ID: 933789208

View in Genome Browser
Species Human (GRCh38)
Location 2:85870422-85870444
Sequence ATGAAAAAGGAGAACGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1056
Summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 948}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933789208_933789212 -8 Left 933789208 2:85870422-85870444 CCCTCCTCGTTCTCCTTTTTCAT 0: 1
1: 0
2: 7
3: 100
4: 948
Right 933789212 2:85870437-85870459 TTTTTCATCTCCTAAGAGTTAGG 0: 1
1: 0
2: 2
3: 24
4: 324
933789208_933789213 1 Left 933789208 2:85870422-85870444 CCCTCCTCGTTCTCCTTTTTCAT 0: 1
1: 0
2: 7
3: 100
4: 948
Right 933789213 2:85870446-85870468 TCCTAAGAGTTAGGATCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 79
933789208_933789215 2 Left 933789208 2:85870422-85870444 CCCTCCTCGTTCTCCTTTTTCAT 0: 1
1: 0
2: 7
3: 100
4: 948
Right 933789215 2:85870447-85870469 CCTAAGAGTTAGGATCCCCAGGG 0: 1
1: 0
2: 1
3: 6
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933789208 Original CRISPR ATGAAAAAGGAGAACGAGGA GGG (reversed) Intronic
900459308 1:2793945-2793967 AAGAAGAAGGAGGGCGAGGAGGG - Intronic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
900932855 1:5747714-5747736 AGGAAGAAGGAGATGGAGGAGGG + Intergenic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902241340 1:15091638-15091660 ATGAAAAAGGAAAACACGGCCGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902560439 1:17274006-17274028 AAGAAAAAGGATAACAGGGAAGG + Intronic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
903020992 1:20394179-20394201 CTACAAAAGGAGAAAGAGGATGG + Intergenic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903430120 1:23290740-23290762 ATGAAAAAAAAGAACCAGAAAGG + Intergenic
903963337 1:27070991-27071013 ATGACAAGGGAGAACGTAGAGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904648953 1:31989807-31989829 ATGAAAAAGGTGAAGGATGCCGG - Intergenic
904807737 1:33143572-33143594 AAGAGGAATGAGAACGAGGATGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905427122 1:37894948-37894970 ATAAGAAAGGAGAACTAGAATGG + Intronic
905468700 1:38175661-38175683 AGGAAAAAGGGGAGCGGGGAAGG - Intergenic
906099194 1:43246225-43246247 TTGAAAAAGAAGAACAAGGTTGG + Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906960430 1:50416529-50416551 ATAAAAAAGGAGAAAAAAGAGGG - Intergenic
907090243 1:51717261-51717283 ATGAAAAAGGAAAACATGGCTGG - Intronic
907200437 1:52721959-52721981 GTAAAAAAGAAGAACGAGCATGG - Intergenic
907233785 1:53025894-53025916 ATGAAATTGGAGAACTAGGCAGG - Intronic
907694739 1:56712553-56712575 TTGAAAAAGGAAAACTAGGCTGG + Exonic
907760607 1:57355166-57355188 AGGAAAAAAGAGAAGGAAGAGGG - Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908949383 1:69541214-69541236 ATGAAAAGGCAGAAAGATGAGGG - Intergenic
909123265 1:71632051-71632073 ATAAAAAATGAGTACAAGGAAGG + Intronic
909614477 1:77591342-77591364 ATGAAAGAAAAGAACGAAGAGGG - Intronic
909829070 1:80162590-80162612 AGGAAACAGCAGAAGGAGGATGG + Intergenic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910397019 1:86803773-86803795 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
910488457 1:87742071-87742093 ATGAAAAAGGAGAAGGGGAGGGG - Intergenic
910501768 1:87900590-87900612 ATGAAGAAGGAGAAAGAGATGGG - Intergenic
910700065 1:90063805-90063827 AAGAAAATGGAGAACTTGGAGGG + Intergenic
911386628 1:97183550-97183572 TTGAAAAAGGAGAACAAAGTGGG - Intronic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
911962400 1:104322165-104322187 ATGAAAAAGGAGACAGAGAAAGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
913322876 1:117601583-117601605 ATGAGAAAGGGGTACGAGGTTGG + Intergenic
913697462 1:121341425-121341447 ATGAAACAGGGCAAAGAGGATGG + Intronic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914140096 1:144938627-144938649 ATGAAACAGGGCAAAGAGGATGG - Intronic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914910785 1:151784589-151784611 AGGAAAGAGGAAAACCAGGAGGG - Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915305182 1:154973212-154973234 AAGAAAGAGGAAAACGGGGACGG + Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916336694 1:163679108-163679130 AGAAGAAAGGAGAATGAGGAAGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916386405 1:164276610-164276632 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
917090803 1:171351347-171351369 GTGACAGAGGAGAAGGAGGAGGG + Intergenic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917994904 1:180426577-180426599 AAGAAAATGGAAAACAAGGAAGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918892927 1:190299358-190299380 AGGAAAAAAGAGAAAGAGAATGG - Intronic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920127113 1:203702144-203702166 AGGAAAAGGGAGAAGGAAGATGG - Intronic
920159848 1:203988159-203988181 ATGAAATAGGAGAGTGAGGTGGG + Intergenic
920209669 1:204319134-204319156 AGGAAAGAGGAGAAAGAAGACGG + Intronic
920365098 1:205444125-205444147 ATGGAAAAGGAGGGGGAGGATGG - Intronic
920484796 1:206359757-206359779 ATGAAACAGGGCAAAGAGGATGG + Intronic
920811722 1:209292072-209292094 ATGAAAATGGAGACCAAGGAAGG + Intergenic
921156567 1:212443739-212443761 GTGAAAAAACAGAACGAGAAGGG + Intronic
921196002 1:212758834-212758856 TTGAAAAAGAAGAACAAGGTTGG + Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921498624 1:215872498-215872520 ATGACAAAGTAGAACAAAGATGG - Intronic
921787220 1:219245074-219245096 AAGAGAAAGAAGAAAGAGGAAGG - Intergenic
921795415 1:219338067-219338089 ACGTAAAATGAGAATGAGGAAGG - Intergenic
921818371 1:219589387-219589409 ATGAAAAAGGGAGAGGAGGAGGG + Intergenic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922570317 1:226630879-226630901 AGGAGAAAGGAGAAGAAGGAAGG + Intergenic
923062147 1:230485554-230485576 ATGAAAAAAGAGAAGGAAAAAGG - Intergenic
923868600 1:237966330-237966352 CTAAAAAAGGAGAACATGGATGG + Intergenic
923942322 1:238842089-238842111 AGGATGAAGGAGAACGGGGAGGG - Intergenic
924406727 1:243755362-243755384 ATTAAAAAGGAGACCGGGCACGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1062864216 10:836463-836485 ATGAAAAGGGAGAAAAAGTAAGG - Exonic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063494499 10:6494406-6494428 ATGAAGAAGGTGAACCATGAAGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064048181 10:12037937-12037959 AAGAAAAAGGAGAAGGAAAAAGG - Intronic
1064106772 10:12506940-12506962 ATGAAAAAGGAGCAAGGAGATGG + Intronic
1064297781 10:14093994-14094016 ATGATAATGGAGCAGGAGGATGG + Intronic
1064402517 10:15033479-15033501 AAGAAAAAGGAGAAGAAAGAGGG + Intronic
1064533023 10:16329539-16329561 AGGAAAAAGGAGAAGGGGAAAGG + Intergenic
1064617896 10:17181560-17181582 CAGAAACAGGAGAACAAGGAGGG - Intronic
1064807129 10:19147973-19147995 ATGAAACAGGAGAGGAAGGAAGG + Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065321864 10:24517564-24517586 AACAAAAAGGAGAACGAGGAGGG - Intronic
1065360321 10:24883472-24883494 ACGAAAAAGGAAAAAGGGGAGGG + Intronic
