ID: 933809980

View in Genome Browser
Species Human (GRCh38)
Location 2:86027124-86027146
Sequence GGCCTCCTGCAGCACAGGTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 2, 1: 0, 2: 2, 3: 35, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933809976_933809980 -2 Left 933809976 2:86027103-86027125 CCTTAGGGGTTATGCCACAGAGG 0: 1
1: 0
2: 0
3: 8
4: 92
Right 933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG 0: 2
1: 0
2: 2
3: 35
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933809980 Original CRISPR GGCCTCCTGCAGCACAGGTG AGG Exonic
900120156 1:1045420-1045442 GTGCTCCTGCCGCCCAGGTGTGG + Exonic
900152123 1:1183287-1183309 GGCCACCTGCAGGACAGAGGGGG - Intronic
900629124 1:3624626-3624648 GGCCTTCTGGAGCGCAGGTGGGG - Intergenic
900707723 1:4090802-4090824 AGCCCCCGGCAGCACAGCTGGGG - Intergenic
901024544 1:6272171-6272193 GGCCTCCAGCAGGACAGGAAGGG - Intronic
901306578 1:8237187-8237209 GGCATCCTGCAGAAAAGGAGAGG + Intergenic
901308513 1:8250825-8250847 CACCTCCTGCACCCCAGGTGGGG - Intergenic
901972853 1:12921462-12921484 AGGGTCCTTCAGCACAGGTGTGG - Intronic
902012327 1:13280300-13280322 AGGGTCCTTCAGCACAGGTGTGG + Intergenic
902904968 1:19549731-19549753 TGCATGCTGCAGGACAGGTGAGG + Intergenic
903226471 1:21896673-21896695 GGCCTCGGGCAGCGCAGATGGGG + Intronic
903654074 1:24938260-24938282 GGCCTCCTGGGGCTCAGGTGTGG - Intronic
903995163 1:27300909-27300931 GGCCTTCTGCTGCAGAGCTGCGG + Intronic
903999742 1:27332164-27332186 GGCCTTCTGGGGCACAGGAGGGG + Intronic
904608366 1:31711306-31711328 GTTCTCCTGGAGCAGAGGTGAGG + Intergenic
907649978 1:56285831-56285853 GGCTTCCTGCAGCACAGATCTGG - Intergenic
908234658 1:62137842-62137864 GGCCTCCCTCACCTCAGGTGGGG + Intronic
908413990 1:63894581-63894603 GGGCTCCTGTAGCACAGGGGAGG + Intronic
911259525 1:95669577-95669599 CTCCACCTGCAGCACCGGTGTGG - Intergenic
912166231 1:107045179-107045201 CTCCACCTGCAGCCCAGGTGTGG + Intergenic
912952087 1:114127249-114127271 GGCCCCTTCCACCACAGGTGAGG - Intronic
912952089 1:114127268-114127290 GGCCTGCTGCTGCTCAGCTGTGG + Intronic
913198219 1:116475467-116475489 AGCCTCCCGCAGAACAGCTGGGG + Intergenic
915062484 1:153197645-153197667 GCCCCCCGGCAGAACAGGTGGGG + Intergenic
915622742 1:157095805-157095827 GGCCCCCAGCAGCTCAGGGGTGG + Intronic
916656881 1:166884499-166884521 GGCATCCTGGAGGAAAGGTGAGG - Intergenic
917475375 1:175365004-175365026 GGGCTCCATCACCACAGGTGAGG - Exonic
918078892 1:181190733-181190755 GGCTTCCTGCTGCCCAGGTGTGG + Intergenic
919201279 1:194358218-194358240 GTCCACCTGCAGCCCTGGTGTGG - Intergenic
919237089 1:194859411-194859433 CTCCACCTGCAGCACCGGTGCGG + Intergenic
920535465 1:206734001-206734023 GGCCTCCCCCAGCACAGATGAGG + Exonic
920540286 1:206773050-206773072 GGCTTCCTACAGTACAGGCGGGG + Intergenic
920883080 1:209898750-209898772 GTCCACCTGCAGCCCCGGTGCGG - Intergenic
921373820 1:214452590-214452612 GGGCTCCTGCAGCAGCTGTGAGG - Intronic
921973380 1:221175375-221175397 GGCCTGCTCCACCACAGCTGAGG + Intergenic
922445415 1:225692850-225692872 GCCTTCCTGAAGCACTGGTGTGG + Intergenic
923462104 1:234216402-234216424 TGCCTCCTGCAGCACCTCTGAGG - Intronic
923615383 1:235533061-235533083 GGCCATCTGCAGCCCAGGAGAGG + Intergenic
924626934 1:245703431-245703453 CGGCACCTGCAGCACAGGGGAGG + Intronic
1062885976 10:1016204-1016226 GGCCTCCTGGTGCTCAGCTGTGG - Intronic
1063148874 10:3319763-3319785 CTCCACCTGCAGCCCAGGTGTGG - Intergenic
