ID: 933810844

View in Genome Browser
Species Human (GRCh38)
Location 2:86031844-86031866
Sequence GGTGAGCTCCACCTCTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933810844_933810853 25 Left 933810844 2:86031844-86031866 CCCTCACAGAGGTGGAGCTCACC 0: 1
1: 0
2: 1
3: 13
4: 180
Right 933810853 2:86031892-86031914 TGCTCACCGGTAAGTTCCCTCGG 0: 1
1: 0
2: 0
3: 4
4: 54
933810844_933810851 12 Left 933810844 2:86031844-86031866 CCCTCACAGAGGTGGAGCTCACC 0: 1
1: 0
2: 1
3: 13
4: 180
Right 933810851 2:86031879-86031901 TCACTGGTGTACCTGCTCACCGG 0: 1
1: 0
2: 0
3: 5
4: 138
933810844_933810846 -4 Left 933810844 2:86031844-86031866 CCCTCACAGAGGTGGAGCTCACC 0: 1
1: 0
2: 1
3: 13
4: 180
Right 933810846 2:86031863-86031885 CACCCTCACTCAGCCCTCACTGG 0: 1
1: 1
2: 2
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933810844 Original CRISPR GGTGAGCTCCACCTCTGTGA GGG (reversed) Intronic
900926812 1:5711181-5711203 GGAGAGCTCCTCCACTTTGAGGG + Intergenic
901005895 1:6171354-6171376 GGTGAAACCCACCTCTGAGAAGG + Intronic
901972208 1:12917356-12917378 GCTAAGCTCCACCTTTTTGAGGG - Intronic
902012970 1:13284406-13284428 GCTAAGCTCCACCTTTTTGAGGG + Intronic
902314161 1:15604972-15604994 GGTGACATCAAGCTCTGTGAGGG + Intergenic
903139301 1:21329358-21329380 GGTGAGTCTCACCTCTGTGCTGG - Intronic
905633462 1:39532000-39532022 TGTGAGCTCCACCACTGTTAGGG - Intergenic
906417196 1:45629600-45629622 TTTGAGCTCATCCTCTGTGAGGG + Exonic
906739313 1:48166474-48166496 TGTGACCTTCACTTCTGTGATGG + Intergenic
906878047 1:49559113-49559135 GGTGAGATCCAGTGCTGTGATGG + Intronic
907076220 1:51581512-51581534 GATATGCTCCACCTCTTTGAGGG + Intronic
910258752 1:85276311-85276333 AGTGAGGTCCTCCTCGGTGAGGG + Exonic
912748322 1:112264571-112264593 GTTGTCCTCCTCCTCTGTGATGG - Intergenic
913960848 1:143337135-143337157 TGTGGGCTCCAGCTCTGGGAAGG + Intergenic
914055202 1:144162707-144162729 TGTGGGCTCCAGCTCTGGGAAGG + Intergenic
914123944 1:144803654-144803676 TGTGGGCTCCAGCTCTGGGAAGG - Intergenic
915552146 1:156641552-156641574 AGTCAGCTCCTCCTCTGTGCAGG + Intronic
915705087 1:157836107-157836129 GGGGGCCTCCACCGCTGTGAAGG - Exonic
917447270 1:175117036-175117058 GGTGCGCTACACCTCTGCCAAGG + Exonic
917543788 1:175941020-175941042 GTTGAGCTCCCCCTTTGTGCAGG - Intergenic
918708162 1:187694451-187694473 AATGAGCTCCAAGTCTGTGATGG + Intergenic
919510441 1:198456610-198456632 GCTGAACTCCTACTCTGTGAAGG - Intergenic
921301260 1:213753538-213753560 GGTGAGCAACAGTTCTGTGATGG - Intergenic
921380251 1:214517202-214517224 GGTCACCTCCATTTCTGTGAAGG + Intronic
923955441 1:239013212-239013234 GGTGACCTGGACATCTGTGAGGG + Intergenic
1065964386 10:30759232-30759254 GGTGAGCCCCACCACTGAGCTGG + Intergenic
1067029287 10:42869390-42869412 TGTGGGCTCCAGCTCTGGGAAGG + Intergenic
1068299550 10:55120947-55120969 GGGCAGCCCCACCACTGTGATGG - Intronic
1068713200 10:60156461-60156483 GGTGAGCCCCAGCACTGTGCTGG + Intronic