1065775670 10:29117418-29117440 ATAAAAAATGAAAATGAGGAGGG + Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1066228888 10:33412539-33412561 AGGAAAAAGGAGAACTAACAAGG + Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067316303 10:45167498-45167520 TTTAAAAAGGTGAAGGAGGAGGG - Intergenic
1068157277 10:53216967-53216989 TTGAAAAGGGACAAAGAGGAAGG - Intergenic
1068165377 10:53325001-53325023 ATTAAAAAGGAGAACGAATGAGG - Intergenic
1068934466 10:62622399-62622421 AGGGAAAAGGAGAAGCAGGATGG - Intronic
1069033951 10:63629209-63629231 AAGAAAAAGGAAAACGAAAAGGG + Intergenic
1069124287 10:64609830-64609852 ATGAAAACAAAGAAAGAGGAAGG - Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069268421 10:66492955-66492977 ATGTCAAAGAAGAACAAGGAAGG - Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1070252801 10:74787735-74787757 GTGAGGAAGGAGAACAAGGAAGG + Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1070639420 10:78156668-78156690 AAGAAAAAGAAGAACAAAGATGG - Intergenic
1070714279 10:78707914-78707936 AGGAGGAAGGAGAACCAGGAAGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071604352 10:86974502-86974524 ATGAAGAAGAAGAGGGAGGAAGG - Intronic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072830195 10:98649264-98649286 AATAGAAAGGAGAAAGAGGAAGG + Intronic
1073209170 10:101784385-101784407 ATGAAAGAGGAGAAAAGGGAGGG + Intergenic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073759061 10:106611090-106611112 AAAAAAAAGTAGAACAAGGAGGG + Intronic
1074085846 10:110208631-110208653 AGGAAAAAGGCGAAGTAGGAGGG - Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1078116380 11:8456052-8456074 ATGAAAAAGAAGAACAATGGAGG - Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078729082 11:13959673-13959695 AGGAGAAAGGAGAAAGAAGAAGG + Intergenic
1079072901 11:17363563-17363585 AAGAAAAGAGAGAAAGAGGAAGG - Intronic
1079321005 11:19451269-19451291 ATGAAAGAAGAGAATGAGGGAGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079518782 11:21300321-21300343 ATTACAGAGGAGAAGGAGGAAGG + Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1080556623 11:33422784-33422806 ATGAAAAAGAAAAAAAAGGAAGG + Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1084887618 11:72221335-72221357 AGGAAAAAGGAGATTGAGGTAGG + Intronic
1085846323 11:80069988-80070010 TTTAAAAAGGAAAACGAGGGGGG - Intergenic
1085923463 11:80986675-80986697 ATGGAAAAGGAGAACAACTATGG - Intergenic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086457073 11:86969531-86969553 AGGAAGAAGGAGAAAGGGGATGG - Intergenic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086858239 11:91892654-91892676 AGGAAAAAGGAGAGGGAGGAAGG - Intergenic
1087594733 11:100238423-100238445 AAAAAAAAGGAGAAAGAAGAAGG + Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088245849 11:107817370-107817392 AAGTAAAGGGAGAACTAGGAAGG + Intronic
1088684874 11:112276265-112276287 AGGAGAAAGGAGACCTAGGAGGG + Intergenic
1089060859 11:115624975-115624997 GTGAAAATGGTGAAAGAGGACGG - Intergenic
1089089720 11:115861209-115861231 AAGAAAAAGTAGAAGGAGTAAGG + Intergenic
1089413037 11:118263103-118263125 ATGAAAAAGAAGAAAAAGAAGGG + Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090948370 11:131451413-131451435 ATGCAAAAGGAGTGAGAGGAGGG + Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091238265 11:134035988-134036010 ATAGAAAAGGAAGACGAGGATGG + Intergenic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092034005 12:5315006-5315028 TTTAAAAAGGGGAAAGAGGAAGG - Intergenic
1092466909 12:8741444-8741466 ATAAAATAGAAGAACCAGGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093896755 12:24583366-24583388 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094150624 12:27278971-27278993 ATAAAAAAGGAAAAAGAGTAGGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1095410294 12:41914117-41914139 AAGATAAAGGAGAATGAGAATGG + Intergenic
1095785378 12:46103076-46103098 CTGAAAAAGGAGGACGAGAGAGG - Intergenic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097152195 12:56987287-56987309 TTGAACAAGGACAATGAGGATGG + Intergenic
1097257792 12:57693903-57693925 CTGAAATTGGGGAACGAGGAGGG + Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097729169 12:63108031-63108053 CGGAAGAAGGAGAAAGAGGAAGG - Intergenic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098343547 12:69476035-69476057 TTTAAAAAGGGGCACGAGGAAGG - Intronic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098997880 12:77142792-77142814 AGGAAAGAAGAGAATGAGGAGGG - Intergenic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1099585765 12:84510363-84510385 TTGAAATAGGAGAAAGAAGAGGG - Intergenic
1099616430 12:84941516-84941538 AAGGAAAAGGAGAAGGAGAAGGG + Intergenic
1099660577 12:85554244-85554266 ATGAAAAATGATGACGATGATGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100101938 12:91119512-91119534 ATGAAAGAGAATAACAAGGACGG + Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1100818514 12:98408920-98408942 AAGAAACAGAAGAACAAGGATGG + Intergenic
1100818525 12:98409001-98409023 AAGAAACAAAAGAACGAGGATGG + Intergenic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101164514 12:102014764-102014786 ATGAAAAGGGAGGAAGATGATGG - Intronic
1101221825 12:102649615-102649637 AAGAAATATGAGAATGAGGATGG + Intergenic
1101469806 12:104986057-104986079 ATAAAAAAGGATAAAGAGGAGGG + Intergenic
1101811940 12:108115036-108115058 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102397054 12:112595501-112595523 AGGCAAAAGGGGAAGGAGGAGGG - Intronic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102887578 12:116533558-116533580 ATGAAGAAGGGGGACAAGGAGGG - Intergenic
1103059785 12:117849113-117849135 AGGAGAAAGGAGAAAGAGAACGG + Intronic
1103098237 12:118149116-118149138 ATGGAAAAGGGGGACGAGGAAGG - Intergenic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1104116611 12:125755092-125755114 ATCAAAAAGGAGAATGTAGAAGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104275659 12:127325035-127325057 ATGAAGATGGAGGAGGAGGAAGG - Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105662949 13:22519531-22519553 ATGAAAAAGGACAAACATGAAGG + Intergenic
1105722873 13:23134511-23134533 CTGGAAAAGGAGGAAGAGGAGGG + Intergenic
1105731981 13:23226861-23226883 AACAAAAAGGAAAACAAGGAGGG + Intronic
1105962641 13:25356046-25356068 AAGAAAAATGAGAACGGGGAGGG - Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1107436498 13:40385050-40385072 ATAAAAAAGGAAAAAAAGGAAGG - Intergenic
1107556349 13:41519543-41519565 ATGCAAAGGCAGAACGCGGAAGG - Intergenic
1108020171 13:46120214-46120236 ATGAAAAAGATAAACCAGGAAGG + Intergenic
1108038727 13:46320073-46320095 AAGAAAAAGGAGGAAGAGGCCGG + Intergenic
1108781139 13:53835572-53835594 AAGAAAGAGGAGGAAGAGGAGGG - Intergenic
1108853318 13:54762562-54762584 AAGAAAAATGAGGAAGAGGAGGG + Intergenic
1109039132 13:57309079-57309101 AAGAAAAAGGAGAAAGAAGTGGG - Intergenic