1063592400 10:7407486-7407508 GGGCTCCCGCAGCACAGCCGCGG - Intronic
1064713586 10:18152126-18152148 GTCCACCTGCAGCATCGGTGGGG + Intronic
1066355928 10:34683759-34683781 GGCCTCCTGCATGAAAAGTGAGG - Intronic
1067746640 10:48941201-48941223 GGGCTGCTGCAGCACAAGGGAGG + Intronic
1068717104 10:60200574-60200596 TGCCTGCTTCAGCGCAGGTGTGG - Intronic
1069619485 10:69827876-69827898 GCGCTGCTGCAGCACAGGGGAGG - Intronic
1069682147 10:70292747-70292769 GGCCTCCTCCAGCTTAGATGGGG + Intergenic
1069723756 10:70564902-70564924 GCCCTCGCGGAGCACAGGTGAGG - Intronic
1070588892 10:77787600-77787622 GGCTTCCCGCAGCTCAGCTGAGG + Intergenic
1072799613 10:98384045-98384067 GGCTTCCTGCACCAAAGGTCTGG + Intronic
1072835922 10:98711885-98711907 GACCTCCTGAAGCAGATGTGTGG - Intronic
1076231173 10:128821159-128821181 GGCCTCCTGCAGCCCTGGGATGG - Intergenic
1076735246 10:132456047-132456069 GTCCTTATGGAGCACAGGTGGGG + Intergenic
1076817847 10:132923378-132923400 GGCCTCGAGCAGCCCATGTGGGG + Intronic
1076941540 10:133613272-133613294 GCCGCCCTGCAGCACAGATGGGG - Intergenic
1076981150 11:205523-205545 TGTCTCCTTCAGCACTGGTGCGG - Intronic
1077028437 11:452023-452045 GTCCTCCCGCAGCACAGCTGGGG + Intronic
1077074441 11:694116-694138 GGGCTTCTCCAGGACAGGTGGGG + Intronic
1077299708 11:1841290-1841312 GGCCCCCGGCAGGGCAGGTGTGG - Intronic
1077352268 11:2098521-2098543 GACTTCCGGCAGCACATGTGGGG - Intergenic
1077490465 11:2858613-2858635 GGCCTCCTGCAGCCCAGAGTGGG + Intergenic
1077589299 11:3479363-3479385 GTCCTCCTACAGCACAAGTCCGG + Intergenic
1077778146 11:5294392-5294414 CTCCCCCTGCAGCCCAGGTGCGG - Intronic
1078395097 11:10974028-10974050 GGCCTCCTGTGGCACGTGTGGGG - Intergenic
1078514205 11:12008864-12008886 GGGCTCCAGCATCACAGGTGAGG - Exonic
1081141087 11:39501196-39501218 GGGCTCCTGCCCCAGAGGTGTGG - Intergenic
1082011068 11:47449799-47449821 AGCCTCTTGCAGCACATGCGGGG - Intergenic
1082877078 11:57999660-57999682 GGCCTCCTTCAGCTGTGGTGGGG + Intergenic
1083151436 11:60794192-60794214 CCCCTCCTGGAGCCCAGGTGTGG + Intronic
1083451488 11:62748945-62748967 GCCCTCCTACAGCACAGGCGGGG + Intronic
1083758843 11:64805079-64805101 GCCCACATGCAGCACAGGCGTGG + Exonic
1084476484 11:69392298-69392320 GACCTCCTGGACCACAGGGGAGG + Intergenic
1084544039 11:69805073-69805095 GGCCTCCTGCCTCCCAGGGGTGG - Intergenic
1084664790 11:70570556-70570578 GGCCTGCAGCAGAGCAGGTGAGG - Intronic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1084914059 11:72414542-72414564 GGCCTCCTCGGGCAAAGGTGTGG + Intronic
1085048140 11:73365104-73365126 GGCCTCCCCCTGGACAGGTGGGG - Intronic
1089064682 11:115653571-115653593 GGACTTCTGCAGCACAGATGTGG + Intergenic
1089554781 11:119310374-119310396 GGCCTCCTGCAGGGCAGCAGCGG - Exonic
1090805290 11:130198605-130198627 GGCCTCCTGCCCCAAGGGTGAGG + Exonic
1090834226 11:130442273-130442295 GGGCTCCTGCAACCCAGATGAGG - Intergenic
1091158086 11:133392544-133392566 GTCCCCCTGAAGCACACGTGTGG - Intronic
1091894111 12:4086720-4086742 GGCCTAGTGCTGCACAGCTGGGG + Intergenic
1092137501 12:6159886-6159908 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1092169404 12:6363783-6363805 GGCCTCCCGGGGCACAGATGAGG - Intronic
1092291076 12:7159729-7159751 GGCTGCCTGTAGCACAGTTGGGG + Intergenic
1092583763 12:9876120-9876142 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1093490906 12:19702741-19702763 GGCCTCTTGCAAAACAGGTCTGG - Intronic
1094338528 12:29386190-29386212 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1096137864 12:49217716-49217738 TGCCTCCTGGAGCCCAGGTGAGG - Intronic
