ID: 933788820

View in Genome Browser
Species Human (GRCh38)
Location 2:85867259-85867281
Sequence GCATCAGTGTAACCTGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 8, 3: 49, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933788816_933788820 16 Left 933788816 2:85867220-85867242 CCTTAAGATCTTGCTACACAGCA 0: 1
1: 0
2: 1
3: 8
4: 109
Right 933788820 2:85867259-85867281 GCATCAGTGTAACCTGGAAGTGG 0: 1
1: 1
2: 8
3: 49
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933788820 Original CRISPR GCATCAGTGTAACCTGGAAG TGG Intronic
900595517 1:3478541-3478563 GAAGCAGGGTCACCTGGAAGGGG - Exonic
901089281 1:6630656-6630678 GAATCACTTGAACCTGGAAGAGG - Intronic
901479724 1:9516701-9516723 GCATCGGTGTAGCCTGGATCTGG + Intergenic
902104353 1:14021321-14021343 GCATCTGTATCACCTGGGAGTGG + Intergenic
904281174 1:29419393-29419415 GAAACAGTGTAACCAGAAAGGGG - Intergenic
906373001 1:45270240-45270262 GCATCAGTGTGACTTGGATGTGG + Intronic
908616746 1:65930546-65930568 ACATCAGTGTGCCCTGGATGTGG + Intronic
909369795 1:74870530-74870552 GCATCAGTGTGCCCTGAATGTGG + Intergenic
909773583 1:79457130-79457152 GCATCAGTGTGCCCTAGATGTGG + Intergenic
911644148 1:100320651-100320673 GCACCAGTGTGCCCTGGATGTGG + Intergenic
912984578 1:114414545-114414567 GCCTCTTTGAAACCTGGAAGCGG - Intronic
914248276 1:145901652-145901674 GAAACAGAGTAACCTAGAAGTGG + Exonic
915687888 1:157653607-157653629 GCATCAAGGGAACCTGTAAGAGG + Intergenic
915787032 1:158624407-158624429 GCATCAGTGTGCCCTGGATGTGG + Intronic
915855690 1:159384036-159384058 TCACCAGTGTACCCTGGATGTGG + Intergenic
917263016 1:173190126-173190148 GAATCACTGAAACCTGGGAGGGG + Intronic
917748713 1:178035797-178035819 GCATCAGTATCACCTGGCACAGG + Intergenic
918767061 1:188499921-188499943 GCATCAGTGTGCCCTGGATATGG + Intergenic
918987161 1:191646720-191646742 CTATCAGTGGAACCTGAAAGTGG + Intergenic
919603776 1:199654171-199654193 GAATCACTTAAACCTGGAAGTGG + Intergenic
921565831 1:216718168-216718190 GCATGATTTTAACCTGGAATTGG - Intronic
924054372 1:240111247-240111269 GCATCAGTGTTATCGGAAAGGGG + Intronic
924241492 1:242045224-242045246 GCATTAGTGTATCCTGGAAATGG + Intergenic
924283078 1:242457768-242457790 GGATCAGTGTAACCAGGAGGAGG - Intronic
1062765185 10:57129-57151 GCATTAGTGTGCCCTGGAAATGG - Intergenic
1062911716 10:1216141-1216163 GCATCAGACTAACCTGGGGGAGG + Intronic
1063557132 10:7091629-7091651 GAATCACTTGAACCTGGAAGTGG - Intergenic
1064476347 10:15692978-15693000 GAATTAGTTGAACCTGGAAGTGG + Intronic
1064623319 10:17237073-17237095 GCATGAGTGAAAACTAGAAGGGG - Intronic
1067322961 10:45239715-45239737 ACATCAGAGGATCCTGGAAGGGG + Intergenic
1068189019 10:53625757-53625779 GAATCAGTGGAACATGGAATAGG + Intergenic
1069106077 10:64384927-64384949 GCATCAATGTGCCCTGGATGTGG - Intergenic
1071664075 10:87536573-87536595 GTATCAGTGTTACCTGAAAATGG - Intronic
1071666316 10:87562276-87562298 GCAGGGGTGTATCCTGGAAGGGG + Intergenic
1071990077 10:91093045-91093067 GCATCATTGTGCCCTGGATGTGG - Intergenic
1072347115 10:94518985-94519007 GAATCACTTTAACCTGGGAGGGG + Intronic
1072808272 10:98439423-98439445 GTATCAGTGTGACCTGGACGTGG + Intronic
1073372671 10:103004998-103005020 GAATCACTTTAACCTGGAGGGGG - Intronic
1074499249 10:114007980-114008002 TCAGCAGTGCAACCTAGAAGAGG - Intergenic
1074542675 10:114378409-114378431 GTATCAGCTTATCCTGGAAGGGG - Intronic
