ID: 933786331

View in Genome Browser
Species Human (GRCh38)
Location 2:85845606-85845628
Sequence GGATTGACACAACTGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933786323_933786331 29 Left 933786323 2:85845554-85845576 CCATGCAGAGTGTACAGCTGTAC 0: 1
1: 0
2: 0
3: 8
4: 118
Right 933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933786331 Original CRISPR GGATTGACACAACTGCAGCA GGG Intronic
902281831 1:15380344-15380366 TGATTGTCACAACTGCAGGCGGG - Intronic
904071823 1:27805087-27805109 AGATGGACAAAACTGAAGCATGG - Intronic
904430395 1:30460487-30460509 GCATAGACTCAACTGCTGCATGG - Intergenic
905023931 1:34837099-34837121 GGGTAGACACACCTGCTGCAGGG + Intronic
905941379 1:41866198-41866220 GGATGGACACATCTGCAGGGAGG + Intronic
907780568 1:57562473-57562495 GGATTGACAGAATGGCAGAATGG + Intronic
910562082 1:88601281-88601303 GGATTGACAGAACTGTCGAATGG + Intergenic
912258730 1:108087359-108087381 GGACAGACAGAATTGCAGCAGGG + Intergenic
912647460 1:111407540-111407562 AGATGGGCAGAACTGCAGCATGG + Intergenic
917927150 1:179798799-179798821 GGATATACACAAGTGCAACAGGG - Intronic
918538287 1:185599552-185599574 GACTTAAAACAACTGCAGCAAGG + Intergenic
1063628756 10:7715093-7715115 GGACTGATTCACCTGCAGCAAGG - Intronic
1065104661 10:22370782-22370804 TGATTGACAAAACTACAGCAGGG + Intronic
1065468000 10:26045856-26045878 GGATAGGCACAAATGAAGCATGG - Intronic
1066589402 10:36977301-36977323 GGCTTGACAGAACTGTAGCTTGG + Intergenic
1069894742 10:71673378-71673400 GGACTGTTACAACTGCAGCTTGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1072902924 10:99425549-99425571 GAATTCACACAATGGCAGCAGGG + Intronic
1073918314 10:108431139-108431161 GGATTGATAGAACTGTAGAATGG - Intergenic
1074201348 10:111238375-111238397 TAATTGACAAAGCTGCAGCAGGG - Intergenic
1075529558 10:123217829-123217851 GGATGGGCTCAACAGCAGCATGG - Intergenic
1076489181 10:130845540-130845562 GGATGGAGACAGGTGCAGCAGGG - Intergenic
1078377667 11:10809274-10809296 GGGATGATACAACTGGAGCATGG - Intergenic
1078484284 11:11707267-11707289 GGATTCATACAAAGGCAGCATGG + Intergenic
1081286933 11:41282137-41282159 GGATTGACAAAGCTGGAGAACGG + Intronic
1081378962 11:42391747-42391769 GGGTTGATATAACTGGAGCAAGG - Intergenic
1084754428 11:71226184-71226206 GGATGGACTCAACAGCAGAATGG + Intronic
1085419243 11:76341425-76341447 GGTTGGACAAAACAGCAGCAAGG - Intergenic
1085928583 11:81053673-81053695 GGATTCAAACAGCAGCAGCATGG - Intergenic
1086916125 11:92531931-92531953 TGGTTGTCACAACTGAAGCAAGG - Intronic
1087411589 11:97797179-97797201 GGATAAACAGAACTGCAGTAAGG + Intergenic
1089018743 11:115189211-115189233 TGATTGATAGAACTGCAGCAGGG + Intronic
1092570590 12:9716953-9716975 GCACTGACACAGCTCCAGCAGGG + Intronic
1098351241 12:69563344-69563366 GGATAGACACAGCTGGAACATGG - Intronic
1100774506 12:97959514-97959536 GGATTGTCACAACTGGAAAAGGG - Intergenic
1102532824 12:113559172-113559194 GGATGGAAACATCAGCAGCAGGG + Intergenic