1103714343 12:122935266-122935288 GGACGGCTACAGCACAGGTGTGG - Exonic
1104747285 12:131218672-131218694 GCCCTGCTTCAGCACAGCTGAGG - Intergenic
1104924215 12:132305723-132305745 GGCCTCCTGGAGCTCAGTTTGGG + Intronic
1105011431 12:132759465-132759487 GGCCTCGTGCATTGCAGGTGGGG - Intronic
1105946345 13:25193049-25193071 AGCCTCCAGCAGCACATCTGCGG - Intergenic
1106160906 13:27200532-27200554 TGCCTCCTACATGACAGGTGGGG - Intergenic
1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG + Intronic
1108076541 13:46686025-46686047 AGTCTCCTCCAGCACAGGTGAGG + Exonic
1108230032 13:48328223-48328245 GGCCTCCAGAAGCAAAGATGAGG - Intronic
1108259912 13:48646126-48646148 TGCCACCTGCAGAACAGATGGGG + Intergenic
1108727861 13:53201425-53201447 GGCCTCCTGGTGCACAGCGGGGG - Intergenic
1112408336 13:99140404-99140426 GACTTCCTGCAACACAGGTGTGG - Intergenic
1112842758 13:103600350-103600372 TGCCACCTGCAGCCCTGGTGCGG + Intergenic
1113954830 13:114093229-114093251 GGCTTCTTGTAGGACAGGTGTGG + Intronic
1114272950 14:21115088-21115110 GGAGTCCTGAAGGACAGGTGTGG - Intergenic
1114329480 14:21621889-21621911 GGTATCCTGCAGCAGATGTGGGG + Intergenic
1114331650 14:21642958-21642980 GGTATCCTGCAGCAGATGTGGGG + Intergenic
1114969276 14:28005492-28005514 GCCCTGCTGAAGCACATGTGTGG - Intergenic
1115779758 14:36756295-36756317 CGCCTCCTTCTGCACATGTGTGG + Intronic
1119029758 14:71182806-71182828 GGCCTCCTGCAGCCCCGCCGTGG - Intergenic
1121447388 14:93987675-93987697 TGACTCCTGCGTCACAGGTGAGG - Intergenic
1121734245 14:96206710-96206732 GACCACAAGCAGCACAGGTGAGG - Intronic
1122407187 14:101507570-101507592 AGCCTCCTTGAGCAAAGGTGAGG - Intergenic
1123986724 15:25652864-25652886 GTGCTCCTGCTGCACAGATGAGG - Intergenic
1124955159 15:34355621-34355643 AGCCCCCTGAAGCCCAGGTGAGG - Exonic
1127301432 15:57657859-57657881 TGCCACCTGCAACACAGGAGAGG + Intronic
1127867136 15:63042341-63042363 GGCCTCCGGCAGCTCAGGGCGGG + Intergenic
1128072990 15:64808812-64808834 TGCCTCCCGCAACACACGTGAGG - Intergenic
1128560869 15:68666991-68667013 GCTCAGCTGCAGCACAGGTGAGG + Intronic
1129280322 15:74480293-74480315 CTCCACCTGCAGCGCAGGTGTGG - Intergenic
1129789594 15:78331817-78331839 GGCCTCTTGCAGCTCCAGTGAGG - Intergenic
1131822259 15:96285382-96285404 GAGCTCCTGCAGCAGAGGGGTGG - Intergenic
1131846039 15:96491781-96491803 CGCCACCTGCAGCCCCGGTGCGG - Intergenic
1132154490 15:99486123-99486145 GGGCTCCTGCAGCTCAGGCCTGG - Intergenic
1132585403 16:704015-704037 CTCCTCCTGCACCACTGGTGGGG + Intronic
1132627505 16:898518-898540 GGCCTGGAGCAGCCCAGGTGGGG + Intronic
1132786287 16:1658578-1658600 TGCCTGATGCAGCTCAGGTGTGG + Intronic
1132897478 16:2235959-2235981 GGCCTCAGGCAGCGCAGCTGGGG - Exonic
1132989495 16:2785641-2785663 GCCCTCCTGCAGGACAGGAGCGG + Exonic
1133400440 16:5482395-5482417 TGCTTCCTGCAGCCCAGGCGGGG + Intergenic
1137491664 16:48938075-48938097 GGCCAGCAGGAGCACAGGTGGGG + Intergenic
1137497395 16:48981343-48981365 GGCCTCCAGAGGCTCAGGTGAGG + Intergenic
1138344694 16:56312698-56312720 GGCCTCCACCTGCAGAGGTGCGG - Intronic
1138591150 16:58000409-58000431 GGCCGCCTGCAGGGCAGGCGCGG + Intronic
1139461974 16:67129700-67129722 GGCAGCCAGCAGCACAGGTAGGG - Intronic
1139597435 16:67966631-67966653 GGCCTCCCAGAGCAGAGGTGTGG + Intronic
1140672529 16:77293139-77293161 GCCCTCCTGCAGCTCAGGTCTGG + Exonic
1141421756 16:83922199-83922221 GGGCTCCGGAAGCACAGGTCGGG - Exonic
