ID: 933811467

View in Genome Browser
Species Human (GRCh38)
Location 2:86035393-86035415
Sequence AGTCCTGACCTGCCACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933811467 Original CRISPR AGTCCTGACCTGCCACAGAC TGG Intronic
900006499 1:58058-58080 AGTCTTTACCTCCCACAGTCTGG + Intergenic
900746639 1:4365412-4365434 TCTCCTGACCTGCCCCCGACTGG + Intergenic
901644804 1:10710604-10710626 AGCCCTGAGCTGGCAGAGACTGG - Intronic
902161282 1:14532315-14532337 AGTCCTGTCATGACTCAGACAGG + Intergenic
902301424 1:15505331-15505353 AGCCCTGCCCAGCCACAGGCTGG + Intronic
902726792 1:18341682-18341704 ACCCCTGCCCTGCCACACACTGG - Intronic
903645598 1:24894088-24894110 AGTCTTGCCCCGCCACAAACAGG - Intergenic
904285320 1:29450057-29450079 AGCCCTGGCCTGGCACAGACAGG + Intergenic
905665516 1:39761004-39761026 AGGCCTGGCCTCCCAGAGACTGG - Intronic
905807022 1:40884519-40884541 GGTCCTGAGCTGCCCCAGGCTGG - Intergenic
906120070 1:43383649-43383671 AGTCCTTTGCTGCCACAGCCTGG + Intergenic
906149424 1:43578907-43578929 AGTCCTTACCTCGCACATACAGG - Exonic
906249898 1:44302863-44302885 ATCCCTGCCCTGCCACAAACAGG + Intronic
907551636 1:55309917-55309939 AGTCCTGACCAGCCACTGAGAGG - Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
913097596 1:115534351-115534373 AGACCTGGTCTGCCACAGAAGGG + Intergenic
917444834 1:175098495-175098517 AGTCCTGACAGGCCTGAGACCGG + Exonic
919877917 1:201884065-201884087 AGTCCTGCTCTGCCACTTACTGG - Exonic
921355666 1:214281863-214281885 AGTCCAGCCCTGCCTCAGATTGG + Intronic
922472284 1:225883761-225883783 ACTCCTGGACAGCCACAGACTGG - Intergenic
922671087 1:227509190-227509212 AGGTCTGACCTGCCTCAGTCTGG + Intergenic
1062763717 10:46154-46176 AGGTCTGACCTGCCCCAGTCTGG - Intergenic
1067171526 10:43910824-43910846 AGTCCTGACCAGCCCCTGCCAGG - Intergenic
1069795772 10:71050846-71050868 AGGCCTGGCCTGCCTCAGGCAGG - Intergenic
1070577823 10:77693100-77693122 AGTCCTGAACCACAACAGACAGG + Intergenic
1070801959 10:79249056-79249078 AGTCCTGGCCTCCCACACACAGG - Intronic
1072132356 10:92507780-92507802 AGTCCTCACCTCCCTGAGACTGG + Intronic
1073474942 10:103746689-103746711 AATCCTGCCCGGCCACAGAAGGG - Intronic
1075555436 10:123427498-123427520 AGTCCGCACCTTCCACAGCCTGG + Intergenic
1076909820 10:133381404-133381426 AGTCCTGCCCTTCCAGGGACTGG + Intronic
1077265318 11:1645618-1645640 AGTGCTGAACTGCCTGAGACAGG - Intergenic
1077713342 11:4557410-4557432 AGTTCTGAACTGCCACTGAGTGG - Intergenic
1080332215 11:31152829-31152851 AGTCCTGACTAACCACAGAACGG + Intronic
1080884483 11:36353819-36353841 ATTCCTAACAGGCCACAGACTGG + Intronic
1081726909 11:45336512-45336534 AGTCCTCACCTGGCACAGTGTGG + Intergenic
1084406383 11:68976337-68976359 AGTCGTGGCCTCCCACGGACTGG - Intergenic
1088916441 11:114231416-114231438 AGCCCTCACCTGGCACAGAGAGG + Intronic
1089913435 11:122127341-122127363 AGTTCTGCCATGCCACACACAGG + Intergenic