1069530379 10:69213997-69214019 ACTGTGCTCCACCTCTTTGAGGG + Intergenic
1069577527 10:69541478-69541500 GGGCAGCTCCACCCCTGTGGAGG + Intergenic
1071297454 10:84232581-84232603 GGTCAGCTCCTCCTTTGTGCTGG + Exonic
1071689137 10:87796977-87796999 AGTGAGCTCAAACTCTGTAAAGG - Intronic
1075398889 10:122147522-122147544 GTTGTGCTCCTCCTCTGTTAGGG + Intronic
1075420310 10:122295510-122295532 GCTGAGCCCCTCCTGTGTGAAGG + Intronic
1078853839 11:15190241-15190263 GGTGAACTCCAGCTGAGTGATGG - Intronic
1079303013 11:19296205-19296227 CCTGGGCTCCATCTCTGTGAAGG + Intergenic
1079697246 11:23497116-23497138 GGTGTTCTCAACTTCTGTGATGG - Intergenic
1081646168 11:44792239-44792261 GGTCAGGGACACCTCTGTGAGGG + Intronic
1083742566 11:64718588-64718610 GGTGAGTTCCCCGTCTGTGGGGG + Intronic
1084553046 11:69860229-69860251 TGTGAGCTCTACCTCTGAGCTGG + Intergenic
1087929709 11:103962921-103962943 GGTGATTTCCATCTCTGTGGAGG - Intronic
1089779869 11:120866234-120866256 GTTCACCTCCACCTCTGGGAAGG + Intronic
1089980154 11:122765591-122765613 GTTGAGTTCCACCTCAGTGGAGG + Intronic
1090332681 11:125943898-125943920 GGTAGGCTTCACCTCTGTGATGG + Intergenic
1091108608 11:132944430-132944452 GGTGCACTCCACCTCTGCGCGGG - Intronic
1092295020 12:7190355-7190377 GGTGACCGCCAGCTCTCTGATGG - Exonic
1094348291 12:29496241-29496263 GATGAGCACCACTTCTGTGGAGG - Exonic
1094514724 12:31119946-31119968 GGTTACCTCCCCCTCTGCGATGG - Intergenic
1096760761 12:53840205-53840227 GGGGAGGTCCACATTTGTGAGGG + Intergenic
1098445612 12:70563019-70563041 GCTGAGCTCCCCCTCTGAGGCGG + Exonic
1101205102 12:102478872-102478894 GGTGAGCTCTGCCTCTGGGCAGG + Intronic
1104002705 12:124870346-124870368 GTTGAGCTCCTACTCTGTGCTGG + Intronic
1105595980 13:21838451-21838473 GATGAGCTCCGCCTCTCAGATGG - Intergenic
1106265721 13:28107806-28107828 GGTGACATCAAGCTCTGTGAGGG + Intergenic
1106391105 13:29336652-29336674 GCTGAGCTCCAGCGCTGTGCTGG + Intronic
1107832096 13:44383516-44383538 TGTTAGCTCCACCTCTCTGGAGG + Intronic
1110916709 13:81030335-81030357 GGTGAGATCCAGTTCTGTGCAGG - Intergenic
1111597982 13:90435172-90435194 GGTCTGCTCCACCTGTGTCATGG + Intergenic
1112697692 13:101969116-101969138 GCTTAGATCCACCTTTGTGAAGG + Intronic
1114647400 14:24263333-24263355 GGTGGGAGCCACCGCTGTGATGG + Intronic
1114976406 14:28106039-28106061 AATGAACTCCAACTCTGTGAGGG - Intergenic
1115864039 14:37722885-37722907 GTTATGCTCCACCTCTTTGAGGG + Intronic
1117189746 14:53278276-53278298 GGTGTGTTCCACCACTGTGAGGG + Intergenic
1119067926 14:71549370-71549392 GGACAGCTCCTTCTCTGTGAGGG - Intronic
1119252776 14:73171154-73171176 GGAGAGCCCATCCTCTGTGATGG + Intronic
1120370466 14:83627606-83627628 GGTAAGCTCCAGCTCTTTAAGGG + Intergenic
1120536178 14:85698489-85698511 GGTGTGTTCCACCTCCATGAGGG - Intergenic
1120841045 14:89085031-89085053 GTTGAGCTCCTCCTCTATGCTGG - Intergenic
1121405331 14:93716175-93716197 TGGGAGATCCAGCTCTGTGAGGG - Intergenic