1103058101 12:117837243-117837265 GGCTTGACCCAGCTACAGCAGGG - Intronic
1106562204 13:30856687-30856709 GGCTTTGCACAAATGCAGCAAGG - Intergenic
1110508054 13:76312697-76312719 GAATTCACACAACTGCACCAGGG + Intergenic
1110789451 13:79571095-79571117 GCATTCACACATCTGCAGAAGGG + Intergenic
1110950137 13:81476016-81476038 TGATAGACACAACTGAACCATGG + Intergenic
1111441051 13:88283033-88283055 GGATTGACAGAACAGTAGAATGG + Intergenic
1114523585 14:23353596-23353618 GGGGTGACGCAACTGCAGGAGGG + Intergenic
1117189662 14:53277696-53277718 GGATTGATTTAATTGCAGCAAGG - Intergenic
1120026929 14:79596894-79596916 GGATTGACACAGCGGGAGCATGG - Intronic
1120265335 14:82241417-82241439 CGATTGAGAAAACTGAAGCAAGG + Intergenic
1121236899 14:92398315-92398337 GGCCTGGCAGAACTGCAGCAGGG + Intronic
1126468688 15:48984055-48984077 TGATTGTCACAACTGAAGAAGGG - Intergenic
1130384926 15:83402775-83402797 GGATAGAAACAGCAGCAGCAAGG - Intergenic
1135080228 16:19427742-19427764 GGTTTGTCACAACTGTAGCAGGG - Intronic
1135121007 16:19766694-19766716 TGATTGTCACAACTGTAGGAGGG - Intronic
1156621660 18:38858665-38858687 GGATTGACTCAATAGCAGAATGG + Intergenic
1158234247 18:55295258-55295280 GGAATGACACACCTGCAGCCTGG - Intronic
1160456020 18:79001174-79001196 AGAATGACACATGTGCAGCACGG - Intronic
1167815498 19:51877129-51877151 GGATGGACACAGATGCAGAAAGG + Intronic
1168470521 19:56637263-56637285 AGATTTACAGAAATGCAGCATGG - Intergenic
926556946 2:14369265-14369287 GAATAGAGACAACTGCAGCAGGG + Intergenic
929572578 2:43031980-43032002 GCATTGAAACAGCTGCAGGAGGG - Intergenic
932942697 2:76187635-76187657 GGATTGACACAAGCACAGAATGG - Intergenic
933357872 2:81236624-81236646 AGATAGACACAACTGCAGTGAGG + Intergenic
933391195 2:81669685-81669707 GGATTGTCTCAAAAGCAGCAGGG - Intergenic
933453622 2:82492545-82492567 AGATTGGAACAACTGCAGGAGGG + Intergenic
933786331 2:85845606-85845628 GGATTGACACAACTGCAGCAGGG + Intronic
938562248 2:132483635-132483657 GGACTAAAACAACTCCAGCAAGG - Intronic
940503045 2:154518727-154518749 GGTTTGAGACAAATGCAGCATGG + Intergenic
942997915 2:182287057-182287079 GGAATGAGACAAGTTCAGCAAGG - Intronic
948841393 2:240651342-240651364 GTGGTGACACACCTGCAGCACGG - Intergenic
1172006997 20:31824500-31824522 GGATGGACAGCCCTGCAGCAGGG + Intronic
1173200946 20:40954797-40954819 GGATAGATACAACCACAGCAAGG + Intergenic
1173534927 20:43802293-43802315 GGACTGTCAAAACTGAAGCACGG - Intergenic
1177217735 21:18151306-18151328 GGATAGGCATGACTGCAGCATGG - Intronic
1180983441 22:19890509-19890531 GGTTTCACGCAGCTGCAGCAAGG + Intronic
949528668 3:4931980-4932002 CAATTGACAAAACTGGAGCATGG + Intergenic
949967760 3:9373181-9373203 GGATTTAAACCAATGCAGCACGG - Intronic
950060107 3:10063799-10063821 GGAATGAACCAACTGCAACAAGG - Exonic
950301472 3:11883022-11883044 GGAATGAACCAACTGCAACAAGG - Intergenic
954303862 3:49715345-49715367 GGCTGGACACAGCTGCAGCCTGG + Intronic
955177103 3:56627363-56627385 GAAGTGATTCAACTGCAGCAGGG + Intronic