1074860579 10:117507075-117507097 GAATCACTTGAACCTGGAAGGGG - Intergenic
1075162159 10:120033904-120033926 GAATCACTTGAACCTGGAAGGGG - Intergenic
1075225122 10:120621900-120621922 ACATCAGAGTAACCTGGATTTGG - Intergenic
1076040743 10:127246069-127246091 TCATCAGAGAAAGCTGGAAGAGG - Intronic
1076072302 10:127499937-127499959 GCTGCAGAGTAACCTGGCAGGGG + Intergenic
1076604077 10:131678109-131678131 GCATGTGAGTAACCTGGGAGGGG + Intergenic
1077845221 11:6015634-6015656 GCATCAGTGTGCCCTGGATGTGG + Intergenic
1077967627 11:7152833-7152855 GCCTCACTGTAATCTGGATGTGG + Intergenic
1078829756 11:14968276-14968298 TCCTCAGTCTTACCTGGAAGAGG + Intronic
1078945725 11:16066885-16066907 GCATCAGTTTGACCTAGATGTGG + Intronic
1079645990 11:22864350-22864372 GCAGCTGTGTCACATGGAAGAGG - Intergenic
1080054116 11:27887469-27887491 GGACAAGTGTGACCTGGAAGGGG + Intergenic
1080136139 11:28857324-28857346 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
1080894949 11:36441441-36441463 GCATCAGTATGTCCTGGATGTGG - Intronic
1080946252 11:36978659-36978681 GCATCACTGTGCCCTGGATGTGG - Intergenic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1081450292 11:43164591-43164613 GGATCAGTGTCATCAGGAAGAGG + Intergenic
1082736237 11:56859183-56859205 GCCTCAGTGGAAGCTGGAAAGGG + Intergenic
1085086520 11:73671553-73671575 GCATCAATGTGCCCTGGATGTGG - Intergenic
1085348331 11:75782336-75782358 GCATCAGCATCACCTGGGAGCGG - Intronic
1085402832 11:76244729-76244751 GAATCAGTGCAGCCTGGTAGGGG - Intergenic
1086729243 11:90227667-90227689 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1087412439 11:97808768-97808790 GCATCAGTGTGTCCTGGATGTGG + Intergenic
1087628233 11:100621321-100621343 GCAACAGGGTATCCTGGATGTGG - Intergenic
1088567193 11:111184479-111184501 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1090021689 11:123134170-123134192 GAATCACTGGAACCTGGGAGGGG + Intronic
1090268620 11:125370530-125370552 GCAGCTGTCTGACCTGGAAGAGG + Intronic
1090490813 11:127159221-127159243 GCATCAGTGAGCCCTGGATGTGG - Intergenic
1090704680 11:129325613-129325635 GCATCGTTTTAACCTGGAACTGG - Intergenic
1092189945 12:6511894-6511916 GCATCACTTGAACCTGGGAGAGG + Intronic
1095242689 12:39879480-39879502 GCATCAGTGTTCCCTGGATGTGG + Intronic
1096304631 12:50463626-50463648 GCATCAGTGTACCCTAGGTGTGG - Intronic
1097302690 12:58035454-58035476 GCATCAGTGTGCCCTGGATGTGG - Intergenic
1097623061 12:61964972-61964994 TCATGTGTGTAACCTGGTAGAGG - Intronic
1098559040 12:71851735-71851757 GCATCAGTGTGCCCTGGGTGTGG - Intronic
1099475543 12:83104078-83104100 GCACCAGTGTGCCCTGGATGTGG - Intronic
1099890792 12:88586332-88586354 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1101800030 12:108013650-108013672 GCATCAGCATCACCTGGAACTGG - Intergenic
1101987983 12:109462244-109462266 TCATCAGGGGAACCTGGAAACGG - Intronic
1103620827 12:122186180-122186202 CCACCAGGGTGACCTGGAAGAGG - Exonic
1103787173 12:123441378-123441400 GAATCACTTGAACCTGGAAGGGG + Intergenic
1103933542 12:124463360-124463382 GCAGAAGCGTGACCTGGAAGTGG - Intronic
1104296557 12:127520544-127520566 GCATAAATGTAACCATGAAGGGG - Intergenic
1105269613 13:18859726-18859748 GCAGAAGTGGAATCTGGAAGTGG - Intergenic
1107371316 13:39752882-39752904 GCATAAGTATAACCTGGAAAAGG + Intronic
1108091986 13:46858591-46858613 GCATGAGTGTGAACTGGAAATGG + Intronic
