ID: 933798226

View in Genome Browser
Species Human (GRCh38)
Location 2:85938237-85938259
Sequence TTGTTAGCAAGGTCAGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933798226_933798229 2 Left 933798226 2:85938237-85938259 CCCTACACTGACCTTGCTAACAA No data
Right 933798229 2:85938262-85938284 CAAAACCCTTATTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933798226 Original CRISPR TTGTTAGCAAGGTCAGTGTA GGG (reversed) Intergenic
No off target data available for this crispr