1109185770 13:59265797-59265819 ATGAAAAAGAAAAAAAAGGAAGG - Intergenic
1109921137 13:69061220-69061242 AGGAGAAAGGAGGAAGAGGAGGG + Intergenic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112616230 13:101008540-101008562 AATAAAAAGGAGTATGAGGAAGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1114392226 14:22322368-22322390 AAGAAGAAGGAGAAAGAGAAAGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114767907 14:25395290-25395312 ATCAAAAAGGTGCAAGAGGAAGG - Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1115563546 14:34605180-34605202 TTGAAAAAAGAGAACTAGGTTGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117879644 14:60299975-60299997 ATAAAAAAGGAAAAAGAGAAGGG - Intergenic
1117931333 14:60843564-60843586 ATAAAAAAGGCAAACGAGGCCGG - Intronic
1118632468 14:67718291-67718313 AGGGAAGAGGAGAAGGAGGAAGG + Intronic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118848015 14:69562738-69562760 ATGAACAAGGAGGTAGAGGAGGG + Intergenic
1118866723 14:69710213-69710235 ATGGAAGAGGAGGAAGAGGAGGG - Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119676892 14:76562540-76562562 AGGAAGAAGGAGAGCCAGGAGGG + Intergenic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1119873872 14:78040088-78040110 TTGAAAAAGGAGAACGAAGTTGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119995184 14:79245876-79245898 AAGAAAAAAGGGAAAGAGGAAGG + Intronic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120597849 14:86463382-86463404 ATGAAAAGGGTGAAAGGGGAGGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121533728 14:94676799-94676821 AAAACAAAGGAGAACAAGGAAGG - Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122206021 14:100148434-100148456 ATGAGAAAGGAGGAAGGGGAAGG - Intronic
1123792327 15:23734258-23734280 AAGAAAAAGAAGAAAGAAGAGGG + Intergenic
1124339623 15:28881864-28881886 GGGAAAAAGAAGAACAAGGAAGG - Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125057654 15:35381419-35381441 AAGAAAAAGAAAAAAGAGGAAGG + Intronic
1125144546 15:36451542-36451564 ATGAAAAAGATAAAAGAGGAAGG - Intergenic
1125650917 15:41317104-41317126 ATGAGAAAGGATAACCAGTAGGG + Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1125983302 15:44023904-44023926 ATGGAAAACGAGACCTAGGAAGG - Intronic
1126386066 15:48094644-48094666 TTGAAAAAGGAGGACCAGGCTGG - Intergenic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127062290 15:55199106-55199128 ATGAATAAGAAGGACAAGGAAGG - Intergenic
1127123728 15:55792518-55792540 ATGAAAAGGGAGGACGAAGGTGG - Intergenic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128557470 15:68641485-68641507 AGGGAAAAGGAGAAGGGGGAGGG + Intronic
1128674441 15:69598194-69598216 ATGAGAAGGGAGAAAGTGGATGG + Intergenic
1128821332 15:70657661-70657683 ATTAAAAAAGAGAAAGAGGGAGG - Intronic
1128839685 15:70840168-70840190 ATGAAAAAGGAGATGCAAGATGG + Intronic
1128856135 15:71018045-71018067 CTGTAAAAGGAGGAGGAGGAGGG + Intronic
1129651809 15:77496439-77496461 ATGGAAAAGGAGAAACTGGATGG - Intergenic
1130424969 15:83787826-83787848 TTGAGAAAGGAGAAAGAGGAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130819743 15:87482095-87482117 ATGACAAAGGAGCATGGGGATGG + Intergenic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131262957 15:90898249-90898271 AGGAACAAGGACAACCAGGAGGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131827127 15:96330975-96330997 ATGATAAAAGAGAGAGAGGAGGG - Exonic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1132778975 16:1612649-1612671 ATGAAAAAGGTGACCAAGGCTGG + Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134615891 16:15650687-15650709 AAGGAAGAGGAGAAAGAGGATGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135065008 16:19302108-19302130 AGGAAAGAGGAAAAAGAGGAAGG - Intronic
1135431849 16:22391133-22391155 TTGAAAAAGAAGAACGAGGCTGG - Intronic
1135976179 16:27110079-27110101 CTGAAAAAGGATAACGAGGTGGG + Intergenic
1136112208 16:28070779-28070801 CTGAGGAGGGAGAACGAGGAAGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138913905 16:61439401-61439423 ATGTAAAAAGAGATGGAGGATGG + Intergenic
1139097784 16:63726795-63726817 AAGAAAAAAGAGAAAGAGAAAGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139196299 16:64922024-64922046 AAGGAAAAGGAGAAAGAGAAAGG - Intergenic
1139330319 16:66183550-66183572 AGGAGAGAGGAGAAGGAGGAAGG + Intergenic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140513107 16:75522408-75522430 AATAAAAAGGAGAAAAAGGAAGG - Intergenic
1140540097 16:75749128-75749150 GCCAAAAAGGAGAAAGAGGAAGG + Intronic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141867037 16:86757475-86757497 AAGAAAAATGAGAACCAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142795039 17:2301138-2301160 GTAAAAAAGGAGAAAAAGGAGGG + Intronic
1142868136 17:2803540-2803562 TTGAAAAAGGAGAACAAAGTTGG + Intronic
1143007632 17:3847116-3847138 AAGAAAGAGGAGAGGGAGGAAGG - Intergenic
1143200521 17:5110186-5110208 ATGAAAAAAGAAGAGGAGGACGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143954553 17:10658241-10658263 AAAAAAAAGTAGAACGAGAATGG - Intergenic
1144212320 17:13025916-13025938 AAGAGAAAGGAAAAAGAGGAAGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1145762181 17:27431361-27431383 AACAAAAAGTAAAACGAGGATGG - Intergenic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147537439 17:41329700-41329722 ACAAAAAAGTAAAACGAGGATGG - Intergenic
1148015968 17:44522947-44522969 AAAAAAAAAGAGAATGAGGATGG - Intergenic
1148067522 17:44883258-44883280 GAGAAAAAGGAGAGCAAGGAGGG + Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148641988 17:49194473-49194495 AGAAAAAAAGAGAAGGAGGAGGG - Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149766971 17:59287369-59287391 ATAAAAAAAGAGAAAGAGAAGGG - Intergenic
1149797932 17:59538565-59538587 AAGAATAAGGAGAAAGAAGAAGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151122745 17:71810597-71810619 ATCAAAAAGGATAAGGAGGCTGG + Intergenic
1151596706 17:75082379-75082401 ATGAAACAGGACAACGTGGGTGG - Intergenic
1151660379 17:75515484-75515506 TTGGAAAAGGAGAAGGAGAAAGG - Exonic
1152277596 17:79367250-79367272 ATGAAAGAAGAAAAGGAGGAGGG - Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1154477250 18:14774351-14774373 TTTAAAAAGGTGAAAGAGGAGGG - Intronic
1155130191 18:22926670-22926692 ATTAAAAAGGGAAACGAAGAAGG + Intronic
1155346206 18:24859709-24859731 AGGAGAGAGGAGAACGAGGTTGG - Intergenic
1155515308 18:26618551-26618573 AGGATAAAGGTGAACGAGGAAGG + Intronic
1155652092 18:28154662-28154684 ATGAAAAAGAATAATGAGAACGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1156571616 18:38261215-38261237 ATGAAAAGGTAGAACTAGTAAGG - Intergenic
1156580297 18:38367193-38367215 CTGAAAAAGGAGATAGATGAGGG + Intergenic
1156585644 18:38428073-38428095 AGGGAAAAGGAGAAGGAGGAAGG + Intergenic
1156768086 18:40683929-40683951 AATAAAAAGAAGAACTAGGAAGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157971217 18:52271316-52271338 ATGAAATAGGAAAATAAGGATGG - Intergenic