1108893648 13:55295062-55295084 GCACCAGTGTGCCCTGGATGTGG + Intergenic
1109322070 13:60823211-60823233 GCATGAGTTTATCCTGTAAGGGG + Intergenic
1109404501 13:61879076-61879098 GCATCAGCATGACCTGGATGGGG + Intergenic
1109421080 13:62113788-62113810 GCATCACTGTAAACTGGATATGG - Intergenic
1109876030 13:68405515-68405537 GCATCAGCATGACCTGGATGTGG - Intergenic
1110033905 13:70654533-70654555 GCCTCAGTGTGTCCTGGATGTGG + Intergenic
1110411097 13:75204636-75204658 GCATCAGTGTGCCCTGGATGTGG - Intergenic
1111107853 13:83669635-83669657 GCATCAGCATGACCTGGATGTGG + Intergenic
1111163207 13:84421696-84421718 GCATCAGTGTGACCTGGATGTGG + Intergenic
1112909400 13:104463030-104463052 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1114081413 14:19204021-19204043 GCACCAGTGTACCCTGGATGTGG + Intergenic
1114917717 14:27288670-27288692 GCATCAGCATTACCTGGATGTGG - Intergenic
1115840797 14:37468369-37468391 GAATTAATGTATCCTGGAAGGGG - Intronic
1115889712 14:38012789-38012811 GCATCAGTGTGCCCCGGATGTGG + Intronic
1115936538 14:38559327-38559349 GCATCAGTGTGCCCTGGATTTGG - Intergenic
1116383098 14:44296750-44296772 GCACCAGTGTCCCCTGGATGTGG - Intergenic
1116481564 14:45397406-45397428 GAATCACTTTAACCTGGGAGTGG + Intergenic
1118371242 14:65138936-65138958 GAATCACTTGAACCTGGAAGAGG - Intergenic
1118691459 14:68344293-68344315 GCACCAGTGTGCCCTGGATGTGG + Intronic
1121140673 14:91539042-91539064 GCATCAGTGTGGCCTGGATGTGG - Intergenic
1122915808 14:104858253-104858275 GAATCACTTGAACCTGGAAGCGG - Intergenic
1122951945 14:105050078-105050100 GCATCAGTGTGACCTGGTCTAGG + Exonic
1123135078 14:106020743-106020765 GCATCAGTGTAAGGTTGAACTGG + Intergenic
1202834982 14_GL000009v2_random:71264-71286 CAATCATTGTAACTTGGAAGTGG + Intergenic
1123432736 15:20232340-20232362 GAATCACTTGAACCTGGAAGTGG - Intergenic
1123585628 15:21758613-21758635 GCATCAGTGTAAGGTTGAACTGG + Intergenic
1123622269 15:22201201-22201223 GCATCAGTGTAAGGTTGAAGTGG + Intergenic
1124440398 15:29681651-29681673 GCATTAGCATGACCTGGAAGTGG + Intergenic
1124625852 15:31307081-31307103 TCACCAGTGTAGGCTGGAAGAGG + Intergenic
1124664540 15:31581181-31581203 GCATCAGCATAACCTGGAAGTGG - Intronic
1124705553 15:31960858-31960880 GCACCAGTGTGCCCTGGAGGTGG + Intergenic
1127965142 15:63917714-63917736 GCATGAGTAAAATCTGGAAGGGG - Intronic
1128655113 15:69455066-69455088 TGATCACTGTAACCTGGAATGGG + Intronic
1129032497 15:72629170-72629192 TCATCAGTGAAACCAGGATGGGG + Intergenic
1129217395 15:74108069-74108091 TCATCAGTGAAACCTGGACTGGG - Intronic
1129470451 15:75750781-75750803 TCATCAGTGAAACCAGGACGGGG + Intergenic
1129778785 15:78255429-78255451 GGACCATTGTAACCTGAAAGGGG - Intergenic
1133148668 16:3809679-3809701 GCATCAGAGGAAGCTGGATGAGG + Intronic
1133169163 16:3970412-3970434 GAATCACTTGAACCTGGAAGCGG - Intronic
1133689370 16:8198534-8198556 GCATCAGTATCCCCTGGAGGAGG - Intergenic
1138363992 16:56457765-56457787 GAATCATTTTAACCTGGAGGCGG - Intronic
1139030858 16:62878692-62878714 GCATCAGTGTGACCTGAATGTGG + Intergenic
1141214278 16:82009448-82009470 GCATCAGTATGACCTGGATATGG + Intronic
1141535605 16:84677734-84677756 CCAGCAGGGTAACCTGGAACTGG - Intergenic
1142439472 16:90086186-90086208 GCATTAGTGTGCCCTGGAAATGG + Intronic
1142547239 17:713563-713585 GAATCACTTGAACCTGGAAGCGG + Intronic
1144257294 17:13481352-13481374 GCATCAGTGCACACTGGATGTGG + Intergenic