1122390799 14:101381587-101381609 GGTAGGCTCAGCCTCTGTGAGGG + Intergenic
1123025479 14:105421770-105421792 GGGGAGCTGCACCTCCGGGATGG - Intronic
1123701906 15:22920725-22920747 GCTCAGCGCCATCTCTGTGATGG + Intronic
1124877436 15:33608388-33608410 AGTAATCTCCACCCCTGTGAGGG - Intronic
1127865198 15:63026884-63026906 GGGGAGCTCCACAGCTGAGAGGG - Intergenic
1129707761 15:77804464-77804486 GGTGAGCTCCCCATCGGGGAGGG + Intronic
1130559775 15:84948848-84948870 GGAGAGCTCCACTTCTGAGAAGG + Intergenic
1132907325 16:2289455-2289477 GGTGCGCTCCTCCTCGATGAGGG + Exonic
1136417300 16:30112060-30112082 GGTGGGCTCCAGCTCTGGGGAGG + Intronic
1140003984 16:71056623-71056645 GGTGAGTGCCACATCTGGGAAGG + Intronic
1141100446 16:81193881-81193903 AGTGAACCCTACCTCTGTGATGG + Intergenic
1142148836 16:88503852-88503874 GGTTAGCACCTCCTCTGTGGAGG + Intronic
1143164698 17:4892049-4892071 GGTGAGCTCCCCCACTTTGATGG - Intronic
1143703702 17:8681791-8681813 GCTGATGTCCACCTCTGGGAAGG + Intergenic
1144025181 17:11271120-11271142 GGTGTGCTCATCCTATGTGAGGG + Intronic
1146229329 17:31094758-31094780 GGTGAGCCCCACGGCGGTGAGGG + Intergenic
1146831743 17:36075601-36075623 AGTGGGTTCCACCTTTGTGAAGG + Intergenic
1147011078 17:37448727-37448749 GATGAGCTCCTCCTATGTGTTGG + Intronic
1148679970 17:49468027-49468049 GCTCAGCTCCGCTTCTGTGATGG - Intronic
1150227987 17:63534106-63534128 GATGAGATCCACCACAGTGAGGG - Exonic
1150655406 17:67035953-67035975 GGTGACCTCCCCCACTGGGATGG - Intergenic
1152538940 17:80965205-80965227 CGTGTGCTACACCTGTGTGAGGG - Exonic
1152572127 17:81125486-81125508 AGTGAGCTCCAGCTCTGAGTGGG - Intronic
1155208788 18:23583545-23583567 TTTGACCTCCAGCTCTGTGAAGG - Intronic
1156846798 18:41674924-41674946 GGTGGGCTCCTGCTTTGTGAGGG + Intergenic
1159030470 18:63225712-63225734 TGCGTGCTCCACCTCCGTGAGGG - Intronic
1160655374 19:264475-264497 TGTTAGCTCCACCTCTTTGATGG - Intergenic
1161706445 19:5824334-5824356 TGTAAGCTCCTCCTCTGTGTGGG + Exonic
1162271669 19:9621140-9621162 GGTGAGTTCCACCTCCTTGGCGG - Exonic
1162391568 19:10393247-10393269 GGGGAGCCCCACCTCAGGGAGGG + Exonic
1163084927 19:14972684-14972706 GGTGAGCTCTGCCTCTTGGAGGG - Exonic
1164905607 19:31965000-31965022 GGTGACCTCCACTTCAGAGAAGG + Intergenic
1165102105 19:33444979-33445001 GGTGACCTCCAGCTTTCTGAAGG - Intronic
1165195402 19:34098611-34098633 GTTATGCTCCACCTCTGTGGGGG - Intergenic
1166072406 19:40394878-40394900 GGTCAGCTCCACCTGTGGCAGGG + Exonic
1202694684 1_KI270712v1_random:115384-115406 TGTGGGCTCCAGCTCTGGGAAGG + Intergenic
925966124 2:9067944-9067966 GTTATGCTCCACCTCTTTGAGGG + Intergenic
926584967 2:14675731-14675753 GGCCAGCTCCACATCTGGGAGGG + Intergenic
930493870 2:52112202-52112224 GTTAAGCTCCACCACTGTGGTGG + Intergenic
932573396 2:72950080-72950102 GGCGAGCTCCTCCACTCTGAAGG - Intronic
933810844 2:86031844-86031866 GGTGAGCTCCACCTCTGTGAGGG - Intronic
933819766 2:86100042-86100064 GGTGTGCTCCACCTGCGTGCAGG - Exonic
