ID: 933799029

View in Genome Browser
Species Human (GRCh38)
Location 2:85945045-85945067
Sequence ATTAGGATGTTCCTCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933799025_933799029 16 Left 933799025 2:85945006-85945028 CCTCAGAGAAGGCAAAGTGATGG No data
Right 933799029 2:85945045-85945067 ATTAGGATGTTCCTCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933799029 Original CRISPR ATTAGGATGTTCCTCCCAGA AGG Intergenic
No off target data available for this crispr