ID: 933794276

View in Genome Browser
Species Human (GRCh38)
Location 2:85907166-85907188
Sequence CCAGTGGAATGGAGTTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933794262_933794276 27 Left 933794262 2:85907116-85907138 CCAGAGAGTAAAGCTCCAGACGC No data
Right 933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG No data
933794269_933794276 5 Left 933794269 2:85907138-85907160 CCCACTGAGGGGAGAGAAGGGAA No data
Right 933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG No data
933794266_933794276 12 Left 933794266 2:85907131-85907153 CCAGACGCCCACTGAGGGGAGAG No data
Right 933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG No data
933794270_933794276 4 Left 933794270 2:85907139-85907161 CCACTGAGGGGAGAGAAGGGAAG No data
Right 933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933794276 Original CRISPR CCAGTGGAATGGAGTTGAGG AGG Intergenic
No off target data available for this crispr