAACCCCAAGG + Intronic
961520964 3:127467209-127467231 CAGTGGAGCCAGCCACTCCTGGG + Intergenic
961634498 3:128324361-128324383 CAGAGAAGCCCCCCACTCCATGG - Intronic
961942939 3:130656426-130656448 GAGAGGAGCTACCCACCCCAGGG - Intronic
962317157 3:134366049-134366071 CAGAGGAGGCTCCCACCCATGGG - Intronic
963202865 3:142602372-142602394 CAGTGGATCCTGACACCCCAGGG - Intronic
963641994 3:147872472-147872494 CAGAAGAGTCTGCCACATCAGGG + Intergenic
963925165 3:150943796-150943818 TAGGGGTGCCTGCAACCCCAGGG - Intronic
966785546 3:183619770-183619792 CAGACTAGCCTGCCATCCCAAGG + Intergenic
966931483 3:184678430-184678452 CAGAGAAGCTTGGCACCCCAGGG - Intronic
967649841 3:191973263-191973285 GAGAGGAGCCACCCACCACATGG - Intergenic
967649848 3:191973300-191973322 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
968602646 4:1517648-1517670 CAGATGAGCCCCCCACCCCCTGG + Intergenic
968667364 4:1828763-1828785 CAGAGGCGCCCCCCACCCCCCGG + Intronic
971740965 4:30520610-30520632 CAGATGATCCTCCCACCTCAGGG - Intergenic
973041193 4:45472142-45472164 AAGAGGAGCCATCCACCCCAGGG + Intergenic
975718523 4:77228340-77228362 GAGTTGAGCCTGCCATCCCAAGG - Intronic
978219702 4:106256013-106256035 GAGAGGAGCTACCCACCCCAGGG - Intronic
979214297 4:118144319-118144341 CACAGGCACCTGCCACCACACGG + Intronic
982498960 4:156130414-156130436 CAGAGGAGCCTCCCCACCCAGGG + Intergenic
985073740 4:186192138-186192160 GAGAGGAGCCTGTCACCCTGTGG + Intronic
986598758 5:9450139-9450161 CAGTGGAGACAGCCGCCCCAAGG - Intronic
987999617 5:25331287-25331309 GAGAGGAGCTGCCCACCCCAGGG + Intergenic
988838891 5:35063823-35063845 CAGAGGAGCCTGAAACTCAAAGG + Exonic
994851287 5:105057627-105057649 GAGAGGAGCTTCCCACTCCAGGG + Intergenic
995450067 5:112290806-112290828 CAAAGGAGCAAGCCAGCCCAGGG + Intronic
996912452 5:128670691-128670713 CCCAGGAGCCTGCCTCCCCCAGG - Intronic
997787673 5:136728547-136728569 CAGACAAGCCTGCCACCCTGGGG - Intergenic
997960480 5:138316768-138316790 GAGAGGAGCCACCCACTCCAGGG + Intronic
1001602101 5:172935445-172935467 CACAGGAGGCTTCGACCCCAAGG + Intronic
1001994766 5:176147765-176147787 CAGAGCAGCCTGCCAGCCAAGGG + Intergenic
1002427672 5:179185712-179185734 CCTAGCAGCCTGACACCCCAGGG - Intronic
1002722552 5:181271999-181272021 CAGAAGGGCCTGCCAGCCGAGGG - Intergenic
1003610905 6:7614365-7614387 CACAGGACCCTGCGTCCCCATGG + Intergenic
1006092743 6:31637531-31637553 CAGAGGAGCCTGGGTCCCGAGGG + Exonic
1006728059 6:36214256-36214278 CAGGAGAGCCTGCCACACCATGG - Exonic
1007405153 6:41631179-41631201 CCAAGGAGCCTGCCCTCCCAGGG - Intergenic
1007649981 6:43413245-43413267 GAGAGGAGCTTCCCACTCCAGGG + Intergenic