1141746633 16:85930635-85930657 CGCCTCGTGCAGCACAGAAGAGG - Intergenic
1142156998 16:88537220-88537242 CCACTCCTGCGGCACAGGTGTGG - Intergenic
1142307376 16:89293346-89293368 GGCCACATGCAGCACAGAAGTGG - Intronic
1142351630 16:89583360-89583382 GGCCTGCACCTGCACAGGTGTGG - Intronic
1142401756 16:89862499-89862521 GGCCGCCTGCTCCCCAGGTGAGG - Intronic
1142585080 17:967155-967177 AGCCTCCAGCTACACAGGTGTGG + Intronic
1142849589 17:2697890-2697912 GCCTTCGTGGAGCACAGGTGAGG - Exonic
1143625028 17:8104754-8104776 GGCCTCCTGGAGGACAAGAGGGG + Intronic
1143644685 17:8222764-8222786 AGCCTCCTGCAGCGCTGGTCAGG + Intergenic
1143764346 17:9127674-9127696 GGCTTCCTGCAGCTCAGACGGGG + Intronic
1146679048 17:34793915-34793937 CGGCACCTGCAGCACAGGTTGGG + Intergenic
1147045508 17:37748864-37748886 GACCTCCTGCAGAACAGGTTAGG - Intergenic
1147668423 17:42163294-42163316 GGACTCTGGCAGCACAGCTGAGG - Exonic
1148126207 17:45238477-45238499 AGCCTGTTGAAGCACAGGTGTGG + Intronic
1148158677 17:45437640-45437662 CGCCTCCTGCAGCAGAGGGGTGG + Exonic
1148225718 17:45896618-45896640 GGCCTCCTGGAGGACACGGGAGG + Intronic
1149565729 17:57639499-57639521 AGCCTCCTATGGCACAGGTGGGG - Intronic
1149655633 17:58308425-58308447 TGCCTCCATCAGCAGAGGTGGGG - Intronic
1150390098 17:64785039-64785061 CGCCTCCTGCAGCAGAGGGGTGG + Intergenic
1150782258 17:68133621-68133643 GGCCCTCAGCAGCACAGCTGGGG + Intergenic
1151976776 17:77487847-77487869 GCCTTCCTGGAGCACTGGTGCGG + Intronic
1152294485 17:79458793-79458815 GGCCTCCTGTGGCAGGGGTGAGG - Intronic
1152375823 17:79918463-79918485 GGCCTCCATCAGGACAAGTGGGG + Intergenic
1152425042 17:80214140-80214162 GGCGTCCTGAAACACAGGAGGGG + Intronic
1152438064 17:80288222-80288244 GGCCTTCACCAGCAGAGGTGGGG - Exonic
1152797190 17:82314268-82314290 TGCCTCCTGCGACACAGGTGGGG - Intergenic
1152935866 17:83136352-83136374 GGCCTCCTGCACCCGAGGGGAGG + Intergenic
1153749138 18:8211237-8211259 GGCCTCCTGCACAACAGGAAGGG + Intronic
1153835250 18:8958098-8958120 GTCCTCCTGAAGAACAGGTCAGG - Intergenic
1155201150 18:23518932-23518954 GACCTCCAACAGCACAGGAGCGG + Exonic
1157522856 18:48357209-48357231 GGCCACCTGCAGAATAGGTCGGG + Intronic
1157557439 18:48621980-48622002 TGGCTCCTGCAGCACAGCTGTGG + Intronic
1157816077 18:50730150-50730172 GGCATCCTGCCACCCAGGTGGGG - Exonic
1158905133 18:62004305-62004327 GCCCTCCTGAAGCACTGGGGTGG - Intergenic
1159716726 18:71833449-71833471 GGGCTGCTGCAGCTAAGGTGAGG - Intergenic
1160871423 19:1279570-1279592 AGCCTCCTGCAGCAGAGCTCTGG - Intergenic
1160883909 19:1335954-1335976 GGCCTCCTGCTGCACCACTGTGG - Intergenic
1161064827 19:2232483-2232505 GGGCGCCTGCAGCCCAGGGGCGG - Exonic
1161144353 19:2668641-2668663 GCCCTCCTCCAGCCCAGGAGCGG - Intronic
1161354967 19:3813836-3813858 GTCCTCCCGCATCAGAGGTGAGG + Exonic
1161741455 19:6023321-6023343 GGCCTTCTGCAGGTCAGGCGGGG - Intronic
1162528702 19:11222900-11222922 GGCCACCTGCAGGAGAGGGGTGG + Exonic
1163186244 19:15641398-15641420 GGCATCCTGCAGGGCAGATGGGG - Exonic
1163242270 19:16071575-16071597 GGCCTTCTGAAGTTCAGGTGTGG + Intronic
1163352764 19:16788970-16788992 GGCCTGCTGCAGGAGAGGTGAGG + Exonic
1163598245 19:18232909-18232931 GGCCTCCTGCAGCGCGGGGGAGG - Intronic
1163675205 19:18652297-18652319 GGGCTCCAGCAGGCCAGGTGCGG + Intronic
1164600776 19:29561928-29561950 GCCCTCCTGCAGCACAGCTCAGG - Intronic
1164609730 19:29623947-29623969 GGCCTCCTGCAGAGGAGCTGGGG + Intergenic