1149062771 17:52442876-52442898 GCTTTAGGGCAACCTGGAAGAGG + Intergenic
1151341108 17:73471509-73471531 GAATCACTTGAACCTGGAAGCGG + Intronic
1152548140 17:81013303-81013325 GCACCAGTGTGCCCTGGATGTGG + Intergenic
1152958099 18:57470-57492 GCATTAGTGTGCCCTGGAAATGG - Intronic
1153578733 18:6550048-6550070 GCACCAGTGTGCCCTGGATGAGG - Intronic
1154418434 18:14200257-14200279 GCAGAAGTGGAATCTGGAAGTGG + Intergenic
1156031427 18:32717612-32717634 GCATCATTGAGATCTGGAAGGGG - Intronic
1157053577 18:44198486-44198508 GCATGAGTGAGCCCTGGAAGAGG - Intergenic
1157129976 18:44997589-44997611 GCATTAGTGTAAATTGGAAATGG + Intronic
1157385098 18:47253688-47253710 TCCTCAGGGTAACCTGGAATGGG - Intergenic
1157677774 18:49579898-49579920 GAATCACTTGAACCTGGAAGTGG - Intronic
1157686192 18:49644678-49644700 TCATCAGGGTAGACTGGAAGGGG - Intergenic
1160167483 18:76527232-76527254 TCATCAGGGTGAACTGGAAGGGG + Intergenic
1161843713 19:6697756-6697778 GCATTACTGTGACCTCGAAGGGG + Exonic
1164274674 19:23705938-23705960 GCATCAGCATAATCTGGATGTGG + Intergenic
1164489405 19:28692814-28692836 CCATCAGTGTAACCTGGGTGTGG + Intergenic
1165184063 19:34001756-34001778 TCATCAGAGGGACCTGGAAGAGG + Intergenic
1166275832 19:41753270-41753292 ACCTCAGTGTAACCTGGAAAGGG + Intronic
1167075378 19:47245279-47245301 GAATCACTTGAACCTGGAAGTGG + Intergenic
1167119550 19:47508330-47508352 CCACCAGTATCACCTGGAAGCGG + Intronic
1167242934 19:48355874-48355896 GCATCAGTTTGACCTCGGAGGGG + Intronic
1168516468 19:57013556-57013578 GCATGAGTGTGCCCTGGATGTGG + Intergenic
1202637722 1_KI270706v1_random:56428-56450 CAATCATTGTAACTTGGAAGTGG - Intergenic
928320968 2:30282547-30282569 CCATCTCTGTCACCTGGAAGAGG - Intronic
928421858 2:31143339-31143361 GCATCAGTGAAAGGTAGAAGTGG + Intronic
928709374 2:33987303-33987325 GCACCAGTGTCCCCTGGATGTGG - Intergenic
933788820 2:85867259-85867281 GCATCAGTGTAACCTGGAAGTGG + Intronic
934011956 2:87830159-87830181 GCATCAGTGTGACCTGGATGTGG - Intergenic
934498835 2:94836985-94837007 GCAGAAGTGGAATCTGGAAGTGG - Intergenic
935931610 2:108133002-108133024 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
936032922 2:109086664-109086686 GAGTCAGTGTCACCTGGCAGGGG - Intergenic
936898388 2:117455155-117455177 GCATCAGTGTTCCCTGGATGTGG + Intergenic
937028409 2:118718139-118718161 GCATCAGTGTGGTCTGGAACGGG - Intergenic
937864214 2:126735980-126736002 GAATCAGGGCAACCTGGAGGTGG + Intergenic
939023577 2:136985892-136985914 GCATCAGCGTGCCCTGGATGTGG + Intronic
939754551 2:146093870-146093892 GCATTGGTGTGGCCTGGAAGTGG - Intergenic
940148984 2:150578442-150578464 GCATCAGAGTGCCCTGGATGTGG - Intergenic
940163435 2:150740070-150740092 TCAGCAGTATAACGTGGAAGAGG + Intergenic
940924295 2:159346600-159346622 GAATCACTTGAACCTGGAAGTGG + Intronic
941375157 2:164719516-164719538 GAGTCAGTGGAAGCTGGAAGAGG - Intronic
942230026 2:173852138-173852160 TCAACAGTATAACCTAGAAGTGG - Intergenic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
945112048 2:206369223-206369245 GAATCCATGTAACCTGGAGGAGG + Intergenic
946055777 2:216900837-216900859 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
947257756 2:228183738-228183760 GCTTCAGTGTAGAGTGGAAGTGG - Intergenic
1169539673 20:6585461-6585483 TCATAAGAGTAACCTGTAAGAGG - Intergenic
1171777245 20:29380667-29380689 GCATCAGTGTGCCCTGAAAGTGG - Intergenic
1171818665 20:29812462-29812484 GCATTAGTGTGCCCTGGAAATGG - Intergenic