1009033755 6:58092082-58092104 CAAAGCTGCCTGCCACCCAACGG + Intergenic
1010153156 6:72760060-72760082 CAGAGGAGCGTGCCATCCTGGGG - Intronic
1010295914 6:74195226-74195248 CAGAGGAACCTCCCCACCCAGGG - Intergenic
1012752801 6:103184427-103184449 GAGAGGAGCTAGCAACCCCAGGG + Intergenic
1013268857 6:108527259-108527281 CAGAGGAGCCTTGGTCCCCAGGG - Intergenic
1016200045 6:141395303-141395325 AAGAGGAGCTTCCCACTCCAGGG + Intergenic
1018245226 6:161816146-161816168 CTGAGCAGCCTGCCGCCACATGG - Intronic
1021021097 7:15599708-15599730 GAGAGGAGCTTTCCACTCCAGGG - Intergenic
1022263419 7:28729563-28729585 CAGAGGAGCCTGGCTCCAGATGG + Intronic
1022487182 7:30788639-30788661 CAGTTGAGCCTGTCACCTCAAGG - Intronic
1025855103 7:65269591-65269613 CAGCGGAACCGGCCTCCCCACGG + Intergenic
1026008078 7:66614904-66614926 CAGAGGCGCCCGCCACCTCCCGG - Intergenic
1026067642 7:67089290-67089312 CAGAGGAGCCTGGGTCCCGAGGG - Intronic
1026327143 7:69320584-69320606 AAGAGGAGCCTCTCAACCCATGG + Intergenic
1026709282 7:72723041-72723063 CAGAGGAGCCTGGGTCCCAAGGG + Intronic
1027045380 7:74987630-74987652 GAGAGGGGCCTGACTCCCCACGG - Intronic
1028136905 7:87231469-87231491 AAGAGCAGCCTGCCAGGCCAAGG + Intergenic
1029327671 7:99823753-99823775 GAGAGGAGCCTCCCAACCCAGGG + Intergenic
1029452460 7:100648765-100648787 CAGTGGAGCCACCCACACCACGG - Exonic
1029481241 7:100814201-100814223 CAGAGGAGCCTGCTGGCCCCTGG - Intronic
1031836488 7:126686060-126686082 GAGAGGAGCTGCCCACCCCAGGG + Intronic
1035830700 8:2691506-2691528 CAGAGGACGCAGCCACCCCCAGG + Intergenic
1037040606 8:14227172-14227194 GAGACCAGCCTGCCACTCCAGGG - Intronic
1038428293 8:27479616-27479638 CAGAGCTGCCAGCCAGCCCACGG + Intronic
1038441208 8:27572033-27572055 CAGAGGAGCCAGCCTGCCCTTGG + Intergenic
1043758327 8:84031886-84031908 GAGAGGAGCTACCCACCCCAGGG + Intergenic
1045462446 8:102437734-102437756 TATAGGAGCCTGCCACCACTGGG + Intergenic
1046014598 8:108590182-108590204 CAGGGGCGCCTGGAACCCCAGGG + Intergenic
1046601808 8:116325965-116325987 CAGAGGAGCTTGCTTCCACAAGG - Intergenic
1047582825 8:126235502-126235524 CAGAGGCACTTGCCACCACAAGG + Intergenic
1049273719 8:141709331-141709353 CAGAGCAGCGTCCCACCCCCAGG + Intergenic
1049407766 8:142459297-142459319 CAGGGGATCCTCCCAACCCAGGG + Intronic
1049451451 8:142664283-142664305 CACAGGACCATGCCACTCCAGGG + Intronic
1050318323 9:4425758-4425780 CAGGGTAGCCTGCAATCCCAGGG + Intergenic
1052816628 9:33107048-33107070 CAGAGGAACATGACACCCCAAGG - Intronic
1052921368 9:33972929-33972951 CAGGAGATCCTACCACCCCATGG + Intronic
1053097135 9:35338442-35338464 CTGAGGAGCATGCCATCCTAGGG - Intronic
1053392318 9:37744734-37744756 CAGAGGAGCCAGCAGCCCCAAGG - Exonic