934275856 2:91572430-91572452 TGTGGGCTCCAGCTCTGGGAAGG + Intergenic
936378603 2:111964118-111964140 GTTATGCTCCACCTCTTTGAGGG + Intronic
936982407 2:118276722-118276744 GGTGTGCCCCACATCTGTCAGGG - Intergenic
937460735 2:122083516-122083538 GCTGAGCCCCTCCTATGTGATGG + Intergenic
939727335 2:145738743-145738765 TGTGAGCTGCACATCTGGGAGGG - Intergenic
944911776 2:204317659-204317681 AGAGAGCTCCACTTCTGTGTTGG - Intergenic
948589514 2:239040155-239040177 GGTGAGCTCCTCCCATGCGAAGG + Intergenic
1171393733 20:24817619-24817641 GTTCAGCCCCACCTCTGGGAGGG + Intergenic
1172216549 20:33239699-33239721 GGGAAGCTCTACCTCTGGGATGG + Intronic
1172331365 20:34078186-34078208 GGTGAGCTCCCCATCTCTGGGGG - Intronic
1174493244 20:50919181-50919203 TGTGAGCTACACCTGTGAGATGG - Intronic
1175768280 20:61606249-61606271 GATAAGCACCACCTCTGTGCCGG + Intronic
1178323415 21:31623543-31623565 TATGAGCTCTTCCTCTGTGAGGG - Intergenic
1179101440 21:38358641-38358663 GGTGTGATCCACTTCTGAGAGGG - Intergenic
1179555936 21:42176147-42176169 TGTGAGCTTCAGATCTGTGAGGG - Intergenic
1181666842 22:24404439-24404461 AGGGAGCTCTGCCTCTGTGAAGG + Intronic
1182090978 22:27594612-27594634 TGCAAGATCCACCTCTGTGATGG - Intergenic
1183272152 22:36868862-36868884 AGTGAGCTCCCCATCTCTGAGGG - Intronic
1184577916 22:45388560-45388582 GCTGAGCCCCTCCTCTGTGCAGG + Intronic
952420294 3:33124460-33124482 GGCCAGCTCCATGTCTGTGATGG - Exonic
953912598 3:46900457-46900479 GGTGAGCTGTGCCTCTGGGAAGG - Intronic
954687974 3:52380726-52380748 GGTGAGCTCCCCGTCAGGGAGGG + Intronic
960177338 3:114532616-114532638 GGAGAGCTCGAGCTCTGTGATGG - Intronic
960534584 3:118802406-118802428 GGTGTGTTCCACCACTGTGGGGG + Intergenic
961413791 3:126742933-126742955 GGTGACCACCACCTATCTGATGG - Intronic
963845131 3:150147696-150147718 GGTGAGCTCCCCATCTGTGCAGG + Intergenic
966913619 3:184572994-184573016 GGTGGGCTCCGCCCCAGTGAGGG - Exonic
968943153 4:3649825-3649847 GGTGAGCTCCGCCTCGATGCAGG - Intergenic
969028558 4:4193415-4193437 GGTGGGCTCCACTTCAGAGACGG - Intronic
970322254 4:14886290-14886312 GGTGAGATCAACACCTGTGAGGG - Intergenic
971054462 4:22896919-22896941 GGTAATCTTCCCCTCTGTGAAGG - Intergenic
972724248 4:41732403-41732425 GTTGAGCTCTACATCTGTGCAGG + Intergenic
975763011 4:77636240-77636262 GGTGTGTTCCACCACTGTGAGGG + Intergenic
984759012 4:183348044-183348066 GATGGGCTCCACCACTGTGCTGG - Intergenic
984832394 4:183987685-183987707 GGTGAGCTCCACCGCTGCCCGGG + Intronic
985369980 4:189276399-189276421 GGTGAGCTCTACCTCAGTGTTGG - Intergenic
985987989 5:3533428-3533450 GCTGAGCACCGCCTCTGGGAGGG - Intergenic
991703198 5:69334276-69334298 GGTGACATCAAGCTCTGTGAGGG + Intergenic
1002319620 5:178367279-178367301 CGGGAGCTCCACGTCTGAGAGGG + Intronic
1002475652 5:179464221-179464243 AGTGAGCCACACCCCTGTGAGGG - Intergenic
1004353188 6:14908869-14908891 TGTGAGCACCACCACTGTCAAGG - Intergenic