1090947865 11:131447873-131447895 AGGCCAGACCTGCCCCAAACGGG - Intronic
1092571136 12:9722764-9722786 AATCATGTCCTGCCAAAGACTGG - Exonic
1094813566 12:34163886-34163908 AGGTCTGACCTGCCCCAGTCTGG - Intergenic
1095103349 12:38204649-38204671 AGGTCTGACCTGCCTCAGTCTGG + Intergenic
1095513558 12:42980287-42980309 AACCCTGAGTTGCCACAGACTGG - Intergenic
1095695827 12:45143010-45143032 ATTCCTAACAGGCCACAGACTGG + Intergenic
1096245271 12:49981394-49981416 AGACCTGGCCTGCCACACGCTGG - Intronic
1096969019 12:55650724-55650746 AGACCTGGCCTGCCACAGTTTGG + Intergenic
1097521573 12:60677335-60677357 AATCCTGATCTGACACAGAAAGG - Intergenic
1103558232 12:121778705-121778727 AGTCCTGTCCTACCACAGTGGGG + Exonic
1106658314 13:31771261-31771283 GTTCCTAACATGCCACAGACTGG - Intronic
1106975259 13:35204023-35204045 GTTCCTGACAGGCCACAGACCGG - Intronic
1107271113 13:38617636-38617658 GGTCCTGACCTTCCACTAACAGG - Intergenic
1108613473 13:52107208-52107230 AGACCTGGCCTGCCACAAAATGG - Intronic
1109159281 13:58951847-58951869 AGTCCTGAACAGACAAAGACAGG + Intergenic
1111877264 13:93912855-93912877 AGTCCCTACCTGCCAGTGACTGG + Intronic
1112054445 13:95677341-95677363 AGTCCTGCCCTGCCCCGGCCAGG + Intronic
1112644925 13:101319234-101319256 AGTCCTAACCTGCTATAGTCAGG + Intronic
1113036920 13:106060982-106061004 ATTCATGTCCTGCCACAAACTGG + Intergenic
1113604704 13:111597049-111597071 AGTTCTGACCTACCTTAGACTGG + Intronic
1114476265 14:22997201-22997223 AGTCCTGACCAGCCACAGACTGG + Intronic
1117554406 14:56869833-56869855 GGTCCTAACAGGCCACAGACTGG - Intergenic
1118835279 14:69473528-69473550 AGTGCTGACCAGCCACAGCAAGG + Intergenic
1119844985 14:77822536-77822558 AGTCCTGGCCTGGCTCAGATGGG - Intronic
1123150867 14:106180600-106180622 AGTCCTGAGATGCTGCAGACAGG - Intergenic
1123399285 15:19968457-19968479 AGTCCTGAGATGCTGCAGACAGG - Intergenic
1123493379 15:20800003-20800025 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1123549888 15:21369105-21369127 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1127325233 15:57888418-57888440 AATCCTGACTTCCCACAGATAGG + Intergenic
1129381780 15:75172434-75172456 AGTGCTGACCTGCCCCAGTGAGG + Intergenic
1129895994 15:79106303-79106325 GGACATGACCTGCCACAGAGTGG - Intergenic
1130263952 15:82381638-82381660 AGTACTGTTCTGCCACACACGGG + Intergenic
1130277078 15:82485953-82485975 AGTACTGTTCTGCCACACACGGG - Intergenic
1130469440 15:84213303-84213325 AGTACTGTTCTGCCACACACGGG - Intergenic
1130476930 15:84327867-84327889 AGTACTGTTCTGCCACACACGGG - Intergenic
1130494835 15:84460263-84460285 AGTACTGTTCTGCCACACACGGG + Intergenic
1130591734 15:85217932-85217954 AGTACTGTTCTGCCACACACGGG - Intergenic
1130765646 15:86868086-86868108 CATCCTGACCTCTCACAGACCGG - Intronic
1131369386 15:91867073-91867095 AGCCCTGACATGCCCCAGCCCGG - Intronic
