ID: 933800517

View in Genome Browser
Species Human (GRCh38)
Location 2:85956743-85956765
Sequence ATTCACTGAGTGGTGCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933800512_933800517 0 Left 933800512 2:85956720-85956742 CCTCTGTGATTCACCCATTTCCT No data
Right 933800517 2:85956743-85956765 ATTCACTGAGTGGTGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933800517 Original CRISPR ATTCACTGAGTGGTGCCATG TGG Intergenic