1165130589 19:33629504-33629526 GGCTGTCTGCAGCACAGGTCGGG + Intronic
1165706740 19:37981707-37981729 GGTGTCCTGCAGAAAAGGTGAGG - Intronic
1166267390 19:41693604-41693626 GGCCTCCTGCAGAACTAGAGTGG + Intronic
1166391516 19:42411266-42411288 AGCCTCCTGGATCACAGGAGAGG - Intronic
1166956951 19:46471187-46471209 GGCCTCCTGCAGGCCAGCCGCGG - Intronic
1166962836 19:46509528-46509550 TGCCTGCTGTATCACAGGTGTGG - Intronic
1167602417 19:50462006-50462028 GGCCTCTGACAGCACAGTTGAGG - Exonic
1167672087 19:50859238-50859260 GTCCTCCTGTGGCCCAGGTGAGG - Intronic
1167674841 19:50877664-50877686 GTCCTCCTGTGGCCCAGGTGAGG - Intronic
1168009474 19:53519183-53519205 AGCCTCCTGGAGCTCAGGTAAGG - Intergenic
1168636163 19:57999129-57999151 GGCCTCCTGCAGCACCACAGGGG - Intronic
925044922 2:765927-765949 GGCATCCTGTTGCATAGGTGAGG - Intergenic
925219297 2:2124830-2124852 GTCCACCTGTGGCACAGGTGGGG + Intronic
925987831 2:9230542-9230564 AGCCTCCTGCAGGAGGGGTGTGG + Intronic
926457988 2:13092524-13092546 GGCCACCTGCAGCCCAGAAGAGG - Intergenic
929177460 2:38995289-38995311 TGGCTCCTGCTGCAGAGGTGTGG + Exonic
929433710 2:41910266-41910288 GGTCACCTGCAGTACAGGAGAGG + Intergenic
932458211 2:71863477-71863499 GGCCTTCGGCAGCTCAGGCGGGG - Intergenic
932943074 2:76192818-76192840 GGCTTACTGGAGCTCAGGTGAGG + Intergenic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
934614781 2:95764278-95764300 GGGCTCCAGCAGCAGAGGAGGGG - Intergenic
936056484 2:109265553-109265575 GGTCTCCTTCAGGGCAGGTGTGG + Intronic
936252057 2:110874600-110874622 GGCCTCCTTCAGCACAGGGGAGG + Intronic
937217022 2:120319244-120319266 TGGCTCCTGCCGCACAGCTGTGG + Intergenic
937670607 2:124533658-124533680 GGCCTCCTGCAGCACCCCTTGGG - Intronic
938063554 2:128269509-128269531 GGGCTCCTGCCGCGCAGGGGAGG - Intronic
938192898 2:129299655-129299677 AGACTGCTGCAGCAGAGGTGGGG - Intergenic
941188160 2:162343631-162343653 CTCCTCCTGGACCACAGGTGTGG + Intronic
942578684 2:177393093-177393115 GCCCTCCTGCAGCACAGGCCCGG - Intronic
944729709 2:202503782-202503804 CTCCACCTGCAGCCCAGGTGTGG + Intronic
946178981 2:217938637-217938659 GGCTTCCTGGAGGCCAGGTGAGG + Intronic
947630378 2:231648821-231648843 GGCCACCTGAGGCACAGGAGTGG + Intergenic
948702132 2:239767092-239767114 GGCTTCATCCAGAACAGGTGGGG - Intronic
948949019 2:241236889-241236911 GACCTCCTGAAGGACAGGAGTGG - Intronic
1168949008 20:1783768-1783790 TGCCTCCTAGGGCACAGGTGTGG - Intergenic
1169293100 20:4369622-4369644 GGCCTCTTGAAGCACTGATGTGG + Intergenic
1169327613 20:4687470-4687492 AGGCGCCTGCCGCACAGGTGGGG - Intronic
1169695811 20:8385525-8385547 GGCCACCAGCACCACAGCTGTGG - Intronic
1171408244 20:24928314-24928336 GTCCTCCTGCAGTACAAGTCCGG - Intergenic
1172664149 20:36587499-36587521 GTACTCCTGCAGCACAGGTATGG + Intronic
1172873731 20:38151655-38151677 GGGTTCCTGCAGCTCAGGAGAGG + Intronic
1172971534 20:38876388-38876410 AGGCTCCAGCAGCACAGCTGAGG - Intronic
1173202675 20:40965818-40965840 GGGCACCTGCAGCCCAGGTCAGG - Intergenic
1173516132 20:43666930-43666952 GGCCGGCTGCAGGACAGGGGCGG - Intergenic
1174340453 20:49892001-49892023 GGCCTCTTGCAGCTCACTTGGGG - Exonic
1175148599 20:56915339-56915361 GGCCTTCTTCAGAACAGTTGGGG - Intergenic
1175199991 20:57270356-57270378 GGCCCCCTGCAGGCCAGCTGGGG + Intergenic
1175357543 20:58380752-58380774 AGCCACCTTCAGCCCAGGTGTGG + Intergenic
1175609566 20:60339456-60339478 AGAGTCCTGCAGGACAGGTGGGG + Intergenic
1175634274 20:60567455-60567477 GGCCTCCTGCTTCCCAGCTGGGG + Intergenic
