ID: 933791850

View in Genome Browser
Species Human (GRCh38)
Location 2:85889163-85889185
Sequence CCCCGGGTGCGTCCCTGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933791850_933791859 -8 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791859 2:85889178-85889200 ACCCGGGGCGGGGGCCAGGCTGG 0: 1
1: 0
2: 5
3: 68
4: 643
933791850_933791867 19 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791867 2:85889205-85889227 AGCCCCCCTTGGTTCTGGAGAGG 0: 1
1: 0
2: 1
3: 9
4: 141
933791850_933791863 -6 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791863 2:85889180-85889202 CCGGGGCGGGGGCCAGGCTGGGG 0: 1
1: 2
2: 15
3: 181
4: 1858
933791850_933791866 14 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791866 2:85889200-85889222 GGGCGAGCCCCCCTTGGTTCTGG 0: 1
1: 0
2: 1
3: 4
4: 67
933791850_933791865 8 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791865 2:85889194-85889216 AGGCTGGGGCGAGCCCCCCTTGG 0: 1
1: 0
2: 1
3: 18
4: 189
933791850_933791861 -7 Left 933791850 2:85889163-85889185 CCCCTGCAGGGACGCACCCGGGG 0: 1
1: 0
2: 0
3: 11
4: 129
Right 933791861 2:85889179-85889201 CCCGGGGCGGGGGCCAGGCTGGG 0: 1
1: 0
2: 3
3: 97
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933791850 Original CRISPR CCCCGGGTGCGTCCCTGCAG GGG (reversed) Intergenic
900095687 1:939255-939277 CCCCGGGTCCTCCCCAGCAGAGG + Exonic
900539550 1:3196042-3196064 CCCCAGGTTTGTCCATGCAGGGG + Intronic
900579745 1:3403135-3403157 CCCAGGGTGTGTCCCACCAGGGG - Intronic
900719335 1:4165165-4165187 GCCTGGGTGGGGCCCTGCAGAGG - Intergenic
900992071 1:6102666-6102688 CCCCGGGTGCTCCCCTGCCGAGG - Exonic
901088404 1:6625663-6625685 CCCCAGGGGCGTCCTGGCAGTGG + Intronic
903216444 1:21846089-21846111 CCCGGTGAGGGTCCCTGCAGTGG - Exonic
906258462 1:44368198-44368220 CCCAGGGCTCATCCCTGCAGTGG - Intergenic
906365377 1:45205873-45205895 CCCCGGGGGCGTCGCGGCTGGGG - Exonic
916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG + Exonic
917944504 1:179955011-179955033 CACCCGGTGCGTCCCCGGAGCGG + Exonic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
1062896970 10:1110754-1110776 CGCCGGGGGCTTCTCTGCAGTGG + Intronic
1065815660 10:29480425-29480447 CCTCTGCTGCGTCCGTGCAGTGG - Intronic
1066480915 10:35794840-35794862 CCCCAGGCGCAGCCCTGCAGCGG - Intergenic
1072996238 10:100247114-100247136 CCCTTGGTGAGCCCCTGCAGAGG - Intronic
1073466196 10:103695875-103695897 TTCCGGGTCCCTCCCTGCAGGGG + Intronic
1075544387 10:123343385-123343407 CCCCTGCTGACTCCCTGCAGAGG - Intergenic
1076421466 10:130335204-130335226 CCCCGAGTGTGCCCCTGGAGCGG - Intergenic
1079110288 11:17601575-17601597 CCACTGGTGCGTCCCACCAGGGG + Intronic
1089363049 11:117903794-117903816 CCCCCGCTGTCTCCCTGCAGGGG + Exonic
1090662324 11:128891124-128891146 CCCCGGCTGCACCCCTGCTGCGG - Intergenic