1132447023 15:101932899-101932921 AGTCTTTACCTCCCACAGTCTGG - Intergenic
1202958217 15_KI270727v1_random:96323-96345 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1132621644 16:870656-870678 AGCCCTGACCAGCCACATTCAGG - Intronic
1134059138 16:11188508-11188530 AGCCCACACCTGCCAAAGACTGG - Intergenic
1134065962 16:11228421-11228443 AGCTCTGACCTGGCACAGTCAGG - Intergenic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1134746603 16:16593613-16593635 AGTCCTACCCTGCCACCTACAGG - Intergenic
1134998871 16:18760067-18760089 AGTCCTACCCTGCCACCTACAGG + Intergenic
1136417873 16:30114435-30114457 ATTCCAGAACTGCCAGAGACTGG + Exonic
1136900082 16:34026281-34026303 AGTTCTGACCAGCCAGAGAAGGG + Intergenic
1137512326 16:49112454-49112476 TGCCCTGACCTGCCTCAGAGTGG - Intergenic
1137781712 16:51103152-51103174 AGTCCTGCCATGCCAAAGAAAGG + Intergenic
1139340959 16:66267551-66267573 GGTCCTGACCTGCCTCAGCCAGG - Intergenic
1141193298 16:81840734-81840756 ATTCCTAACGGGCCACAGACAGG + Intronic
1141270731 16:82538877-82538899 AGTCCTCACTTGCCAAAGAATGG - Intergenic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1141466212 16:84207340-84207362 AGACCTGGCCTGCCACACAGAGG - Intergenic
1141649650 16:85386076-85386098 AACCCTGACCTGTCACAGAGAGG - Intergenic
1145978673 17:28998717-28998739 ACACCTGACCTGCCAGAGATAGG + Intronic
1146946655 17:36878027-36878049 AGTCCAGACCAGACTCAGACAGG - Intergenic
1147122065 17:38341455-38341477 AGCCCTGACCTGGCACTGCCTGG + Intronic
1147311010 17:39596232-39596254 AGCCCAGGCCTGGCACAGACAGG + Intergenic
1147597162 17:41724653-41724675 AGTGCTCACCTGCCCCAGCCTGG - Exonic
1148866319 17:50630648-50630670 AGTCCCCACCTGCCACAGCCTGG + Intergenic
1149748732 17:59124858-59124880 AGTCCTAACCTGTCATAAACAGG - Intronic
1151296381 17:73189507-73189529 AGACCTCAGCTGCCACAGCCGGG - Intergenic
1151835947 17:76582867-76582889 AGTCCTGACCTGCCCCGCATTGG + Intronic
1152057799 17:78044979-78045001 TGTCCTGCCCTCCCAAAGACAGG - Intronic
1152956626 18:46487-46509 AGGTCTGACCTGCCCCAGTCTGG - Intergenic
1155740898 18:29286361-29286383 AGCCCTGACCTGCAAATGACAGG + Intergenic
1156513759 18:37662559-37662581 GGTCCTCACGTGCCACAGACAGG + Intergenic
1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG + Intronic
1158584726 18:58721876-58721898 AGTCCTGGCCTGCGTCAGAGGGG + Intronic
1160044704 18:75375902-75375924 AGTCCACACCTGGCACAGGCAGG + Intergenic
1160568238 18:79799717-79799739 AGTTCTCAGCTGCCACAGGCAGG + Intergenic
1160638253 19:99634-99656 AGTCTTTACCTCCCACAGTCTGG + Intergenic
1160739217 19:678153-678175 AGTCCTGAGCTGCAAGAGGCTGG - Intronic
1162105294 19:8366487-8366509 AGCCCTGACCTGGCCCAGCCAGG + Intronic
1164233287 19:23310030-23310052 AGTCCTCACCTGCCAGAGCTGGG - Intronic
1164978967 19:32598263-32598285 AGGCCTGGACTGACACAGACTGG - Exonic
1166659441 19:44636637-44636659 AGCACTGAGCTCCCACAGACAGG - Exonic