1053407640 9:37891270-37891292 CAGAGGCGCCTCCCACCTCCCGG - Intronic
1054916244 9:70497715-70497737 CAGAGGAGGCTGGGAACCCAGGG - Intergenic
1055230464 9:74058053-74058075 GAGAGGAGCCACCCACTCCAGGG + Intergenic
1055688972 9:78809381-78809403 TACAGGCGCCTGCCACCACACGG + Intergenic
1056790202 9:89620314-89620336 CAGAGGAGCCCTCCACTCCATGG + Intergenic
1057305867 9:93911633-93911655 CAGAAGAGCCTGCCGCCAGATGG + Intergenic
1057531235 9:95848054-95848076 CAGAGGAGCCACCCTCTCCAGGG + Intergenic
1057793998 9:98142885-98142907 CAGAGCAATCTGCCAGCCCAGGG - Intronic
1059246094 9:112850795-112850817 CAAAGGGGCCTCCCACCCCCAGG - Intronic
1059320521 9:113464844-113464866 CAGAAGAGCCAGGAACCCCAGGG - Intronic
1059389202 9:113988252-113988274 CACAGGAGCCCACCAGCCCATGG - Intronic
1059396601 9:114038082-114038104 CCGAGGATCCTGCTTCCCCATGG - Intronic
1061060213 9:128246499-128246521 CAGAGGTGCCTGCCTGCCCCTGG + Exonic
1061452925 9:130678333-130678355 CAGAGGGGCTCGACACCCCAGGG + Intronic
1061591797 9:131602749-131602771 AAGAGGGGACTGGCACCCCAGGG - Intronic
1062031102 9:134362347-134362369 GAGATGCCCCTGCCACCCCAGGG - Intronic
1062160424 9:135076602-135076624 CGGAAGAGCCTGCCAGCCGAGGG + Intronic
1062197901 9:135284829-135284851 CAGAGAAGCCTGCCTCCCTGGGG + Intergenic
1187391816 X:18891080-18891102 GAGAGGAGCCTGGCAGCCCCTGG - Intergenic
1188182741 X:27075617-27075639 TGGAGGTGCCTGCGACCCCAAGG - Intergenic
1188213858 X:27454383-27454405 CTCAGGAGCCTTCCTCCCCAAGG + Intergenic
1188859819 X:35243774-35243796 GAGAGGAGCTTCCCACTCCAGGG - Intergenic
1189083623 X:37998028-37998050 GAGAGGAGCTTCCCACTCCAAGG + Intronic
1190356038 X:49605766-49605788 CACAGGCGCGTGCCACCACAAGG - Intronic
1192224138 X:69216922-69216944 GAGAGACCCCTGCCACCCCAAGG + Intergenic
1193467622 X:81868067-81868089 GAGAGGAGCCACCCACTCCAGGG - Intergenic
1195067544 X:101250981-101251003 CAGAACAGCCAGCCACACCATGG - Exonic
1195346471 X:103954872-103954894 CAGAGGTGCCTGCCTCCCTGTGG - Intronic
1195360977 X:104083964-104083986 CAGAGGTGCCTGCCTCCCTGTGG + Intergenic
1195857529 X:109347332-109347354 CAGAAGAGCTTGCCACATCAGGG + Intergenic
1195906671 X:109851118-109851140 CTGGGGAGCTTGCCACCCCAAGG - Intergenic
1196979578 X:121196916-121196938 CAGAAGAGCCCCCCAGCCCATGG + Intergenic
1197378438 X:125710065-125710087 GAGAGGAGCTACCCACCCCAGGG + Intergenic
1197505971 X:127305926-127305948 CAGTGGAGCCTGGAACCCCAGGG + Intergenic
1198828141 X:140720113-140720135 CAGATTAGTCTGCCAACCCATGG + Intergenic
1199811615 X:151355532-151355554 CAAGGGAGCTTGCCACCCCCTGG - Intergenic
1200365438 X:155657631-155657653 CAGTGGCGCCTGGAACCCCAGGG - Intronic