1090803176 11:130187351-130187373 CCCCGGGTTCCTCCCTGCCAAGG - Intronic
1090835259 11:130449232-130449254 CCCCCGGTGAGCCCCTGGAGGGG - Exonic
1102298957 12:111757599-111757621 CCCCGGCTGCCACCTTGCAGAGG + Intronic
1103458932 12:121088752-121088774 CCCTGGGTGTTTCCTTGCAGTGG + Intergenic
1103921139 12:124399745-124399767 CCCTGGGTGGGTTCCCGCAGTGG + Intronic
1105290426 13:19049791-19049813 CCCCGGCCCAGTCCCTGCAGAGG - Intergenic
1105695463 13:22884105-22884127 CCCGCGGAGCATCCCTGCAGGGG + Intergenic
1112330280 13:98472066-98472088 CCCTGTGTGTGTCCCTCCAGTGG - Intronic
1118322097 14:64759292-64759314 CCCTGGCTGCGAACCTGCAGTGG + Intronic
1121103263 14:91264446-91264468 TCCCGGGTGCGTCCCCGCGCTGG + Intergenic
1121111007 14:91313163-91313185 TGCCGGCTGCGTCCCTGCAGCGG + Exonic
1122901999 14:104785870-104785892 ACCCAGGTGCTTCCCTGGAGTGG - Intronic
1124966799 15:34437717-34437739 CCCCGGGAGAGACCCGGCAGCGG - Intergenic
1125760408 15:42092650-42092672 CCCCGAATGCCTCCCTGCTGAGG + Intronic
1128207923 15:65869515-65869537 ACCAGGGGGCGTCGCTGCAGGGG - Exonic
1129361331 15:75026409-75026431 CCCTGGTTGGGGCCCTGCAGTGG + Intronic
1129764069 15:78149809-78149831 CCCCGGCTGCGGCCCTGCTGCGG + Intronic
1131252570 15:90839955-90839977 CCCAGGGGACGTCCCTGCAGTGG - Intergenic
1132055316 15:98647685-98647707 CCCCGGGCGCGTCCCCGCGGCGG - Intergenic
1132393831 15:101458015-101458037 CCCGTGGTACGTCCCTCCAGAGG + Intronic
1132702990 16:1229874-1229896 CCCCTGGTGAGTCCCAGCCGGGG - Exonic
1132705333 16:1240994-1241016 CCCCTGGTGAGTCCCAGCCGGGG + Exonic
1132708464 16:1256357-1256379 CCCCTGGTGAGTCCCAGCCGGGG + Exonic
1132717773 16:1300786-1300808 CCCGGTGTGCGACTCTGCAGAGG + Intergenic
1132743856 16:1428732-1428754 CCCCGGGGCCGGACCTGCAGAGG - Intergenic
1137240141 16:46649089-46649111 CCCCTGCTGCTTCCCTCCAGGGG + Intergenic
1141443281 16:84042854-84042876 CCCCGGGGCCGGGCCTGCAGGGG - Intergenic
1141719986 16:85750799-85750821 CCCGGGCCGCGCCCCTGCAGCGG + Intronic
1141732111 16:85829787-85829809 CCCCGGGGGCCACCGTGCAGGGG + Intergenic
1143231288 17:5357794-5357816 CCTCTGGTGCTTCCCTGCTGTGG - Intronic
1144206030 17:12980129-12980151 CCCTGGTTGAGTCCCTGCACAGG - Exonic
1145747880 17:27333269-27333291 CCCCGGGTCCCTCTCTGGAGGGG - Intergenic
1152023506 17:77794418-77794440 CCCAGGGTGGGTCTCTGCATGGG - Intergenic
1152066859 17:78116986-78117008 CCCCGGGTGTGGCCCCGCTGAGG - Intronic
1152073671 17:78146301-78146323 CCCTGGGTGGGTGCCTGCAGTGG - Intergenic
1152160303 17:78664568-78664590 CCCCGGGTGATTCCCTGAGGCGG + Intergenic
1160298483 18:77658310-77658332 GCCTGGGTGAGTACCTGCAGGGG + Intergenic
1160454162 18:78986195-78986217 TCCCGGGTGCTTCACTGCACAGG + Intronic
1161770291 19:6227234-6227256 TCCCAGGTGCTTCCCTGCTGGGG + Intronic