1167093086 19:47358096-47358118 TGTCCTGGTCGGCCACAGACAGG - Exonic
1167419723 19:49395700-49395722 AGTCCTCACCAGCCACAGGCAGG - Intronic
1168536572 19:57175273-57175295 AGGCTTGACCAGCCACTGACGGG + Intergenic
925022680 2:584076-584098 AAGCCTGACCTAACACAGACGGG - Intergenic
926951922 2:18252442-18252464 AGGCTTGGCCTGCCACAGTCAGG + Intronic
927125702 2:20011256-20011278 AGTCCTGACCTGCCTCCCTCTGG - Intronic
927228034 2:20789670-20789692 GTTCCTGACAGGCCACAGACAGG - Intronic
929941014 2:46334043-46334065 ATTCCTGGGCTGCCACAGGCTGG - Intronic
931553628 2:63475066-63475088 AGTGCTAAGCTGCCACATACTGG + Intronic
933749374 2:85593291-85593313 TTTCCTGTCATGCCACAGACTGG + Exonic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
938358183 2:130668342-130668364 AGTACTGATGTGCCACAGAGAGG + Intergenic
938684188 2:133720971-133720993 ATTCCTAACAAGCCACAGACTGG + Intergenic
940973081 2:159914701-159914723 AGTAGTGACTTGCCAGAGACAGG + Intergenic
941676238 2:168346098-168346120 ATTCCTAACAGGCCACAGACTGG - Intergenic
944264628 2:197709721-197709743 AGGCCTGACTTTCCAAAGACAGG + Intronic
945139666 2:206671112-206671134 AGTTCTGACCTGACCCAGTCTGG + Intronic
948841307 2:240650797-240650819 AGACCTCACCTGCCACAGCCAGG + Intergenic
948841929 2:240655532-240655554 AGTCCTGGTCTGCCTCACACAGG - Intergenic
948946157 2:241220825-241220847 AGGCGTGAACTGCCACAGCCAGG - Intronic
1170280352 20:14639519-14639541 AGTCCTGTCTGGCCACAGACAGG - Intronic
1171204429 20:23267842-23267864 AGTCCTGACCAAACACAGACTGG + Intergenic
1172098004 20:32470026-32470048 GGCCCTGACCTGCCCCAGCCAGG + Intronic
1173570585 20:44073174-44073196 GTTCCTGACAGGCCACAGACTGG - Intergenic
1175203610 20:57294248-57294270 ATTCCTAACAGGCCACAGACCGG + Intergenic
1175257845 20:57657710-57657732 TGTCCAGACCTGCCAGGGACAGG + Intronic
1176445305 21:6816032-6816054 ACTCCTGCCCTGCCACACCCTGG - Intergenic
1176823473 21:13681065-13681087 ACTCCTGCCCTGCCACACCCTGG - Intergenic
1179945189 21:44669391-44669413 AGTCCTGCTCTGTCACAGGCTGG - Intronic
1180096281 21:45556676-45556698 TGGCCGGAGCTGCCACAGACAGG + Intergenic
1181580882 22:23827454-23827476 AATCCTGACCTGCCACCACCAGG - Intronic
1182273333 22:29169707-29169729 AGTCCTCACCTGGCTCAGCCAGG - Intergenic
1182896597 22:33864113-33864135 AGTCTTGACCTGACAGAGACAGG + Intronic
1183484585 22:38082276-38082298 AGTCCCGCCCTGGCACAGACTGG + Intronic
1184946548 22:47808142-47808164 ATTTCTGAGCTACCACAGACAGG - Intergenic
1185226527 22:49656747-49656769 ATTCCTGCCCCGCCACAGGCAGG + Exonic
949438231 3:4051876-4051898 AGTACTGACCTTACTCAGACCGG - Intronic
950580903 3:13861495-13861517 AGTCCTCAGCTGCCACGGAGTGG - Intronic
953424408 3:42781531-42781553 AGTCTAGACCTGCCAAAGGCGGG + Intronic
953790670 3:45945584-45945606 AGTCCTAACCTGCCAATCACAGG + Exonic
954198826 3:49012310-49012332 AAGCTTGACCTGCCACACACGGG - Exonic
