ID: 933780087

View in Genome Browser
Species Human (GRCh38)
Location 2:85795307-85795329
Sequence GGAGCTTTATCCAGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933780087_933780095 27 Left 933780087 2:85795307-85795329 CCTTCAAATCTGGATAAAGCTCC No data
Right 933780095 2:85795357-85795379 AACTAAAGCTGCTTTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933780087 Original CRISPR GGAGCTTTATCCAGATTTGA AGG (reversed) Intergenic