ID: 933801098

View in Genome Browser
Species Human (GRCh38)
Location 2:85961077-85961099
Sequence CTGGCTGTGGAGAGGACCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933801098_933801106 13 Left 933801098 2:85961077-85961099 CCCACGGTCCTCTCCACAGCCAG No data
Right 933801106 2:85961113-85961135 GTGTTCAGTTTTTCGCAGAAAGG No data
933801098_933801107 22 Left 933801098 2:85961077-85961099 CCCACGGTCCTCTCCACAGCCAG No data
Right 933801107 2:85961122-85961144 TTTTCGCAGAAAGGAGACCCTGG No data
933801098_933801109 28 Left 933801098 2:85961077-85961099 CCCACGGTCCTCTCCACAGCCAG No data
Right 933801109 2:85961128-85961150 CAGAAAGGAGACCCTGGAGTGGG No data
933801098_933801108 27 Left 933801098 2:85961077-85961099 CCCACGGTCCTCTCCACAGCCAG No data
Right 933801108 2:85961127-85961149 GCAGAAAGGAGACCCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933801098 Original CRISPR CTGGCTGTGGAGAGGACCGT GGG (reversed) Intergenic
No off target data available for this crispr