ID: 933800517 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:85956743-85956765 |
Sequence | ATTCACTGAGTGGTGCCATG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933800512_933800517 | 0 | Left | 933800512 | 2:85956720-85956742 | CCTCTGTGATTCACCCATTTCCT | No data | ||
Right | 933800517 | 2:85956743-85956765 | ATTCACTGAGTGGTGCCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933800517 | Original CRISPR | ATTCACTGAGTGGTGCCATG TGG | Intergenic | ||