1173602631 20:44306981-44307003 GCAGCAGTGCCACCAGGAAGGGG - Exonic
1177222951 21:18217931-18217953 GCATCAGTGTGACTTGGATGTGG - Intronic
1177994074 21:28073929-28073951 GAATCAGTTGAACCTGGGAGAGG - Intergenic
1178198858 21:30379717-30379739 GCATCAGCGTGTCCTGGATGTGG + Intronic
1180322110 22:11331836-11331858 GCATTAGTGTGCCCTGGAAATGG - Intergenic
1180499361 22:15918665-15918687 GCACCAGTGTACCCTGGATGTGG - Intergenic
1181358362 22:22316199-22316221 ACATCAGTGTGCCCTGGATGTGG - Intergenic
1181383827 22:22528887-22528909 GCATCAGTGTGTCCTGGATGTGG - Intergenic
1182339118 22:29605250-29605272 GAATCACTTGAACCTGGAAGTGG - Intronic
1182494885 22:30699027-30699049 GAATCACTGGAACCTGGGAGTGG - Intronic
950014767 3:9747740-9747762 GCATCTGTCCAGCCTGGAAGAGG + Exonic
950963829 3:17132200-17132222 GCGTCAGTGTCAGCAGGAAGCGG - Intergenic
951081236 3:18452530-18452552 GCATCCCTGTAACATGGATGAGG - Intergenic
952732768 3:36656561-36656583 GAATCACTTGAACCTGGAAGTGG + Intergenic
953372461 3:42400876-42400898 GTAGCAGTGTAAGCTGGAAATGG + Intronic
954815995 3:53280984-53281006 GAATCACTGGAATCTGGAAGAGG + Intergenic
955454739 3:59107478-59107500 GCATCACTGAAAACTGGAATGGG - Intergenic
955789790 3:62576701-62576723 GAATCAGTTGAACCTGGAAACGG + Intronic
955970707 3:64435774-64435796 GCATCAGCATGACCTGGATGTGG + Intronic
957625272 3:82646990-82647012 GCATCAGCATGACCTGGATGTGG + Intergenic
957762106 3:84572328-84572350 GCATCAGCATGACCTGGATGTGG - Intergenic
957857339 3:85895222-85895244 GCATCAGTGTGACCTGGATGTGG + Intronic
958554384 3:95655595-95655617 TCATCAGTGTGCTCTGGAAGAGG + Intergenic
958720542 3:97837861-97837883 GCATCAGGGAAATCTGGAAATGG - Intronic
959722428 3:109507682-109507704 GAATCACTTGAACCTGGAAGGGG - Intergenic
959804354 3:110533196-110533218 GCATGAGTGTGCCCTGGATGTGG + Intergenic
960724668 3:120658422-120658444 ACACCAGTGTACCCTGGATGTGG - Intronic
962076848 3:132091063-132091085 GTATCAGTGTCATCTGGAGGAGG - Intronic
962228936 3:133642784-133642806 GCATCAGGGTAACATGATAGTGG - Intronic
963511798 3:146256538-146256560 GCATCAGTGTGCCCTGGATGTGG - Intergenic
963512565 3:146267084-146267106 GCATGTGTGAAACCTGGAGGAGG + Intergenic
964088595 3:152847273-152847295 GCATCAGTGTGACCTGGATGTGG + Intergenic
965092538 3:164181405-164181427 GCATCAGCATGACCTGGATGTGG - Intergenic
965865368 3:173199062-173199084 GCACCAGTGTGCCCTGGATGTGG - Intergenic
965869867 3:173252710-173252732 GCATCAGTGTGGCCTGGATGTGG - Intergenic
965887746 3:173469376-173469398 TCATCAGTGTAACTTGGAGTAGG - Intronic
966075929 3:175936654-175936676 GCATCAGTGTGCTCTGGATGTGG + Intergenic
966991321 3:185234425-185234447 GCATCAGTGAAACCTGATATGGG + Intronic
967806028 3:193715282-193715304 GCACCAGTGCACCCTGGATGTGG + Intergenic
969875233 4:10131370-10131392 GCTGCAGGGTGACCTGGAAGAGG + Intergenic
970376365 4:15461194-15461216 GCACTAGTATAACCTGAAAGAGG + Intergenic
970432112 4:15998801-15998823 GAATCATTTTAACCCGGAAGGGG - Intronic
970781138 4:19739500-19739522 ACCTCAGGGTAACCAGGAAGAGG - Intergenic
971337552 4:25737975-25737997 GAATCACTGGAACCTGGGAGAGG - Intergenic
973393090 4:49572633-49572655 CAATCATTGTAACTTGGAAGTGG + Intergenic
973542325 4:51946776-51946798 GCACCAGTGTGCCCTGGAGGTGG + Intergenic
973555232 4:52075585-52075607 CCACCAGTGTAGCCTGGAAAAGG + Intronic
973628269 4:52794084-52794106 GAATCAGTTGAACCTGGAGGTGG - Intergenic