956951341 3:74286949-74286971 GGATTCACACACCTGAGGCAGGG + Intronic
966903982 3:184508553-184508575 GGTTAGACACAATTCCAGCAGGG + Intronic
968612692 4:1564305-1564327 GGAATGACACAAGAGGAGCAGGG + Intergenic
969116788 4:4875269-4875291 GGGCTGACATACCTGCAGCAGGG + Intergenic
970013475 4:11486115-11486137 GGAGTGACAGAACAGCTGCAGGG - Intergenic
973790807 4:54376354-54376376 GGATTGTCTCTACTGCTGCAAGG - Intergenic
974936410 4:68414019-68414041 GGAAGGACCCAGCTGCAGCAAGG - Intergenic
975185406 4:71396593-71396615 TGTTTGACCCAACTGCTGCAGGG - Intronic
981873715 4:149516486-149516508 GGATTGACAGAATTGTAGAATGG + Intergenic
984296696 4:177862362-177862384 GGAATGACACACCTGCAGAAAGG + Intronic
988285487 5:29210989-29211011 GTATAGAAACAACTGCAACAGGG + Intergenic
990384014 5:55241866-55241888 GGATTGGCAAAACTCCAGGAAGG - Intergenic
992239144 5:74747691-74747713 AGATGGACAAAACTGGAGCAAGG - Exonic
1002774916 6:320531-320553 GCATAGACACCACTGCAGCCTGG + Intronic
1004894831 6:20138476-20138498 GGTTTGACACAAGAGGAGCATGG - Intronic
1009523399 6:64713238-64713260 TGATTTCCAAAACTGCAGCAGGG + Intronic
1010392378 6:75352479-75352501 GGATTGCCACAATTGAAGCAGGG - Intronic
1017511734 6:155120218-155120240 GGATAGACCCATCTGCGGCAAGG - Intronic
1021874234 7:25033484-25033506 GGATTGTGACAATGGCAGCAGGG + Intergenic
1026577635 7:71586327-71586349 AGATACACACAACTGCAACATGG - Intronic
1031833188 7:126651305-126651327 GGATTGACAGAATGGCAGAATGG + Intronic
1037950735 8:23017491-23017513 GGATGGGGACAACAGCAGCAGGG - Exonic
1038933428 8:32220664-32220686 ACAGTGACACATCTGCAGCATGG - Intronic
1040008627 8:42642396-42642418 GGATTCACACAAGGGCAGCAAGG - Intergenic
1040582596 8:48709305-48709327 GGGGAGACAGAACTGCAGCAGGG - Intergenic
1042351083 8:67778348-67778370 GGTTTGGCAAAACTGTAGCACGG + Intergenic
1043345428 8:79292264-79292286 GGAGTGACACAGCTGCAGCAGGG + Intergenic
1044821484 8:96158700-96158722 GGACAGAAACAACTGTAGCAAGG + Intronic
1045400633 8:101813309-101813331 TGATTAAAACCACTGCAGCATGG + Intronic
1048566126 8:135599853-135599875 GAAATGACACAGCTGCTGCAGGG + Intronic
1050364935 9:4865065-4865087 GGGTTGCCACAACTGAAGCCAGG - Intronic
1056067398 9:82951150-82951172 AGCTCAACACAACTGCAGCAGGG - Intergenic
1056493188 9:87128459-87128481 TGTTTGACACATGTGCAGCATGG + Intergenic
1057100416 9:92353974-92353996 GGATTGACAGAACAGTAGAATGG - Intronic
1057590510 9:96369127-96369149 AGATGGACACAAATGCAGCAAGG + Intronic
1187190819 X:17033285-17033307 GGATTGAAACAAATGAGGCAGGG - Intronic
1187262910 X:17703833-17703855 GCATTCACACCTCTGCAGCATGG - Intronic
1188085736 X:25899113-25899135 GGATTGACATACCCCCAGCAGGG + Intergenic
1188839203 X:34994382-34994404 GGATAGACACAACAGCAGAATGG - Intergenic
1197592734 X:128428499-128428521 TGATTGACAGAAATGAAGCATGG - Intergenic
1198690262 X:139275213-139275235 TAATTGATAAAACTGCAGCAGGG - Intergenic
1199212576 X:145231133-145231155 GTAATGACAAAACAGCAGCAGGG + Intergenic