1175862419 20:62157390-62157412 AGCCCCCTGCTGCTCAGGTGTGG + Intronic
1176187809 20:63790923-63790945 GGCCTCCCGCTGCACACCTGTGG - Exonic
1176222857 20:63978423-63978445 GGCCTTCAGCAGGGCAGGTGAGG + Intronic
1177369447 21:20182344-20182366 CCCCTCCTGCACCACAGCTGAGG - Intergenic
1177776478 21:25573009-25573031 GGTCTCCTGCAGTACAAGAGGGG - Intergenic
1178327062 21:31654597-31654619 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1178930172 21:36811399-36811421 AACCTACTGCAGGACAGGTGAGG + Intronic
1179454687 21:41490934-41490956 GACCTCCGGAGGCACAGGTGTGG - Intronic
1179888654 21:44325250-44325272 GGCCACCTGCAGCAGGTGTGGGG + Exonic
1179912188 21:44456202-44456224 GGCCACCTACAGCACCGCTGGGG - Intronic
1180043627 21:45292908-45292930 GGCCTCCTTCCCCTCAGGTGAGG - Intergenic
1180092282 21:45539297-45539319 GGCCATCTGCTGCTCAGGTGGGG + Intronic
1180724021 22:17931058-17931080 GGTCGCCTGAAGCACTGGTGTGG - Intronic
1180921948 22:19525557-19525579 GGCCCCCTGAGGCTCAGGTGGGG + Intronic
1180971481 22:19818420-19818442 GGCCCCCTGCACCAGTGGTGAGG + Intronic
1181475347 22:23164647-23164669 AGCCCCCTGCAGCCAAGGTGCGG + Intergenic
1181715973 22:24729132-24729154 GGCCTGCAGCTGCACAGATGAGG + Intronic
1182526703 22:30924902-30924924 GGCTTCATTCAGCACAGCTGTGG + Intergenic
1182549449 22:31093100-31093122 GGCCCCATGCCTCACAGGTGGGG - Intronic
1183721239 22:39562762-39562784 GTCCTACTGCAGCACCTGTGGGG - Intergenic
1184336176 22:43854566-43854588 GGTCACCTGCAGCGCTGGTGAGG + Intronic
1184683670 22:46086241-46086263 GGTCTCCAGCAGCAGGGGTGAGG + Intronic
1184727518 22:46355517-46355539 AGCCTCCCGCAGCACTGGTCCGG + Exonic
1184780283 22:46645393-46645415 GCCCTCCTGCAGGTCAGGCGAGG - Intronic
1184854400 22:47138546-47138568 TGCCTCCTACAGCTCAGGGGAGG - Intronic
1185121674 22:48975134-48975156 GGCCACCTGCAGCCCATGAGGGG + Intergenic
949209224 3:1477988-1478010 GGCCTCCTTCAGCTGTGGTGAGG - Intergenic
950261533 3:11545834-11545856 AGCCTCCTGCAGAAGAAGTGGGG + Intronic
950283486 3:11726428-11726450 GGGCTCTGGCAGCACAGTTGAGG + Intergenic
950304061 3:11904892-11904914 GCTCTCCTGCAGGACAGGGGAGG + Intergenic
952389806 3:32870376-32870398 GGCCGCCTGCAACAGAGATGGGG - Intronic
953735601 3:45491683-45491705 GTCCTCCAGGGGCACAGGTGTGG - Exonic
953907426 3:46875306-46875328 GACCTCCTGCTGAACAGATGAGG + Intronic
954320551 3:49829616-49829638 GTCCTCTTGCAGCAAAGATGTGG - Exonic
954333390 3:49902638-49902660 GGCCACCCGCAGCACAGGGTAGG + Exonic
954456435 3:50602239-50602261 GGGCTCCTCCACCAGAGGTGGGG - Intergenic
954800351 3:53183594-53183616 CCCCTCCTGCAGCCCAGGGGCGG - Intronic
954870578 3:53764639-53764661 GCCAGCCTGCAGCACACGTGAGG - Intronic
955772867 3:62403972-62403994 GACTTCCTGCACCACAGGGGTGG - Intronic
961381295 3:126498064-126498086 GGCTTCCTCCAGCACAGATGTGG + Exonic
961623794 3:128245174-128245196 GGGCTGCTGCAGCTCAGATGTGG - Intronic
962342169 3:134594936-134594958 ATCCTCCTGGAGCTCAGGTGAGG + Intergenic
962935113 3:140073615-140073637 GGCCTCCTAGAGCACTGGCGAGG + Intronic
963924262 3:150934913-150934935 GGCCTCCTGTAATAGAGGTGCGG - Intronic
967290912 3:187919235-187919257 GGCTTCCTGAAGCACAGACGAGG + Intergenic
968143010 3:196274002-196274024 GGTGTCCAGCAGCACAGGAGGGG - Intronic
968342536 3:197968674-197968696 GACTTCCTGCAACACAGGTTTGG + Intronic
968742055 4:2336040-2336062 TGCCTCCTGGGGCAGAGGTGGGG - Intronic
969254216 4:5991567-5991589 GGCCTCCTTCAGCCCAGCTGGGG - Intergenic