974139905 4:57872753-57872775 GAATGAGTGTAACTGGGAAGTGG - Intergenic
975461729 4:74661266-74661288 GCATCTGCATAACCTGGAAAAGG - Intergenic
975521998 4:75311278-75311300 GCACCAGTGTACCCTGGATGTGG + Intergenic
975577090 4:75874018-75874040 GAATCACTGTAACCCGGAAGAGG + Intronic
975796621 4:78012751-78012773 GCATCAGCATGACCTGGATGTGG + Intergenic
976798316 4:88958923-88958945 GCATGAGTGTGCCCTGGATGTGG + Intronic
977670186 4:99685888-99685910 GCATCAGCATGACCTGGATGTGG + Intergenic
981020394 4:140021758-140021780 GGATCAGTGGCACCAGGAAGCGG - Intronic
981156456 4:141442206-141442228 CCAACAATGTAACCTGGGAGAGG + Intergenic
983665547 4:170177435-170177457 ACATCAGTGTTGCCTGGATGTGG + Intergenic
984447912 4:179860599-179860621 GCAGTGATGTAACCTGGAAGAGG + Intergenic
984543917 4:181075241-181075263 GCCTCAGGGCAACCTTGAAGCGG - Intergenic
985443155 4:189999833-189999855 GCATTAGTGTGCCCTGGAAATGG - Intergenic
1202765042 4_GL000008v2_random:142285-142307 CAATCATTGTAACTTGGAAGTGG - Intergenic
986299756 5:6468512-6468534 GCATCAGTGAAACTTGAAGGTGG + Intronic
987165294 5:15192136-15192158 GCATCAGTGGAGACTGGAATTGG + Intergenic
987226024 5:15842215-15842237 GCATCAGCATGACCTGGATGTGG + Intronic
987870875 5:23615053-23615075 GCATCAGTGTGCCCTGGATGTGG + Intergenic
988310261 5:29548226-29548248 GCATCAGTGTGCCCTGGATGTGG - Intergenic
988354112 5:30151079-30151101 GCACCAGTGTGACCAGGATGTGG - Intergenic
988905237 5:35781315-35781337 GCATCAGTGTGCCCTGAAATTGG + Intronic
990784955 5:59408715-59408737 ACATCAGTGTGACCTGGATGTGG + Intronic
991204893 5:64039027-64039049 GCATCAGTGTACCCTAGATGTGG + Intergenic
991724227 5:69520044-69520066 GAATCACTTGAACCTGGAAGCGG - Intronic
992982066 5:82186050-82186072 GTATCTGTGTGAACTGGAAGTGG + Intronic
993117581 5:83735846-83735868 GCATCAGTGTGACCTGCATGTGG + Intergenic
995391045 5:111640397-111640419 GCATTAGTGTGACCTAGATGTGG + Intergenic
995925606 5:117369756-117369778 GCATCACTGTGACCTGGATATGG + Intergenic
998563969 5:143199621-143199643 CTAACAGTCTAACCTGGAAGGGG + Intronic
999214061 5:149916871-149916893 GCATCACTGTCACCTTGAACAGG + Intronic
1000567273 5:162865292-162865314 GCATAAGTGTCAGCTGAAAGAGG + Intergenic
1002834963 6:858081-858103 GCATCAGCCTCATCTGGAAGAGG - Intergenic
1003091592 6:3108536-3108558 GTGTCAGTGTAAGCTGGAGGTGG + Intronic
1004525226 6:16401129-16401151 TCATCCTTGAAACCTGGAAGTGG + Intronic
1005228449 6:23671315-23671337 GCACCAGTGTGACCTGGATGTGG - Intergenic
1008111683 6:47501999-47502021 TCTTCAGTGCAACCTTGAAGAGG - Intronic
1008153916 6:47990030-47990052 GAATCAGTGTGACCTCGATGTGG + Intronic
1008248393 6:49207338-49207360 ACATCAGTGTGACCTGGAAGTGG - Intergenic
1008272286 6:49504102-49504124 GGATCAGTGTAATCAGGAGGAGG + Intronic
1010087532 6:71938194-71938216 CCCTCAGTGTGACCTGGATGTGG - Intronic
1010130471 6:72486740-72486762 GCATGTATGTAACCAGGAAGAGG - Intergenic
1010430181 6:75769529-75769551 GCACCAGTGTGCCCTGGATGTGG - Intronic
1010498555 6:76566722-76566744 GCAGCAGTGTGCCCTGGATGTGG - Intergenic
1010595671 6:77760680-77760702 AGATTAGTGTATCCTGGAAGAGG - Intronic
1011227443 6:85123238-85123260 AGAACAGTGTTACCTGGAAGAGG + Intergenic
1011846291 6:91567198-91567220 GCAGCAGTGTATCTTGGATGTGG + Intergenic
1011849078 6:91603543-91603565 GCACCAGTGTACCCTGGATGTGG - Intergenic
1012045092 6:94263550-94263572 GCATCAGCATGACCTGGATGTGG - Intergenic
