ID: 933798466

View in Genome Browser
Species Human (GRCh38)
Location 2:85940782-85940804
Sequence ATCAGGGCTCCTTTGATGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933798459_933798466 -4 Left 933798459 2:85940763-85940785 CCTAGCTATTTCCACCTGAATCA No data
Right 933798466 2:85940782-85940804 ATCAGGGCTCCTTTGATGGGCGG No data
933798457_933798466 27 Left 933798457 2:85940732-85940754 CCAGTGACTAAAGAAGGCAGTGA No data
Right 933798466 2:85940782-85940804 ATCAGGGCTCCTTTGATGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933798466 Original CRISPR ATCAGGGCTCCTTTGATGGG CGG Intergenic
No off target data available for this crispr