1162021243 19:7869528-7869550 CCGCAGGTGCGCCCCTGCCGTGG - Exonic
1164574393 19:29397263-29397285 TCCAGAGTGTGTCCCTGCAGTGG - Intergenic
1164888700 19:31804810-31804832 CCCCGGGTTCCCTCCTGCAGTGG + Intergenic
1165750522 19:38256574-38256596 TCCCGGGCGGGTCCCTGCATCGG + Exonic
1167073033 19:47231368-47231390 CGCCGGGGGTTTCCCTGCAGCGG + Intronic
1167750823 19:51379282-51379304 CCCCTGATGCGTCCCTTCAAAGG - Intergenic
1168489325 19:56795218-56795240 TCCTGGGTCCCTCCCTGCAGGGG + Intronic
925084757 2:1099361-1099383 CCCTGGCTGTGTCCCTGGAGGGG + Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932777480 2:74536786-74536808 CCCTGGGGGGGGCCCTGCAGTGG - Exonic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
934882358 2:97995444-97995466 CCCCGGCGGCGTCCCTGCGGCGG - Intronic
947761951 2:232609834-232609856 CCCTGGCCGGGTCCCTGCAGAGG - Intronic
948585509 2:239016477-239016499 CTCCGGGAGCCGCCCTGCAGAGG - Intergenic
949012253 2:241687310-241687332 CCCCGGCTGAGCCCCTGCACTGG - Intergenic
949023645 2:241754967-241754989 CCCTGGGTAGGACCCTGCAGGGG + Intronic
949047909 2:241880596-241880618 CCCTGGGAGAGTCCCTCCAGGGG + Intergenic
1172844079 20:37919392-37919414 CCTCGGGTGCCTCCCTGGGGAGG + Intronic
1173362826 20:42359860-42359882 GCCCTGCTGCGGCCCTGCAGGGG + Intronic
1174503155 20:51000231-51000253 CCCTGGGCGCATCCCCGCAGGGG + Intergenic
1175306930 20:57982647-57982669 CACCGGGTGCTTCTTTGCAGAGG + Intergenic
1175673436 20:60926633-60926655 CCCTGGGTGCATCCCAGGAGAGG + Intergenic
1175939331 20:62530732-62530754 CCAGCAGTGCGTCCCTGCAGAGG - Intergenic
1179245033 21:39625697-39625719 CCCTGTGTGCGCCCCTGCGGGGG - Intronic
1179899304 21:44380743-44380765 GCCCGGGGACCTCCCTGCAGGGG + Intronic
1180014564 21:45074068-45074090 CCCCGCGCTCCTCCCTGCAGCGG - Intronic
1180036118 21:45251129-45251151 CCGAGGGTGGATCCCTGCAGAGG + Intergenic
1182509257 22:30807386-30807408 GCCAGGGTGCCTCCCTGCACAGG + Intronic
1183585547 22:38751035-38751057 CCCCTGGTTCTTCCCTGCACAGG - Exonic
1185265917 22:49903957-49903979 CCCGGTGTGTGTCCCTGTAGAGG + Exonic
1185288201 22:50011604-50011626 CACCGGATGCCACCCTGCAGTGG - Intronic
1203252528 22_KI270733v1_random:124856-124878 CCGCGCGTGCGTCCCGGCTGCGG + Intergenic
952845722 3:37686430-37686452 CCACGCCTGCGTCCCTCCAGTGG - Intronic
952998066 3:38904591-38904613 CCCTGCATGTGTCCCTGCAGCGG - Intronic
955356740 3:58237991-58238013 CCCCCAGTGTCTCCCTGCAGCGG + Intronic
960569713 3:119173656-119173678 GCCCGGGAGATTCCCTGCAGAGG - Intronic
968596243 4:1487323-1487345 TCCCAGCTGCTTCCCTGCAGGGG + Intergenic
968699059 4:2046278-2046300 CAAGGGATGCGTCCCTGCAGAGG - Intergenic
971234594 4:24829686-24829708 TCCCGGGTGAGTCCATGCACAGG - Intronic
981199648 4:141965880-141965902 CCCCTGGTGCTTCCCTGTTGAGG - Intergenic