1012597302 6:101055109-101055131 GCACCAGTGTGCCCTGGATGAGG - Intergenic
1014835476 6:126156081-126156103 GCACCAGTGTGACCTAGATGAGG - Intergenic
1015439628 6:133233179-133233201 GCCTCAGTGTGTCCAGGAAGTGG - Intergenic
1015662252 6:135588921-135588943 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1017675005 6:156804247-156804269 GAATCACTTGAACCTGGAAGCGG + Intronic
1018093651 6:160366364-160366386 GCATCAGTGTAACCTGGATGTGG - Intronic
1019891626 7:3951741-3951763 ACCTGAGTGTGACCTGGAAGAGG + Exonic
1021000628 7:15326309-15326331 TAATCAGTTTAACCTGAAAGGGG + Intronic
1026420550 7:70232489-70232511 GAATCATTTGAACCTGGAAGGGG - Intronic
1027993491 7:85394916-85394938 GCATCAGTGTGACCTGGATGTGG - Intergenic
1029272203 7:99384041-99384063 GCATCACAGGGACCTGGAAGTGG - Intronic
1029435208 7:100560264-100560286 GAATCACTTGAACCTGGAAGAGG - Intronic
1029554319 7:101257487-101257509 GAATCAGTTGAACCTGGGAGGGG + Intergenic
1030834444 7:114265391-114265413 GTATCAGTGTGCCCTGGATGTGG - Intronic
1030930828 7:115521782-115521804 GCACCAGTGTACCTTGGATGTGG - Intergenic
1031283985 7:119841568-119841590 GCATCAGTGTGCCCTGAATGTGG + Intergenic
1031284229 7:119843572-119843594 GCATCGGTGTGCCCTGGATGTGG + Intergenic
1031487051 7:122339796-122339818 GAATCATTTGAACCTGGAAGTGG + Intronic
1032394515 7:131579685-131579707 GAATCACTGGAACCTGGAGGCGG + Intergenic
1032668346 7:134060714-134060736 GCAACAGTTTCACCTGGAGGTGG - Intronic
1034081526 7:148282280-148282302 TCATAAGTGTAGGCTGGAAGAGG + Intronic
1034627034 7:152501627-152501649 GCAGCAGTGTCACCTGGGACTGG + Intergenic
1037514652 8:19618550-19618572 GAATCGTTTTAACCTGGAAGGGG + Intronic
1037709181 8:21342094-21342116 GCAAGAGAGAAACCTGGAAGGGG + Intergenic
1038010677 8:23473529-23473551 GAATCACTTGAACCTGGAAGTGG + Intergenic
1038204458 8:25452600-25452622 GCATCAGAGTCACTTGGAGGAGG - Intronic
1038994505 8:32906620-32906642 ACCTCAGTGTAGCCTGGAAAAGG - Intergenic
1039168498 8:34714340-34714362 GCATCAGTGTGCCCTGGATGTGG - Intergenic
1042482219 8:69317064-69317086 GCATGAATGTAACCTAGAAAAGG + Intergenic
1043389650 8:79780011-79780033 GCATCAGAATCACCTGGAGGAGG + Intergenic
1043812049 8:84753111-84753133 GCATCAGTGTACCCTGAATGTGG + Intronic
1044050813 8:87501377-87501399 CCATGACTGTAACCGGGAAGGGG + Intronic
1044221002 8:89669548-89669570 GCTTCATTGGAACCTGGAAGTGG - Intergenic
1045378638 8:101600782-101600804 GCAACAGTGTGACCAGGGAGAGG + Intronic
1047649091 8:126900402-126900424 GCATCAGCATACCATGGAAGTGG + Intergenic
1048375343 8:133818173-133818195 GCTGCAGGGGAACCTGGAAGTGG - Intergenic
1048397041 8:134023687-134023709 GCAGCTGTGTACCCTGAAAGAGG + Intergenic
1048950437 8:139492240-139492262 GCATCAGAATCACCTGGAGGTGG + Intergenic
1049938135 9:518976-518998 GAATCACTGGAACCTGGAAGGGG - Intronic
1050421576 9:5471275-5471297 GAATCAGTTGAACCTGGAGGCGG - Intergenic
1052686571 9:31764854-31764876 GCATCAGTGTGGCCTGGATGTGG - Intergenic
1053658325 9:40243570-40243592 GCAGAAGTGGAATCTGGAAGTGG + Intronic
1053908697 9:42872844-42872866 GCAGAAGTGGAATCTGGAAGTGG + Intergenic
1054359018 9:64094506-64094528 GCAGAAGTGGAATCTGGAAGTGG + Intergenic
1054370449 9:64389845-64389867 GCAGAAGTGGAATCTGGAAGTGG + Intronic
1054526273 9:66132651-66132673 GCAGAAGTGGAATCTGGAAGTGG - Intronic
1054678076 9:67879600-67879622 GCAGAAGTGGAATCTGGAAGTGG + Intronic