1158087510 18:53670066-53670088 AAGAAAAAGGACAAAAAGGAGGG - Intergenic
1158332328 18:56376258-56376280 AGGAAAAAGGAGAGGGAGAAAGG + Intergenic
1158862807 18:61609499-61609521 ATTAAAAAGGAGCATGAGGTAGG + Intergenic
1158865709 18:61636107-61636129 ATGAAAGAAGAGAAGGAGCAAGG + Intergenic
1158875054 18:61725556-61725578 ATGAACAAGAAGACCAAGGATGG - Intergenic
1159345852 18:67201667-67201689 ATGATATAGGAGAGCTAGGAAGG - Intergenic
1159448958 18:68575821-68575843 AGGAAAAAAGAAAAGGAGGAAGG - Intergenic
1159657770 18:71053012-71053034 ATGAAATAGGAGGAGGACGAAGG - Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1159924692 18:74257521-74257543 ATGAACAAGGAGAAAGAATATGG + Intronic
1160442804 18:78905167-78905189 ACAAAATAGGAGAACCAGGAGGG + Intergenic
1160448621 18:78946962-78946984 AGGAAAAGGGAGGAAGAGGAGGG + Intergenic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1162201252 19:9022178-9022200 AAGAAGGAGGAGGACGAGGAAGG - Intergenic
1162964091 19:14147891-14147913 ATCGAAAAGGAGACCAAGGAGGG + Exonic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164992650 19:32695645-32695667 ATCAAAAAGGGGAAGGAGAAGGG - Intronic
1165157109 19:33795673-33795695 AGGAAACAGGAGGAAGAGGAAGG + Intergenic
1165182187 19:33981100-33981122 ATGTCAAAGAAGAACGAGTAGGG + Intergenic
1165532422 19:36415115-36415137 TTGAAAAAGGAAAAAGAGGTTGG - Intronic
1165640044 19:37376716-37376738 AAGAGAATGGAAAACGAGGAAGG + Intronic
1165821697 19:38680768-38680790 AGGAATAAAGAGAAGGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166322581 19:42027788-42027810 ATGAAAAGTGAGTAGGAGGAGGG - Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167607241 19:50487946-50487968 ATCAAACAGGAGAAAGAGGGAGG + Exonic
1167646643 19:50709477-50709499 CTGAGAAAGGAGATCAAGGAGGG + Intronic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167806393 19:51789262-51789284 ATCAAAAAGGAGAAATAGGAAGG + Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925905218 2:8536141-8536163 CTGAAAAATTAGAACCAGGAGGG - Intergenic
926316775 2:11715802-11715824 ATGAAAATGGAGGAGGAGGATGG + Intronic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927295172 2:21445360-21445382 ATGACAAAGGAGACAGAGAAGGG - Intergenic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927733395 2:25496281-25496303 ATGAACAAGGAGAACAAGGAAGG - Intronic
927866180 2:26589159-26589181 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
929199898 2:39223892-39223914 ATTAAAAAAGAGAAGGAGGCTGG - Intronic
929799924 2:45091033-45091055 TTGAAAAAGGAAAAAGAGGGTGG - Intergenic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
930081661 2:47454592-47454614 ATGAAAAAGTATAACAAGGGGGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931150069 2:59563118-59563140 AAGAAAAAGGTGAAAGAGGTAGG + Intergenic
931152309 2:59587977-59587999 AAGAAAAATGAGAGAGAGGAAGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931255383 2:60567655-60567677 ATGCAAAAGGAAAAAGAGGAGGG + Intergenic
931794765 2:65698782-65698804 AGGAAAAATGAGAAAAAGGAGGG - Intergenic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933231069 2:79808256-79808278 ATGAAAGAGGAGAAGGGAGAAGG + Intronic
933231071 2:79808263-79808285 AGGAGAAGGGAGAAGGAGGAAGG + Intronic
933789208 2:85870422-85870444 ATGAAAAAGGAGAACGAGGAGGG - Intronic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934535313 2:95128556-95128578 AAGAAAAAGAAGAAAGAAGAAGG + Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935441554 2:103103919-103103941 ATGGAAAAGGAGGAAGAGAAAGG - Intergenic
935625383 2:105168355-105168377 ATGAGAAAAGAGACCGAGGCAGG + Intergenic
935709497 2:105884804-105884826 ATGAGAGAGGAGAGCGAGGGAGG - Intronic
936000814 2:108828235-108828257 ATCAAATACGAGAACAAGGAAGG + Intronic
936044828 2:109179358-109179380 ATGAAAAAGCAGAACGTGAGAGG + Intronic
936376908 2:111948615-111948637 ATGAAAAATGAGAAAAAGGAAGG - Intronic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
936848054 2:116861616-116861638 ATGAAATAAGAAAATGAGGAAGG - Intergenic
936958855 2:118051801-118051823 TGGAAAAAGGAAAACAAGGAAGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937624993 2:124034113-124034135 ATGAAAAAGGACAGTGAGAAGGG + Intronic
937683596 2:124670749-124670771 TTGAAAGAGGTGAACGAGCAAGG - Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
938938890 2:136151864-136151886 AGGAAACAGAAGAACGAGGAGGG - Intergenic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939076924 2:137614278-137614300 ATGAGAAAGAAGAATGGGGATGG - Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939160674 2:138584783-138584805 AAGAAAAAGAAGAAAGAGAAGGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940374350 2:152940991-152941013 ATGAAAAAGGATAATGATAAAGG - Intergenic
940577978 2:155538370-155538392 TTGAAAAAGGATAAAGATGAAGG - Intergenic
940793626 2:158054022-158054044 GTGCAAAAGGAGACCGAGGTGGG + Intronic
940911906 2:159216639-159216661 AGGAGAAAGGACAACGAGGCGGG - Intronic
941094644 2:161223711-161223733 AGGAAAAAGGAAAATGAAGAAGG - Intronic
941163505 2:162061032-162061054 AGTAAAAAAGAGAAAGAGGAAGG - Intronic
941231967 2:162921466-162921488 AAGAAAGAGGAGAAAGAGGAAGG + Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941992822 2:171573626-171573648 ATGAAAAAGGACAAAAAGGAAGG + Intergenic
942329415 2:174806245-174806267 ATGAAAAAGGAAAGCAAGGGTGG - Intronic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942881044 2:180860628-180860650 AGGAAAAAGGAGAATGAGAAAGG + Intergenic
943134185 2:183890814-183890836 ATCAAAAAGGAGAAGGAGAGAGG + Intergenic
943190571 2:184673101-184673123 ATGAAATAAAAGAAGGAGGAAGG + Intronic
943206287 2:184901257-184901279 ATTACAAAGGATAAAGAGGAGGG + Intronic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
944256267 2:197626263-197626285 ATGTAAAAGGAGAATAAGCATGG + Intronic
944285749 2:197948105-197948127 ATGAGAAATGAGAAACAGGATGG + Intronic
944328770 2:198440517-198440539 AATAAATAGGAGAATGAGGAGGG + Intronic
944542828 2:200769742-200769764 ATGAAAAAGAAGAAAGGGAAAGG - Intergenic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945719230 2:213397974-213397996 ATTAAGAAGGAGAACATGGAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946076477 2:217077743-217077765 ATGAAAAAGCAGAACAAAGAGGG - Intergenic
946111671 2:217425127-217425149 ATGAAAAAGGGGAATGAGCCAGG - Intronic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
948096212 2:235336060-235336082 AGAGAAAAGGAGAAGGAGGAGGG - Intergenic
948533180 2:238626523-238626545 CTGAGAAAGGAGAACAAGGAGGG - Intergenic
1168838089 20:891131-891153 ATGAAAAAGGGGAAACAGCAAGG + Intronic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1169472050 20:5894938-5894960 ATGAATAAGGAAAAAGAGGTGGG - Intergenic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170152220 20:13237561-13237583 ATGAAAAGGGAGTCCAAGGAGGG + Intronic
