ID: 933792974

View in Genome Browser
Species Human (GRCh38)
Location 2:85897854-85897876
Sequence CAGTATTAGCAGGTGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933792974_933792978 -10 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792978 2:85897867-85897889 GCTAATACTGGCCAAGCAGCAGG No data
933792974_933792984 28 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792984 2:85897905-85897927 AAAATCTAGACTGGAGCAGAGGG No data
933792974_933792979 -6 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792979 2:85897871-85897893 ATACTGGCCAAGCAGCAGGCTGG No data
933792974_933792981 1 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792981 2:85897878-85897900 CCAAGCAGCAGGCTGGAGATAGG No data
933792974_933792982 19 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792982 2:85897896-85897918 ATAGGAGACAAAATCTAGACTGG No data
933792974_933792983 27 Left 933792974 2:85897854-85897876 CCTGAAGCCACCTGCTAATACTG No data
Right 933792983 2:85897904-85897926 CAAAATCTAGACTGGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933792974 Original CRISPR CAGTATTAGCAGGTGGCTTC AGG (reversed) Intergenic
No off target data available for this crispr