1055033599 9:71794685-71794707 GTATGAGTGCAAGCTGGAAGTGG - Intronic
1055120900 9:72659544-72659566 GAATCACTTGAACCTGGAAGGGG + Intronic
1056527213 9:87454711-87454733 GCCTCAGTGTGCCCTGGATGTGG - Intergenic
1058393592 9:104524656-104524678 GCATCAGTGTGACCTGGACATGG - Intergenic
1059885144 9:118737156-118737178 GCACCAGTGTACCCTGGATGTGG + Intergenic
1060143200 9:121228024-121228046 GCACCACTGCAACCAGGAAGTGG + Intronic
1061601357 9:131672403-131672425 GCATCAGTGTCACATGGGAGGGG + Intronic
1203370321 Un_KI270442v1:297728-297750 GCATTAGTGTACCCTGGAAATGG - Intergenic
1203545790 Un_KI270743v1:127174-127196 CAATCATTGTAACTTGGAAGTGG - Intergenic
1186804122 X:13122599-13122621 GCATCAGTTCAATCTGGAACTGG + Intergenic
1188166436 X:26870143-26870165 GCATCAGTGTGCCCTCGATGTGG - Intergenic
1188954113 X:36414141-36414163 ACACCAGTGTACCCTGGATGTGG - Intergenic
1189072057 X:37874350-37874372 GAATCACTGGAACCTGGAGGCGG - Intronic
1189213433 X:39303546-39303568 GCATCAATGTACCCTGGATATGG + Intergenic
1189240548 X:39521350-39521372 GAATCACTTGAACCTGGAAGAGG + Intergenic
1189368242 X:40406643-40406665 GCATCAATTTTACATGGAAGTGG + Intergenic
1189594318 X:42548170-42548192 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1189886137 X:45546485-45546507 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1190412591 X:50151645-50151667 GCAAGTCTGTAACCTGGAAGAGG + Intergenic
1190640347 X:52478255-52478277 GCATCAGTGTCCCATGGCAGTGG - Intergenic
1190647325 X:52534610-52534632 GCATCAGTGTCCCATGGCAGTGG + Intergenic
1190683715 X:52851824-52851846 GCATCAGTGTCCCATGGCAGTGG + Intergenic
1191006858 X:55718431-55718453 GTATTTGTGAAACCTGGAAGTGG + Intronic
1192211531 X:69130900-69130922 GCATCAGTTTAACCTGGGAAGGG - Intergenic
1193205153 X:78739497-78739519 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1193547367 X:82846343-82846365 GCATCAGTGTGCCCTGGATGTGG + Intergenic
1193678171 X:84483028-84483050 GCATCAGCATAACCTGAATGTGG - Intronic
1193938436 X:87651641-87651663 GCATCAGTGTGACATGGATGAGG - Intronic
1194019449 X:88668842-88668864 GCACCAGTGTGCCCTGGATGTGG - Intergenic
1194178809 X:90688183-90688205 GCATCTGTGTGCCCTGGAAGTGG - Intergenic
1194373937 X:93109825-93109847 GCATCAGTGTACCCTAGATGTGG - Intergenic
1195658518 X:107356151-107356173 GTATCAGTGGAACCTAGAACTGG - Intergenic
1196278616 X:113797099-113797121 GCCTCAGCGTGACCTGGATGTGG + Intergenic
1196596079 X:117547059-117547081 GGATCAGAGTAACATTGAAGAGG + Intergenic
1199132528 X:144208390-144208412 GCATCAGTGTGACCTGGATGTGG + Intergenic
1199237813 X:145510789-145510811 GCATCAGTGTGCCCTGGATGAGG + Intergenic
1199384648 X:147209035-147209057 GCAGCAGTGTGCCCTGGATGTGG + Intergenic
1199393387 X:147307335-147307357 GCACCAGTGTGTCCTGGATGTGG - Intergenic
1199423695 X:147676572-147676594 GCACCAGTGTGCCCTGGATGTGG + Intergenic
1200525474 Y:4270353-4270375 GCATCTGTGTGCCCTGGATGTGG - Intergenic
1200551990 Y:4589863-4589885 GCATCAGTATGTCCTGGATGTGG - Intergenic
1200681966 Y:6223896-6223918 GCATCAGTGTACCCTAGATGTGG - Intergenic
1200857537 Y:7955324-7955346 GCATCAGTGTCATCAGGAGGAGG + Intergenic
1201067975 Y:10117347-10117369 GCATTAGTGTTCCCTGGAAATGG + Intergenic
1201411537 Y:13703652-13703674 GCATCTGTGCAGCCTGGCAGCGG + Exonic
1201760355 Y:17530403-17530425 GCATTAGTGTGTCCTGGAAATGG - Intergenic
1201841199 Y:18375587-18375609 GCATTAGTGTGTCCTGGAAATGG + Intergenic