1170235433 20:14098981-14099003 ATAAAAAAGCAGAACGTGGCTGG + Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1170779611 20:19412542-19412564 AGGAAGACGGAGAAGGAGGAGGG + Intronic
1170912480 20:20587260-20587282 AGGAAAAGGGAGAAAGAGGTGGG + Intronic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172811337 20:37650257-37650279 ATGAAAGAGGAAGAGGAGGAGGG - Intergenic
1173343624 20:42177869-42177891 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1173673988 20:44817896-44817918 AAGAAAAAAGAGAACTAGGTAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173757533 20:45531187-45531209 ATGAAAAGGGAGTAGAAGGAAGG - Intergenic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173890923 20:46509600-46509622 ATGGAAAATGAGAAGGAGGTGGG - Intronic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174865323 20:54130308-54130330 ATCAAAATGGAAAAAGAGGATGG - Intergenic
1175374708 20:58516043-58516065 CAGAAAAAAGAGAACCAGGAAGG + Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175732067 20:61360940-61360962 ATGAAAATGTAGCAGGAGGAGGG + Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1178003503 21:28191648-28191670 TTGAAAAAGGAGAACAAAGTTGG + Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1178712870 21:34934913-34934935 ATGAAAAAGGGGAAAAATGAAGG - Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179147698 21:38782942-38782964 ATGAAAAAGGAGGCTGAGCACGG - Intergenic
1179149098 21:38795203-38795225 AGCAAAGAGGAGAATGAGGAAGG + Intergenic
1179498100 21:41787505-41787527 AAGAACAATGAGAACGTGGATGG - Intergenic
1180191184 21:46163775-46163797 TTGAAAAAGGAGAACATTGAGGG - Intronic
1180592938 22:16956206-16956228 ATGAAGAAGGTGAACAAGAAGGG + Intergenic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181915874 22:26279444-26279466 AGGAAAGAAGAGAAGGAGGATGG - Intronic
1182402208 22:30087184-30087206 ATGGAACATGGGAACGAGGAAGG + Intronic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1183230087 22:36576638-36576660 AAGAAAGAGGAGAACAAAGATGG + Intronic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949152068 3:781328-781350 ATAAAACAGCAGAATGAGGAAGG + Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949366270 3:3285001-3285023 AGGAAGAAGGAGAAGGAGAAGGG - Intergenic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950248257 3:11441641-11441663 AAAAAAAAGGAGAAAGGGGAAGG - Intronic
951472589 3:23072044-23072066 ATGTAAAAAGAGAACTAAGAGGG + Intergenic
951865836 3:27306264-27306286 ATGACAAAGGATTACAAGGATGG - Intronic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952285113 3:31960846-31960868 ATTAAAGAGGATAAAGAGGATGG - Intronic
952588356 3:34920506-34920528 ATTAAGAAGGAGAATGAGAATGG - Intergenic
952666634 3:35913521-35913543 CTGAAAAAGGTGAACGTGTAAGG - Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
952926866 3:38326663-38326685 AGGAGAAAGGAGGAAGAGGAGGG - Intergenic
953903732 3:46857834-46857856 AGGAAAAAAGAGAGGGAGGAAGG + Intergenic
954000151 3:47550124-47550146 ATGAAGAAGAAGAAGGAGAAGGG - Intergenic
954093904 3:48307461-48307483 ATGAAAATGGAGAAAGAAGAGGG - Intronic
954130579 3:48558715-48558737 CTGCAAAAGGAGGATGAGGAAGG - Intronic
954367420 3:50154107-50154129 AGGAAAGAGGAGAAAGAGGAGGG + Intergenic
955123576 3:56086269-56086291 AACAAAATGGAGAGCGAGGATGG + Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955475336 3:59330384-59330406 AGGAGAAAGGAGAAGGAGAAAGG + Intergenic
955959673 3:64327429-64327451 AGGAAAAAAGAGAAAAAGGAGGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956530409 3:70211724-70211746 AAGAAAAAGGAAAAAGAGAAAGG - Intergenic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
956842659 3:73155036-73155058 ATCAAAAAGGGGGAAGAGGAGGG - Intergenic
957468344 3:80624840-80624862 ATGAAAGAGGACACCAAGGAAGG + Intergenic
957549952 3:81691294-81691316 AAGAAAAAGGAGAACAAAAATGG + Intronic
957573289 3:81976712-81976734 AAGAAGGAGGAGAAAGAGGAGGG + Intergenic
957765953 3:84623913-84623935 AAGAAAAATAAGAACGAGAAAGG + Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
959188300 3:103075593-103075615 TTGAAAAAGGAGAAAATGGAGGG + Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959742910 3:109741532-109741554 ATGAAAAAAGAGAATGTGCAAGG - Intergenic
960099245 3:113721636-113721658 AAGAAAAACAAGAACAAGGAGGG + Exonic
960254719 3:115499640-115499662 ATGAAAAGGGAAGACGTGGAAGG - Intergenic
960285754 3:115826599-115826621 ATGACAAAGGAGAATGAAGCAGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960758014 3:121039740-121039762 AATAAAAAAGAGAAAGAGGAGGG - Intronic
961080254 3:124020888-124020910 AGGAAAAAGGAGAAAGAAAAAGG + Intergenic
961608226 3:128114189-128114211 CTGAAACAGGAGCACGAGTAAGG + Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962795304 3:138844808-138844830 TTGAAAAAGGAGAGGGAGGCTGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963010933 3:140769728-140769750 AGGAAAAAGGAGAAAGAACAGGG - Intergenic
963303088 3:143620613-143620635 TTGAAAAAGGAGAAACAGGGGGG + Intronic
963367982 3:144363268-144363290 AGGCAAAAGGAGAACCAGAAGGG + Intergenic
963431286 3:145207685-145207707 ATGAAAAAGAAAAAGAAGGAGGG + Intergenic
964036482 3:152205461-152205483 ATTAAAATGGGGAAGGAGGAGGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
965545833 3:169915501-169915523 AGGAAAAAGGAGAAGGAAAAAGG - Intronic
965550775 3:169962850-169962872 ATGAAGAAGAAGAAGGAGCAAGG - Intergenic
965637464 3:170798226-170798248 CTGAAAAAGGAAAACTATGATGG + Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
965898449 3:173608734-173608756 AGGAAAAAAGAGAGAGAGGAAGG - Intronic
965906494 3:173713980-173714002 AAGAAAAAGGAGAAAGATGAAGG + Intronic
966210580 3:177449517-177449539 AGGAGCAAGGAGACCGAGGAAGG + Intergenic
966416509 3:179694831-179694853 AGAAAAGAGGAGAAAGAGGAAGG + Intronic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
966922349 3:184620924-184620946 TTGAAAAAGGAGTACAATGAGGG + Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967949752 3:194831738-194831760 ATGAAACAGGAGACATAGGAGGG + Intergenic
968161611 3:196431962-196431984 ATGATGAAGGAGGAGGAGGAGGG + Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969394964 4:6914741-6914763 ATTAAAAAAGAGAAAGAGGCTGG + Intronic
969726069 4:8918951-8918973 AAGAAAAAGAAGAATGAGAAAGG - Intergenic
969957376 4:10904836-10904858 TTGAAAAAGAAGAACCAGGTAGG + Intergenic
970010264 4:11450839-11450861 ATGAACAAGGAGAACTGAGAAGG - Intergenic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
970334387 4:15019714-15019736 ATGAAAAAGGAGAAGGGAGTTGG + Intronic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971661707 4:29426169-29426191 AGGAAAAAAGAAAACAAGGAAGG - Intergenic
971778194 4:30995522-30995544 AAAAAAAAGATGAACGAGGAAGG + Intronic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972580618 4:40392786-40392808 ATGAGAAGAGAGAACAAGGATGG + Intergenic
972881254 4:43426024-43426046 ATAAAAGAGGAAAAGGAGGAAGG + Intergenic