969375704 4:6761941-6761963 GGCTTCCTGCAGCTGAGCTGGGG + Intergenic
969619738 4:8273060-8273082 GGCCTCCAGCAGCACATCTGTGG - Intronic
971563630 4:28113188-28113210 CTCCACCTGCAGCCCAGGTGTGG + Intergenic
973546741 4:51990026-51990048 GGCCTCCTTGAGCTGAGGTGGGG + Intergenic
976274020 4:83258022-83258044 GGCCTGCAGCAGCACTGGCGAGG + Intergenic
977020360 4:91751381-91751403 GGCCTCCTTCAGAACAGGATGGG - Intergenic
979679570 4:123444668-123444690 GGCCTCATGTGGAACAGGTGGGG + Intergenic
979688665 4:123538329-123538351 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
982205888 4:152996835-152996857 GTCTTCCTGCAGCCCAGGTAGGG - Intergenic
982208984 4:153019875-153019897 AGCAGCCTGCAGCACAGGGGTGG - Intergenic
982717516 4:158824534-158824556 GAGCTCCAGCAGCAGAGGTGGGG - Intronic
982728260 4:158928114-158928136 CTCCACCTGCAGCACAGGTGTGG + Intronic
984238746 4:177193144-177193166 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
985272722 4:188209409-188209431 GGTCTCATGCTGCACAGGTGTGG + Intergenic
985517512 5:354471-354493 GGGCTCCTGCATCTCAGGTGGGG + Intronic
985718588 5:1476614-1476636 TGGCTCCTGCAGCTCAGGTCTGG + Intronic
985864680 5:2505147-2505169 GGCCACCTGCAGGACAGCAGAGG - Intergenic
986693984 5:10335898-10335920 GGCCTGCTGCAGCACACCAGAGG - Intergenic
988920204 5:35934447-35934469 GACCTCTTGTAGCACAGATGTGG - Intronic
992869703 5:80993897-80993919 GGCCTCCAGGGGCACAGATGGGG + Intronic
994048702 5:95338151-95338173 GGGCTCCTGCAGGACAGGCCTGG - Intergenic
994096415 5:95851579-95851601 TTCCACCTGCAGCCCAGGTGCGG + Intergenic
995224927 5:109690649-109690671 GGCCTCGCCCAGCACGGGTGTGG - Intronic
995513224 5:112928520-112928542 AGCCTCCTGCAGCAGAGGGAGGG - Intergenic
995778845 5:115754937-115754959 GGGCTTCTGCAGAACAAGTGTGG - Intergenic
995920468 5:117305075-117305097 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
996224638 5:120976824-120976846 TTGCTCCTGCAGGACAGGTGGGG + Intergenic
998517679 5:142770638-142770660 GGCCGCCGGCTCCACAGGTGTGG - Exonic
1001229112 5:169970577-169970599 GCCTCCCTGCAGCACAGATGGGG - Intronic
1001864090 5:175087990-175088012 GGCCTCCTGGAGAACAAGGGTGG + Intergenic
1002688895 5:181037021-181037043 GGCCTCCTGCTGTACAGATCAGG + Intergenic
1003141660 6:3476664-3476686 GTTCTGCTGCAGAACAGGTGGGG - Intergenic
1003845805 6:10172167-10172189 CTCCACCTGCAGCCCAGGTGCGG + Intronic
1004172650 6:13308922-13308944 TGCCTCCTACAGCCCAGGTTAGG - Intronic
1005919809 6:30391094-30391116 GGCCACCTGGAGCACATCTGTGG + Intergenic
1006950954 6:37820269-37820291 GGCCTCCTGGGCCACGGGTGAGG + Intronic
1007386519 6:41523740-41523762 AGCCTCCTTCAGGGCAGGTGGGG - Intergenic
1007735939 6:43982214-43982236 TGCCTCCTGCAGCCCAGGCCTGG + Intergenic
1008463630 6:51805229-51805251 GGCCTCCAGCAGCACCCATGTGG - Intronic
1009019914 6:57938378-57938400 GCCCTGCTGCCACACAGGTGAGG + Intergenic
1012255549 6:97027340-97027362 GGCTTCCTGCAGCCCCGTTGAGG - Intronic
1012578159 6:100829179-100829201 CTCCACCTGCAGCCCAGGTGCGG - Intronic
1014258636 6:119189795-119189817 GGCCTCCTGGAGCACAAGATGGG - Exonic
1017679236 6:156846783-156846805 GACTTCCTACAGGACAGGTGGGG + Intronic
1018390283 6:163336401-163336423 GGCCGCCAGGAGCTCAGGTGAGG - Intergenic
1018721287 6:166574450-166574472 GACCTCCAGCTGCACAGATGTGG + Intronic
1019215449 6:170440047-170440069 GGTCTCAGACAGCACAGGTGAGG + Intergenic
1019307901 7:344490-344512 GGAGTCCTCCACCACAGGTGAGG - Intergenic
1020568142 7:9822875-9822897 GGCCTCCTGCTTCACAGGCCAGG - Intergenic