981429833 4:144645984-144646006 CCCCGGCGGCCTCCCTGCTGCGG - Intergenic
986025076 5:3842996-3843018 CCACCTGTGCCTCCCTGCAGTGG - Intergenic
986176961 5:5360544-5360566 CACCGGCTGCCTCCCTGCAGGGG - Intergenic
989557422 5:42813731-42813753 CCTGTGGAGCGTCCCTGCAGGGG + Intronic
992642542 5:78780447-78780469 CCCCGTGTACTTCCCTGCACAGG - Exonic
992789216 5:80198653-80198675 CCCAGTGTGCGTCCCTACAAGGG + Intronic
992989843 5:82273186-82273208 CCCGTGGAGCGTCCCTGCGGGGG - Intronic
993168375 5:84384642-84384664 CTGCGGGTGGGTCCCGGCAGAGG + Exonic
999763589 5:154721591-154721613 CACAAGGTGCTTCCCTGCAGTGG - Intronic
1002176375 5:177403604-177403626 CCTCGGGTGCGGGCCTGCGGGGG + Exonic
1002701837 5:181130173-181130195 CTGTGGGTGGGTCCCTGCAGGGG + Intergenic
1002703959 5:181147973-181147995 CTGTGGGTGGGTCCCTGCAGGGG - Intergenic
1008130477 6:47715079-47715101 CCCCAGGTCAGTCCCAGCAGTGG - Exonic
1009969817 6:70614668-70614690 CCCCGTCTGTGTCCCTTCAGTGG + Intergenic
1014159830 6:118155220-118155242 CTCAGGGTGCATCCCTGGAGGGG + Intronic
1016311492 6:142738362-142738384 ACCCGGGTGCTTCTCTGCATGGG + Intergenic
1016400400 6:143673809-143673831 CCCTGCGTGAGTCTCTGCAGAGG - Intronic
1021936379 7:25636216-25636238 CCACGGAGGCGTCCGTGCAGAGG + Intergenic
1024939231 7:54745130-54745152 CCCTGGGTGCTTCCCTGGTGTGG + Intergenic
1028609772 7:92697627-92697649 TCCCGGGGGCTTCTCTGCAGTGG - Intronic
1029366369 7:100119153-100119175 CCCCGTGTGTGTGCCTGCATTGG - Intronic
1030262446 7:107580152-107580174 CCGCGGGTCCGTCCCGGCTGAGG - Intronic
1032782127 7:135171783-135171805 CCTGTGGAGCGTCCCTGCAGAGG + Intergenic
1034128911 7:148698574-148698596 CCCCGGGGGCGCCCCTTCCGCGG - Intronic
1034559686 7:151872088-151872110 GCCCGGGTGTGTCTCAGCAGAGG - Intronic
1035129615 7:156640300-156640322 CCCCGGTTGTTTCCCTGCGGTGG - Exonic
1037741985 8:21615596-21615618 CCCCTGGTGCTTCCCTTCTGTGG + Intergenic
1038478737 8:27886934-27886956 CCCCAGGAGGGTCCCTGCAGGGG + Intronic
1039542523 8:38383053-38383075 CCCCGGGTGCCCCCCAGCCGCGG + Intergenic
1039846254 8:41327816-41327838 CCCCTGGTGGGTCCCAGGAGGGG - Intergenic
1047225709 8:122953988-122954010 CTCCGACTGCGTCCCTGCAGAGG + Exonic
1048300248 8:133246035-133246057 GCCGGGGTGCACCCCTGCAGGGG - Intronic
1058835306 9:108854820-108854842 CCCCGGGGACAGCCCTGCAGTGG - Exonic
1061277422 9:129577356-129577378 TCCCGGGTCCCTCCCTGCACAGG - Intergenic
1061375694 9:130223062-130223084 CGCCTTGTCCGTCCCTGCAGGGG + Exonic
1061419778 9:130466848-130466870 TCCCGGGCACGTCCCTGCTGGGG + Intronic
1062047009 9:134429021-134429043 CCCCTGGTGGGACCCTACAGAGG - Intronic
1062122433 9:134841042-134841064 CCCAGGATGCAGCCCTGCAGAGG - Intronic
1062388659 9:136325328-136325350 CCCCTGCTGGGCCCCTGCAGTGG - Intergenic
1185456125 X:311720-311742 CCCGGGGTGCGGCCCCCCAGAGG - Intronic