972887114 4:43506040-43506062 ATTAAAAAGTAAAACGAGGCCGG - Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973278838 4:48338542-48338564 ATGAAACAGGATTAAGAGGATGG + Intergenic
973681537 4:53325420-53325442 ATAAAAAAGAAGAAAGATGAAGG + Intronic
973779111 4:54271851-54271873 AGGAAAAGGGAGAACAAGGGAGG - Intronic
973802040 4:54487792-54487814 GTGAAAAAGGAGAATGATTATGG - Intergenic
973977561 4:56278208-56278230 TTGAAAAAGGAGAACAAAGATGG + Intronic
974136922 4:57830071-57830093 AGGAAGAAAGAGAAAGAGGAAGG + Intergenic
974187753 4:58463473-58463495 ATCAAAAAGGGGAAGGAGAAGGG + Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975191510 4:71468449-71468471 AAAAAAAGGGAGAACGAGAAAGG - Intronic
975495415 4:75030890-75030912 ATGTAAGAGGAGGAGGAGGAGGG + Intronic
975838694 4:78451790-78451812 ATGGAACAGGAGAACCTGGAGGG + Intronic
976001706 4:80381871-80381893 AGGAAAAAGGAACAGGAGGAAGG - Intronic
976544783 4:86321991-86322013 TTAAAAAAGGAGATCTAGGATGG - Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976951040 4:90830927-90830949 ATGAAAAAGGACAATGGGAAGGG - Intronic
976956001 4:90901109-90901131 ATGAAAAACAAGAAAGAGCAGGG - Intronic
977328353 4:95605504-95605526 ATGACAAAGAAGAAGGAGAACGG - Intergenic
977539292 4:98297005-98297027 AAAAAAAAAGAGAACGAGGCAGG - Intronic
977966538 4:103156284-103156306 TTGAAAAAGAAGAACGAAGTTGG + Intronic
977983543 4:103355146-103355168 AAGAAAGAGGAGGAAGAGGAGGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981111476 4:140939439-140939461 AGGAAAGAAGAGAAAGAGGAAGG + Intronic
981310534 4:143293927-143293949 CTGAGATAGGAGAACCAGGAAGG - Intergenic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982234484 4:153239688-153239710 AAGAGAAAGGAGAACAAGAAAGG - Intronic
982316527 4:154037546-154037568 ATGGCAAAGGAGAAGGAGGTTGG - Intergenic
982445760 4:155489161-155489183 AGGGAAAATGAGAACAAGGAAGG - Intergenic
982855964 4:160383500-160383522 ATGAAAAACAAGAATGGGGAGGG - Intergenic
983019134 4:162653529-162653551 AAGAAAAAGGACAAGGAGGTTGG - Intergenic
983273655 4:165592059-165592081 ATGAACAAAGAGAAAGAGGGAGG - Intergenic
983296300 4:165873348-165873370 TTGAAAGGGGAGACCGAGGAAGG - Exonic
983450769 4:167908250-167908272 AAGAAAAAGGAGAACATTGAAGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983731550 4:171000191-171000213 AGGAAAAAAGAGAGCAAGGAAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984791318 4:183617390-183617412 TTGAAAAAAAAGAAAGAGGAAGG - Intergenic
984795996 4:183660489-183660511 ATTAAAAAGTAAAACGTGGATGG - Intronic
985376444 4:189344664-189344686 ATGAAGATGGAGAACAGGGAAGG + Intergenic
985487314 5:158721-158743 AGGAAGGAGTAGAACGAGGAAGG - Intronic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985895024 5:2743775-2743797 TTGGAAAAGATGAACGAGGAAGG - Intergenic
985934582 5:3086655-3086677 TTGAAAAAGAAGAACAAAGATGG + Intergenic
986143542 5:5054682-5054704 AAGAAAAAGAAGAAAGAAGAAGG + Intergenic
986228203 5:5836764-5836786 ATGACACAGGAGAATCAGGAGGG - Intergenic
986377667 5:7148793-7148815 ATGAAAAAAGAGAAGCAGCAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986601987 5:9481646-9481668 AAGAAAAAGGAGAGCAAGAAAGG - Intronic
986703890 5:10439644-10439666 ATGGAAAAGGAGAGAGAGCAGGG - Exonic
986901179 5:12435738-12435760 ATGAAAAAAGAGGAAAAGGAAGG - Intergenic
987263807 5:16230146-16230168 GTGAAAAAGGAGATAAAGGAAGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987427331 5:17788220-17788242 ATGAAAAAAGAGAAGACGGAGGG - Intergenic
987579915 5:19776457-19776479 AAGAAAGAGGAGGAAGAGGATGG + Intronic
987849632 5:23333736-23333758 AAAACAAAGGAGAAAGAGGAAGG - Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988092231 5:26558642-26558664 ATGAAAAAAGAAAAAAAGGAAGG + Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
991000840 5:61781282-61781304 ATGAAGAGGGAGCAAGAGGATGG + Intergenic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
991975154 5:72177921-72177943 AGGAAAAAAGAGAGGGAGGAAGG - Intronic
992133615 5:73720344-73720366 TTGAAAAAGAAGAAAAAGGAAGG + Intronic
992455606 5:76912749-76912771 ATCAAAAAGGGGAAGGAGAAGGG + Intronic
992729954 5:79654139-79654161 ATGAAAAAGGAGGCCGGGCACGG + Intronic
992861813 5:80918949-80918971 AAGAAAAAAGTGAAGGAGGAAGG + Intergenic
992912667 5:81412601-81412623 ATGAGAATGGAGGAGGAGGAGGG - Intergenic
993130472 5:83891458-83891480 ATGAAATTGCAGAACCAGGAAGG + Intergenic
993313329 5:86366363-86366385 ATGAAAAAGGAGAAAAAATATGG - Intergenic
993366193 5:87036512-87036534 ATGAAAAAAGAAAAGGAAGATGG - Intergenic
993672746 5:90781518-90781540 ATGAAAAATGATAACGCAGAAGG + Exonic
994130839 5:96225893-96225915 AAGAAAAAGGAGAAGAAGAATGG - Intergenic
994631024 5:102288107-102288129 ATCAAAAACTAGAATGAGGAAGG + Intronic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
994864774 5:105253331-105253353 ATGAGAAAGGAAAATGAGCATGG + Intergenic
995294138 5:110499135-110499157 ATAGAAAAGGAGAAAGAGCAGGG + Intronic
995541990 5:113194680-113194702 AAGAAAAAGAAGAAAGGGGAAGG + Intronic
995994172 5:118279696-118279718 ATGAAAAAGGAGAGGGTGAAAGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996809172 5:127494983-127495005 AAGAAAGAAGAGAAAGAGGAAGG + Intergenic
997182893 5:131850383-131850405 ATGAAAAAGAAGAACAAAGCTGG + Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998797055 5:145831795-145831817 ATGAAAAGGCAGAACTGGGAAGG - Intronic
999000505 5:147916777-147916799 AAGAAAAAGAAGTAAGAGGATGG + Intergenic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999547895 5:152651051-152651073 AGGAAAATGGAGAAAGTGGAGGG - Intergenic
999831190 5:155321910-155321932 ATGAACAAGGAGATGGGGGAGGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1000968268 5:167685425-167685447 AGGAAAAAGAAGGCCGAGGAAGG - Intronic
1000997796 5:167976121-167976143 AGGAAAGAAGAGAAAGAGGAAGG - Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001152840 5:169247240-169247262 ATGGAAAAGGAAGACGAGAAGGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002157915 5:177297245-177297267 ATGAAAGGGGAGAACTAGGCAGG - Exonic
1002692603 5:181060596-181060618 TTTAAAAAGGAGAAACAGGAAGG + Exonic
1002795100 6:465644-465666 AGGAGAAAGGAGAAAGAGGATGG - Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003335584 6:5168899-5168921 GTGATAAAGGAGAGGGAGGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003777888 6:9389888-9389910 ATGAAAAAGGAGGCAGGGGATGG + Intergenic
1003817626 6:9859942-9859964 ATGAAGAAGGAGGAGGAGAAGGG + Intronic
1003905668 6:10697444-10697466 ATGAAAAAGAAGATTGAGCATGG + Exonic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1004589719 6:17037837-17037859 ACGAAAAAGGAGAATCTGGATGG - Intergenic
1004751301 6:18565463-18565485 ATGAAAAAAGGGAGGGAGGATGG - Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1005040749 6:21597354-21597376 AGGAAAAAGAAATACGAGGATGG - Exonic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005648294 6:27863459-27863481 ATTAAAATGGAGAAAGAGGAAGG - Intronic