954710291 3:52502078-52502100 AGCCCTTACCTGGCACACACAGG - Exonic
956987871 3:74724210-74724232 ATTACTGACAGGCCACAGACAGG - Intergenic
961737171 3:129009740-129009762 AGTCTTGAGCTGCCACAGGTGGG - Intronic
962857627 3:139363239-139363261 ATTCCTAACAGGCCACAGACTGG - Intronic
963138320 3:141928059-141928081 AGTCCTTACCTGGCCCATACAGG - Intergenic
965479971 3:169206153-169206175 ATCCCAGTCCTGCCACAGACAGG - Intronic
965769582 3:172167657-172167679 GTTCCTAACATGCCACAGACAGG - Intronic
966918637 3:184598285-184598307 AATCCAGACCTGCCACTTACAGG + Intronic
968357705 3:198121730-198121752 AGGTCTGACCTGCCCCAGTCTGG + Intergenic
969457343 4:7307538-7307560 AGCCCTGACCTGCCCCAGCCTGG - Intronic
971961507 4:33493474-33493496 ATTCCTGACAGGCCATAGACTGG + Intergenic
975981091 4:80160195-80160217 AGTCCTGACCTCCAACAGTCAGG + Intergenic
977303563 4:95296056-95296078 AGTCTTGCCCTGTCCCAGACGGG - Intronic
979269590 4:118744345-118744367 AGCACGGACCTGGCACAGACTGG - Intronic
983533609 4:168834313-168834335 GGTCCTCACCTGGGACAGACTGG - Intronic
984216927 4:176925375-176925397 AGTTCTTACCTCCCCCAGACTGG + Intergenic
985440854 4:189981603-189981625 AGGTCTGACCTGCCCCAGTCTGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985785484 5:1891425-1891447 AGTCCTGTCCTGCCACAGCACGG + Intergenic
990514848 5:56521443-56521465 AATGCTGACTTCCCACAGACTGG + Intronic
990751087 5:59017096-59017118 AGACCTGTCCTCCCTCAGACTGG - Intronic
994841739 5:104932655-104932677 GTTCCTGACAAGCCACAGACTGG + Intergenic
997091273 5:130861581-130861603 ATGCCTGACCTTCCACAGGCTGG - Intergenic
997169434 5:131701023-131701045 ATTCCTGACAGGCCACTGACGGG - Intronic
997740897 5:136252846-136252868 ATTCCTAACAGGCCACAGACTGG + Intronic
998515500 5:142750062-142750084 AGGCCTGAGCTGGCACAAACAGG + Intergenic
1001568739 5:172716671-172716693 AATCCAGACCTGCCACTCACTGG + Intergenic
1002116875 5:176969156-176969178 CTTCCTGAGCTGCCAGAGACCGG + Exonic
1002275747 5:178103506-178103528 GGTCCTGGCCTGTGACAGACCGG + Intergenic
1002932489 6:1644101-1644123 CGTGCTGACCTACCTCAGACCGG - Intronic
1004350662 6:14887752-14887774 AGACCTGACCAGCCCCACACTGG + Intergenic
1005272392 6:24180040-24180062 AGTCCTGACCAGGCACTTACTGG + Intronic
1006202240 6:32304982-32305004 AGACCTGCCCTGCCACAGTAAGG - Intronic
1014221670 6:118804566-118804588 AGTCTTGGCCTGAGACAGACGGG + Intergenic
1015301006 6:131653209-131653231 AGTCTTGACCTCCCAGACACAGG + Intronic
1016765409 6:147787553-147787575 AGTCCTGAATTGTCACTGACAGG + Intergenic
1017986816 6:159450942-159450964 AGTCTTGCCCTGGCACAGGCTGG + Intergenic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1020826489 7:13035542-13035564 ATTCCTAACGGGCCACAGACAGG - Intergenic
1021806553 7:24362606-24362628 ACTCCTGATCTGCCTCAAACTGG + Intergenic
1022467473 7:30661326-30661348 AGTGCAGACCTGCCTCAGATAGG + Intronic
