ID: 933800789

View in Genome Browser
Species Human (GRCh38)
Location 2:85958848-85958870
Sequence TAGGGTGGTGCAGGCACTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933800789_933800795 -7 Left 933800789 2:85958848-85958870 CCCGCAGTGCCTGCACCACCCTA No data
Right 933800795 2:85958864-85958886 CACCCTAGGACAGCAGGTCCTGG No data
933800789_933800799 18 Left 933800789 2:85958848-85958870 CCCGCAGTGCCTGCACCACCCTA No data
Right 933800799 2:85958889-85958911 TAATGTCATTTAGTTCAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933800789 Original CRISPR TAGGGTGGTGCAGGCACTGC GGG (reversed) Intergenic
No off target data available for this crispr