1005795484 6:29356607-29356629 ATGAAAAAGGAGAGCAGGGATGG - Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006069931 6:31490908-31490930 AGGAAGAAGGAGCACGAGGGAGG - Intergenic
1006085294 6:31590830-31590852 AAGAAAAAAGAAAAAGAGGAAGG - Intronic
1006635712 6:35459889-35459911 CTCATAAAGGAGAAAGAGGATGG - Intronic
1007394564 6:41570219-41570241 AAGAAAAAGGAGAATGCAGAAGG - Intronic
1008014003 6:46497457-46497479 ATGGAAAAGGAGAAGAAGTATGG - Intergenic
1008265135 6:49415655-49415677 ATGAGAGAGTAGAAAGAGGAAGG + Intergenic
1008439490 6:51516302-51516324 AAAAACAAGGAGAACCAGGAAGG - Intergenic
1008641080 6:53463393-53463415 ATAAAAAGGGAGAAAGAGAAAGG + Intergenic
1009417905 6:63436145-63436167 AGGAAAAAAGAGAATGAAGATGG - Intergenic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009726340 6:67540575-67540597 ATGAAAGAGGAGAGAGAGAATGG + Intergenic
1009860944 6:69331300-69331322 ATCCAAAAGGAGAAAGAGAAAGG - Intronic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1012455639 6:99401437-99401459 AAGAAAAAGAAAAACAAGGAAGG - Exonic
1012553028 6:100481604-100481626 CTGAAATAGGAAAACCAGGAGGG - Intergenic
1012768474 6:103398467-103398489 AAGAAAAAAGAGAACAAAGATGG - Intergenic
1013036548 6:106390391-106390413 AAGAAAAGGGAGAGAGAGGAGGG - Intergenic
1013670456 6:112396702-112396724 ATAAGAAAGGAGAATGAGGTTGG - Intergenic
1014214281 6:118737661-118737683 GAGAAAGAGGAGAACTAGGAGGG + Intergenic
1014760659 6:125353081-125353103 ATAAAGAAAGAGAACGAGAAAGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1015326877 6:131933478-131933500 ATTAAGAAGGAGAATGAGGGTGG + Intergenic
1015510504 6:134033737-134033759 ATGAAAGAGGAAAACAAGAAAGG - Intronic
1015515351 6:134077929-134077951 ATGAAGAAGGATAACCAAGAAGG + Intergenic
1016048724 6:139507156-139507178 ATGAAAAAGAAAAAGGAGAATGG - Intergenic
1016285296 6:142465870-142465892 AGGAAAAAGTAGAACGGGGTAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016608518 6:145962479-145962501 ATGAAATACTAGAACGAGGCAGG + Intronic
1016895326 6:149045758-149045780 AAGAAAATGGAGAACTAGAAGGG - Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017147144 6:151244627-151244649 ATGGAAATGGAGAACGAAGATGG + Intronic
1017531577 6:155297652-155297674 ATGTAAAAGGAAAAACAGGAGGG + Intronic
1018299456 6:162385603-162385625 ATGAGAAAGGAGAGCGGGAAAGG - Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018504206 6:164446172-164446194 ATCAAAAAGCAGAGGGAGGATGG + Intergenic
1018519959 6:164637152-164637174 ATAAAAAAGGAAAACAAAGAAGG + Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019398432 7:836205-836227 AAGATGTAGGAGAACGAGGAAGG + Intronic
1019805046 7:3117547-3117569 AAGAGAAAGGAGAGAGAGGAGGG + Intergenic
1019971119 7:4541684-4541706 TTGAAGAAGGAAAACAAGGAAGG - Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020386577 7:7611225-7611247 ATGAAAAAGAAGAAAGCGAAAGG + Intergenic
1020530717 7:9330808-9330830 AAGAAAAAAGAAAAAGAGGAAGG - Intergenic
1021305261 7:19023931-19023953 AAGTAAAAGCAGAACGTGGATGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022816001 7:33914802-33914824 AGGCAAGAGGAGAACCAGGAAGG + Intronic
1023047089 7:36219590-36219612 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023047096 7:36219639-36219661 AAGAAGAAGGAGGAAGAGGAAGG + Intronic
1023114687 7:36851062-36851084 AAGAAAAATGAGAAAGAGAAAGG - Intergenic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023584391 7:41714244-41714266 AGGAAGAAAGAGAAAGAGGAGGG + Intergenic
1024731129 7:52254978-52255000 AAGAAAAAGGAGAAGAAAGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025887072 7:65606243-65606265 ATAAAAGAAGAGAACCAGGAAGG - Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026079399 7:67204491-67204513 ATAAAAAAAGAGAAGAAGGAAGG - Intronic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026205600 7:68254936-68254958 AAGAAAAAGGAGGAAGAGAAAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027143038 7:75673317-75673339 TTGAAAAAGAAGAACAAGGCCGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028439326 7:90840695-90840717 AGGAAAAAGGATAAAGAGAAAGG - Intronic
1028472463 7:91220089-91220111 ATGAAAATGGAGAGAAAGGAAGG - Intergenic
1029336432 7:99903800-99903822 GTGCCAAAGGAGAAAGAGGAGGG - Intronic
1029409211 7:100398048-100398070 AGGACAAAGGAGAACAAGGATGG - Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030272625 7:107686389-107686411 AAGAAAAAAGAGAGAGAGGAAGG - Intronic
1030551372 7:110964778-110964800 AGGAAAAAATAGAAAGAGGAAGG - Intronic
1030583098 7:111384308-111384330 AGGGAAAAGGAGAAGGAGGAGGG + Intronic
1030673221 7:112360024-112360046 TTGAAAAAGAAGAACAAGGTTGG + Intergenic
1030880121 7:114867472-114867494 ATGACAAAAGAGAAGAAGGAGGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031211485 7:118834122-118834144 ATGAAAAAGGAAAACAAAGGAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031855343 7:126915685-126915707 ATAAAAGAAGAGAACCAGGAAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1032294486 7:130623516-130623538 CTGAAAAAGGAAAACCATGAGGG - Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032798962 7:135302872-135302894 AAGAAAAAAGAGAGAGAGGAAGG + Intergenic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1034230522 7:149523411-149523433 ATGAAGAAGGAGAACAAAGTTGG + Intergenic
1034510988 7:151534514-151534536 TTGAAAAAGAAGAACAAGGTTGG - Intergenic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034905157 7:154938040-154938062 TTGAAAAAGGAGAACAAAGTTGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035668327 8:1396003-1396025 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1035669025 8:1402236-1402258 ACGACTCAGGAGAACGAGGAGGG - Intergenic
1037311564 8:17561790-17561812 ATGAAAAAGAAGAAAGGGCAAGG + Intronic
1037356452 8:18024863-18024885 ATCAGAAGGGAGAACTAGGAGGG + Intronic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1037915370 8:22769653-22769675 GTGATAAAGGAGAAAGAGGCTGG - Intronic
1038139611 8:24829916-24829938 ATGAAAAAGGAGAACAATATAGG + Intergenic
1038175860 8:25181918-25181940 ATGAAAAAGAACCAAGAGGAGGG - Intergenic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038906534 8:31910309-31910331 ATGAAAATGGAGACAGAGGCGGG + Intronic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039513157 8:38107566-38107588 ATGAGAAAGGAAAAAAAGGATGG - Intronic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1040582635 8:48709578-48709600 ACGAAAGAGGAGGAAGAGGAGGG - Intergenic
1040857727 8:51967446-51967468 AGGAAACTGGAGAAAGAGGAAGG + Intergenic
1041321249 8:56615151-56615173 AGGAAAAAAGAGAAAGAGGAAGG - Intergenic
1041549454 8:59083173-59083195 AGGAAAAAAGAGAAAGTGGAAGG + Intronic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1041846977 8:62340465-62340487 GTGAAATAGGAGAAGGAGAAAGG + Intronic
1041971035 8:63742872-63742894 TTGAGAAAGGAGAACGTGCAAGG - Intergenic