1022482397 7:30752612-30752634 AGTCCTGACCTTGCACAGCCAGG + Intronic
1023931387 7:44708547-44708569 TGGCCTGACCTGGCACAGAAAGG + Exonic
1024190973 7:47009428-47009450 AGACCTGGCCTGCCACAGTGGGG - Intergenic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1025788349 7:64665178-64665200 AGTTCTGACCAGCCACATTCCGG - Intergenic
1026300543 7:69094055-69094077 GTTCCTGACAGGCCACAGACTGG + Intergenic
1026870526 7:73848497-73848519 AGACCTGGCCTGCCACAGTGCGG + Intergenic
1034469468 7:151247765-151247787 AGCACTGTCCTGCCACAGGCAGG - Intronic
1036431689 8:8697999-8698021 GTTCCTGACAGGCCACAGACTGG - Intergenic
1037490652 8:19394275-19394297 AGTTCTAACAGGCCACAGACTGG + Intronic
1037771829 8:21805760-21805782 AGTCATGTCCAGCCACTGACTGG - Intronic
1039961094 8:42248306-42248328 ATTCCTAACAGGCCACAGACCGG + Intergenic
1040837964 8:51752529-51752551 AGACCTGGCCTGCCACAGAAGGG + Intronic
1044900560 8:96939361-96939383 ATTCCTAACAGGCCACAGACTGG + Intronic
1048902777 8:139055733-139055755 AGTCCTGACAGCTCACAGACAGG - Intergenic
1049294065 8:141820769-141820791 AGTCCTGATCTTCCACACCCAGG + Intergenic
1049672898 8:143877637-143877659 TGTCCTGACCTGACTCAGGCAGG - Intronic
1052045434 9:23788661-23788683 AGTTCTGACATGCCAAAGAGAGG - Intronic
1052448977 9:28601814-28601836 AGTTCTGACCTGCTGCAGACAGG - Intronic
1053072710 9:35110650-35110672 AGTCCTTGCCAGCCACAGCCTGG - Exonic
1056803662 9:89711652-89711674 ATCCCTGGCCTGCCACAGCCTGG - Intergenic
1057299786 9:93871194-93871216 ACACCTGACCTCCCACAGTCTGG + Intergenic
1057377096 9:94535121-94535143 AGACCTGACCTACCACTGATGGG + Intergenic
1057860684 9:98638447-98638469 AGAGCTGGCCTGCCACAGAGAGG - Intronic
1058420285 9:104826977-104826999 AGTCCTGCCATGCCACACACAGG + Exonic
1058966056 9:110039495-110039517 AATCCTGACCTGTCACTTACTGG - Intronic
1059391927 9:114004665-114004687 AGCCCTGCCCTGACCCAGACTGG + Intronic
1060643266 9:125257078-125257100 ATTCCTAACAAGCCACAGACGGG - Intergenic
1061369848 9:130192069-130192091 AGGCCTGAGCTGCCCCAGAAAGG - Intronic
1061746071 9:132741117-132741139 TGCCGTGACCTGGCACAGACTGG - Intronic
1062741552 9:138178224-138178246 AGGTCTGACCTGCCCCAGTCTGG + Intergenic
1203523890 Un_GL000213v1:68493-68515 ACTCCTGCCCTGCCACACCCTGG + Intergenic
1185738761 X:2513434-2513456 AGACCTGGCCTGCCACAGGTGGG + Intergenic
1185977841 X:4741221-4741243 AGACCTGGCCTGCCACAGAATGG + Intergenic
1187280112 X:17852100-17852122 AATCCTGGCCTGCAACGGACTGG + Intronic
1192853306 X:74980674-74980696 AGTCCTGACCTGGGCCAGAGAGG + Intergenic
1193084761 X:77439085-77439107 ACTCCTGACCTCCCAAAGTCTGG + Intergenic
1195935423 X:110120933-110120955 AGTTCTGCCCTGCCACTGGCTGG + Intronic
1196384967 X:115139729-115139751 AGTGCTGCCCTGCCACAGAGGGG + Intronic
1197461777 X:126751491-126751513 AGACCTGGCCTGCCACATAGAGG + Intergenic
1199452111 X:147989255-147989277 AGAGCAGACCTGCCACAGAGGGG - Intronic