1020682333 7:11252941-11252963 GGCCTCCTGCATCACTTCTGGGG - Intergenic
1021324196 7:19245897-19245919 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1021916023 7:25433109-25433131 GGCCTCCTTGTGCACAGGAGAGG + Intergenic
1021962828 7:25889612-25889634 GGGCTCCTGCAGCACCCATGGGG - Intergenic
1023849346 7:44141427-44141449 GGCCTCCCCCAGCCCAGGCGGGG - Intergenic
1024741839 7:52363020-52363042 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1025937712 7:66050550-66050572 AGCCTCCTGCAGAAAAGGTGGGG - Intergenic
1026464681 7:70643965-70643987 GGTCTACTGCAGCACAGATATGG - Intronic
1027848787 7:83422231-83422253 GGCCTCCTGACCCAAAGGTGTGG + Intronic
1028941847 7:96530352-96530374 GGCCACATCCACCACAGGTGAGG + Intronic
1030759313 7:113331589-113331611 GGCAACCAGCAGCACAGCTGTGG + Intergenic
1031798025 7:126202327-126202349 TGTCTGCTGGAGCACAGGTGTGG - Intergenic
1034073971 7:148214115-148214137 GGCCCCCTGGAACACAGGGGTGG - Intronic
1035246755 7:157567439-157567461 AGCGTCCTGCAGCAGAGGGGAGG - Intronic
1035663757 8:1365306-1365328 GGCCACCTGCAGCCTCGGTGCGG - Intergenic
1035856916 8:2985831-2985853 GGCCTCCTGGAGCACATTTCCGG - Intronic
1036261072 8:7240663-7240685 GGCCTCCTCCTCCACAGCTGTGG + Intergenic
1036305537 8:7598884-7598906 GGCCTCCTCCTCCACAGCTGTGG - Intergenic
1036356388 8:8046881-8046903 GGCCTCCTCCTCCACAGCTGTGG - Intergenic
1037239434 8:16760488-16760510 CTCCTCCTGCAGCCCTGGTGTGG - Intergenic
1037747860 8:21661172-21661194 AGCCTGCTGCAGCACAGTGGTGG + Intergenic
1041208291 8:55521083-55521105 GGCCTCCTTCAGCACAGCTGGGG - Intronic
1044404954 8:91816734-91816756 CTCCACCTGCAGCCCAGGTGCGG + Intergenic
1045150367 8:99400321-99400343 GGTTTCCTTCAGCACAGCTGAGG + Intronic
1045371665 8:101530167-101530189 CCCCTCCTGCACCAAAGGTGGGG + Intronic
1047765840 8:127989349-127989371 GACCTCCTGCAGCACAGCTTGGG + Intergenic
1048329177 8:133460708-133460730 GGGCTCCCGCAGCACAGAGGAGG + Intronic
1049413912 8:142486570-142486592 TGCCGCCTGCAGTACAGGTCTGG - Intronic
1049841888 8:144778177-144778199 GGACTACTGCAGCCCAGGTGTGG + Intronic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1052515126 9:29470917-29470939 GACCTCTTGCAAGACAGGTGTGG + Intergenic
1052979621 9:34438358-34438380 CTCCACCTGCAGCACCGGTGCGG + Intronic
1053363380 9:37505323-37505345 GTCTTCCTTCAGCAGAGGTGTGG + Intergenic
1056736001 9:89209771-89209793 CTCCACCTGCAGCACTGGTGTGG + Intergenic
1057195756 9:93115005-93115027 GAACACCTGCAGCACAGGTGTGG - Intergenic
1057631153 9:96719984-96720006 GGGCTCCTGAAGCGCGGGTGGGG + Intergenic
1058202051 9:102055837-102055859 GGCCTGCTGCAGCAGAGTGGAGG - Intergenic
1058944634 9:109844859-109844881 GGGGTTCTACAGCACAGGTGAGG - Intronic
1059612549 9:115914947-115914969 GGCCTACTGCAGCAGAGCAGGGG + Intergenic
1060518327 9:124279629-124279651 GTCCTCCCACTGCACAGGTGGGG - Intronic
1061296732 9:129680827-129680849 TGCCTCCTTCTGCACAGGAGTGG - Intronic
1061918287 9:133768639-133768661 GGCCTCCTGGATCACTGGTTGGG - Intronic
1203698455 Un_GL000214v1:117166-117188 GGCTTCCCGCTGCACAGCTGTGG + Intergenic
1190045801 X:47110952-47110974 CTCCACCTGCAGCCCAGGTGCGG - Intergenic
1194494877 X:94602176-94602198 GGCCATCTGCAACACAAGTGGGG - Intergenic
1195287841 X:103402709-103402731 TGCCACCTGCAGCTCAGTTGGGG - Intergenic
1198623545 X:138541697-138541719 GGCCTCCTGGAGCACAAAGGAGG - Intergenic
1200246721 X:154530447-154530469 TTCCACCCGCAGCACAGGTGAGG - Intergenic