1042100568 8:65271516-65271538 ATGAAAAAGGAGGACGGGGGAGG + Intergenic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043315811 8:78920294-78920316 AGGAGAAAGAAGAACTAGGAAGG + Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043975072 8:86575591-86575613 ATGAAAACGGAGAATAGGGATGG + Exonic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045085404 8:98677528-98677550 AAGACAAAGGAGGAAGAGGAAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046184474 8:110694624-110694646 AGGAAGAAGGACAAAGAGGAAGG + Intergenic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1046760716 8:118017217-118017239 ATGTATAAGGAGAATGAGGTAGG - Intronic
1047091214 8:121577824-121577846 ATGAAAAATGAGGAAGAGAAAGG + Intergenic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047222338 8:122928499-122928521 ATGAAAATGGGGAACCAGCATGG + Intronic
1047568487 8:126072785-126072807 AAGAAAAAGGAGAAAAAGAAGGG + Intergenic
1048167350 8:132075209-132075231 ATGAAAAAGGAGACGGGGCAGGG + Intronic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048403759 8:134097269-134097291 AAGAAAAAGGAGAAATAGGGAGG + Intergenic
1048557629 8:135496138-135496160 ATGAGAAAGCAGAAGTAGGAAGG + Intronic
1048769904 8:137884147-137884169 AAGGAAAAGGAGAAGGAGCAGGG - Intergenic
1048996579 8:139797939-139797961 TTGAAAAAGAAGAACGAAGTTGG - Intronic
1049356804 8:142193077-142193099 AGGAAAAAGGAGCAGGAGGGAGG + Intergenic
1050008876 9:1164322-1164344 ATGAAAAAAGGGAGGGAGGAAGG - Intergenic
1050181649 9:2929180-2929202 TTGAAAAAAGAGAAGAAGGAAGG + Intergenic
1050908358 9:11034715-11034737 ATTAAAAAGGATAATGATGATGG - Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051267708 9:15324473-15324495 ATGAAAAAGAAGAACAAAGTTGG + Intergenic
1051714614 9:19969252-19969274 ATGAAAAAGGAAAAGAATGAAGG - Intergenic
1052005984 9:23349476-23349498 ATGAGAAAGGAGATCCAGCAGGG - Intergenic
1052387686 9:27841264-27841286 ATAAAAAGGGAGAAGGAAGAAGG - Intergenic
1052609465 9:30753967-30753989 ATCAAAAAAGAGAATGATGAAGG + Intergenic
1053154227 9:35763961-35763983 TTGAGAAAGGAGAGAGAGGAGGG + Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1054856273 9:69902801-69902823 ATGAAATAGGAGAACAAGGCAGG - Intronic
1055212762 9:73817170-73817192 AGGAAAAAGGAGAAAAAGGCGGG + Intergenic
1055238851 9:74159309-74159331 GTCAAAAAGGAGCAAGAGGAGGG + Intergenic
1055450240 9:76424841-76424863 ATAAAAAAGGACATCGAGGCTGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057339816 9:94190062-94190084 ATGGAAAATGAGAAGCAGGAGGG - Intergenic
1057344457 9:94236286-94236308 TTGAAAAAGAAGAACGATGTGGG + Intergenic
1057992550 9:99785419-99785441 ATGATAAAGGAAAAAGAGAATGG + Intergenic
1058159505 9:101552549-101552571 AAGAAGAACGAGAACGAGAAAGG + Exonic
1058245682 9:102622086-102622108 ATTAAAAAGGAAAACCAGGATGG - Intergenic
1058437255 9:104974449-104974471 AGGAAAGAGGAAAAAGAGGAAGG - Intergenic
1058556404 9:106173312-106173334 AAGAAGAAGGAGAACAAGAAGGG - Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058696595 9:107564275-107564297 ATGAAAAAGGAAAAGAGGGAAGG + Intergenic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059646733 9:116275624-116275646 AGGAAAAAGGGGGAAGAGGAAGG - Intronic
1060517027 9:124272266-124272288 ATGAACAAAGAAAACAAGGAAGG - Intronic
1061541617 9:131280532-131280554 CTGAAAAATGAGAAAGAGGAGGG + Intergenic
1061899686 9:133666522-133666544 AGGAAAAAGGGGAGAGAGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062635817 9:137490726-137490748 ATGAAAGAAGAGCAGGAGGACGG + Intronic
1062638357 9:137503420-137503442 AGAAAGAAGGAGAATGAGGAGGG + Intronic
1062638390 9:137503515-137503537 AGGAGGAAGGAGAAGGAGGAGGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185532371 X:832242-832264 ATGATAAATGAAAACGAGGCCGG + Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185875711 X:3700563-3700585 AAGAAAAAAGAGAAAGAAGAAGG - Intronic
1186471173 X:9823132-9823154 AGGAAGAAGGAGAAGGAGAAGGG - Intronic
1186615567 X:11183623-11183645 AGGAAAAAGGAGACAGAGGGAGG - Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025810 X:15434275-15434297 AAGAAAGAGGAGAAAGAAGAAGG + Intronic
1187529713 X:20085252-20085274 AGGAAAGAGGAGAAGAAGGATGG + Intronic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188128778 X:26404189-26404211 ATGATAAAGGAGAAGGAGCAAGG + Intergenic
1188218049 X:27502994-27503016 AAGAAAGAGGAGAAAGAAGAGGG + Intergenic
1188730894 X:33645456-33645478 AAGAAAAAGGAGGATGAGAAAGG + Intergenic
1189248355 X:39580824-39580846 ATGAGAGAGGAGAGAGAGGAGGG - Intergenic
1189400112 X:40659951-40659973 ATGAAGAAGGAGAACTAGATGGG + Intronic
1189446055 X:41082959-41082981 TTGAAAAAGGAGAACAATGTTGG - Intergenic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1189719698 X:43903705-43903727 AGGAAAAACAAGAACAAGGAGGG + Intergenic
1190490420 X:50977115-50977137 ATGATAAAGGAGAACGAATTTGG - Intergenic
1190583866 X:51917721-51917743 AACAAAAAGGAGAACAGGGAGGG - Intergenic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191616119 X:63171252-63171274 ATGAAAAACAAGAAAGAGCAGGG + Intergenic
1191620178 X:63207671-63207693 ATGAAAAACAAGAAAGAGCAGGG - Intergenic
1192125807 X:68499613-68499635 ATAAGAAAGGAGAACAAGTATGG - Intronic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192331069 X:70175610-70175632 AAGAAAGAGGAGGAAGAGGAAGG + Intergenic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1192497341 X:71624782-71624804 ATCAAAAAGGAGAATAAGGCCGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193667118 X:84334441-84334463 AGGAAAAGGGAGAAAGAGAAAGG + Intronic
1193940556 X:87676753-87676775 AGGAAAAAGGAGAAAAAGGGGGG + Intergenic
1194935902 X:99948588-99948610 ATGAAAAAGGAGAATTACAAGGG + Intergenic
1195269553 X:103215887-103215909 AGCAAAATGGAGGACGAGGATGG - Intronic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195679001 X:107529804-107529826 AGGCGAAAGGAGGACGAGGAAGG - Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195789650 X:108569526-108569548 AAGGAAAAGGAGAAAGGGGAGGG - Intronic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195973966 X:110505161-110505183 AAGGAAAAGGAGAAGGAGAAGGG - Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196050094 X:111295859-111295881 ATGAAAATGGAGAAGAAGAAAGG + Exonic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196938296 X:120751203-120751225 AGGAAAAAGGAGAAGAGGGAGGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198652721 X:138880867-138880889 ATGAAAAAGAAGAACAAAGTTGG - Intronic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199328588 X:146531453-146531475 AAGAAAAAGGAGAATGAATAAGG + Intergenic
1199435190 X:147804985-147805007 AAGAAAAAGGACAGCGAGAAAGG + Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic
1201010424 Y:9545471-9545493 CTGATCAAGGAGAAAGAGGAGGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201342244 Y:12947188-12947210 AATAAATAGGAGAACCAGGATGG - Intergenic
1201568233 Y:15388457-15388479 ATCAAAAAGGGGAAGGAGAAGGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic