ID: 933799025

View in Genome Browser
Species Human (GRCh38)
Location 2:85945006-85945028
Sequence CCATCACTTTGCCTTCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933799025_933799033 28 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799033 2:85945057-85945079 CTCCCAGAAGGAAGAACCTGGGG No data
933799025_933799030 26 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799030 2:85945055-85945077 TCCTCCCAGAAGGAAGAACCTGG No data
933799025_933799029 16 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799029 2:85945045-85945067 ATTAGGATGTTCCTCCCAGAAGG No data
933799025_933799032 27 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799032 2:85945056-85945078 CCTCCCAGAAGGAAGAACCTGGG No data
933799025_933799028 -1 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799028 2:85945028-85945050 GTCACAACGGACAATAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933799025 Original CRISPR CCATCACTTTGCCTTCTCTG AGG (reversed) Intergenic
No off target data available for this crispr