1004469737 6:15918806-15918828 GCAGAGCTCCACTTCTGGGAAGG + Intergenic
1006020779 6:31116470-31116492 GGTGGGGTCCAGCTCTGTGGAGG - Exonic
1007826564 6:44605397-44605419 GGTGAGCTCCTCCTGGGTGTTGG + Intergenic
1009797905 6:68495367-68495389 GGAGAGCTCCAGCACTGTGCTGG - Intergenic
1011352245 6:86435342-86435364 GGTGATCTCCACCTATATGTGGG + Intergenic
1011665199 6:89626635-89626657 GGTGAGCTCCCCTCCTGTCAGGG - Intronic
1013995649 6:116304698-116304720 GGGCAGCTCCTCCTCTGTGCTGG - Intronic
1014584656 6:123183076-123183098 GCGGAGCTCAAGCTCTGTGATGG - Intergenic
1015786516 6:136924263-136924285 GGTGGGCTCCACGTCGCTGAAGG - Exonic
1016185634 6:141195351-141195373 TGTGAGATCCAGTTCTGTGATGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019254666 7:41538-41560 GGTGAGTTCCACCTCACTGAAGG - Intergenic
1022771024 7:33473040-33473062 GCCGAGCTCCAGCTCTGGGATGG + Intronic
1025096880 7:56102905-56102927 GGTGACATCAAGCTCTGTGAGGG - Exonic
1026374164 7:69733498-69733520 GGTGAAATCCTCCTCTGAGAAGG + Intronic
1031055524 7:116989321-116989343 GGTGAGCTCCACAGCTGTGAAGG - Intronic
1034078389 7:148254060-148254082 GGTGAACTACATTTCTGTGAGGG + Intronic
1036093598 8:5697447-5697469 GGTGTGCTCCATCTCATTGAGGG + Intergenic
1038331032 8:26609675-26609697 GGGGAGCTCCAGCTCAGCGACGG - Intronic
1040355950 8:46618221-46618243 GGTGAGCTCCACTCCAGCGAGGG + Intergenic
1047517608 8:125568720-125568742 GGTGAGATTCAGCTCTGTCAGGG + Intergenic
1056001030 9:82216541-82216563 GGAGAGCTCCAGCTCTGTGCTGG - Intergenic
1056648486 9:88436408-88436430 GGTGTGCTGCACATTTGTGAGGG - Intronic
1057145055 9:92752877-92752899 AGTTTGCTCCACCTCTTTGAGGG - Intronic
1057796609 9:98162263-98162285 GGTGAGATCCAGGGCTGTGATGG - Intronic
1058901655 9:109447444-109447466 GGTGAGCTCCCCCTCACTGGGGG + Intronic
1062140675 9:134956224-134956246 GGTGAGCCCCACCGTGGTGAAGG - Intergenic
1062337290 9:136077635-136077657 GGGGACCTTCTCCTCTGTGAAGG - Intronic
1062391735 9:136336583-136336605 GGTCACCTCCAGCTGTGTGACGG - Intronic
1186911573 X:14173649-14173671 GGTGAGATCCAGCGCTGTGCTGG - Intergenic
1189631233 X:42955718-42955740 GGAAATCTCCACCTCTGAGAAGG + Intergenic
1189931697 X:46018802-46018824 TGTAAGCTCCACCTCATTGAGGG + Intergenic
1189999497 X:46671920-46671942 ACTGAGCTCCACCTCCTTGAGGG + Intronic
1190405699 X:50085288-50085310 AGAGACCTCCACCTCTGTGTAGG - Intronic
1192142185 X:68655157-68655179 GGTGAGCTCCACATCACTGGAGG - Intronic
1194976004 X:100396546-100396568 GCTGAGCTCAACTTCAGTGAAGG + Intronic
1197870326 X:131058025-131058047 GGTGAGCCCCAAATCTGAGAGGG - Intergenic
1199037144 X:143064447-143064469 GGTGAGCTCCAGTGCTGTGCTGG + Intergenic
1199189049 X:144949515-144949537 GGTGAGCCCCACTACTGTGCTGG + Intergenic
1199679790 X:150216623-150216645 GTTGGCCTCCAGCTCTGTGAGGG + Intergenic
1199695438 X:150340426-150340448 GTTGGCCTCCAGCTCTGTGAGGG - Intergenic
1200048153 X:153413463-153413485 GGGCTGCTCCACCTCTGTGAGGG - Intergenic