ID: 933814502

View in Genome Browser
Species Human (GRCh38)
Location 2:86054879-86054901
Sequence ACATTCCCAGAGATGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933814498_933814502 14 Left 933814498 2:86054842-86054864 CCAGAGTTGGCTACAGAAGGGCC 0: 1
1: 0
2: 0
3: 17
4: 83
Right 933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 238
933814500_933814502 -7 Left 933814500 2:86054863-86054885 CCGAATGCAGGTGCACACATTCC 0: 1
1: 0
2: 0
3: 12
4: 144
Right 933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG 0: 1
1: 0
2: 3
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933814502 Original CRISPR ACATTCCCAGAGATGAAGCA GGG Intronic
902171359 1:14614112-14614134 ACATTGCTGGAGATGAGGCAGGG - Intronic
907782952 1:57583843-57583865 GCATTTCCAGAGAAGAACCAAGG - Intronic
908539645 1:65110730-65110752 ACATGGCGAGAGAAGAAGCAAGG + Intergenic
908810458 1:67976914-67976936 ACAGTCCCAGGGATTATGCATGG + Intergenic
911037067 1:93562178-93562200 GCTTTCCCAAAGATGAAGCTGGG + Exonic
911847423 1:102772022-102772044 ACATTCTGAGAGATGAGGCAGGG - Intergenic
912039077 1:105362663-105362685 ACATAGCAAGAGAGGAAGCAAGG - Intergenic
912709350 1:111938778-111938800 ATAATCCCAGAGAGGGAGCAGGG + Intronic
913939971 1:125093005-125093027 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
916045509 1:160997317-160997339 ACTGTCCCAGAGCTGAGGCAAGG - Exonic
917183617 1:172326416-172326438 ACATTCCCAGAACTGACTCAGGG - Intronic
917813039 1:178679023-178679045 ACATGGCAAGAGAAGAAGCAGGG + Intergenic
919738787 1:200970303-200970325 ACATCCCCAGACAGGCAGCAGGG + Intronic
920324270 1:205149762-205149784 AAATTCCCACAGAAGAATCAAGG - Intronic
1067201838 10:44179599-44179621 ACTTTCCCAGTGATGAGGAAGGG - Intergenic
1068026712 10:51654633-51654655 AAATTCACAGAGATGACACAAGG - Intronic
1069941813 10:71961926-71961948 TACTTCCCAGAGAGGAAGCAAGG + Intergenic
1070591297 10:77803567-77803589 ACATTCCTGGAGATCAAGAAGGG + Intronic
1074241906 10:111648165-111648187 ACATTCCCAGAGGCGGATCAGGG - Intergenic
1074281539 10:112056287-112056309 ACATTTCTAGAGAAGAAGAAAGG - Intergenic
1074366687 10:112863142-112863164 ACTTTCCCAGAGAGGAATCAAGG - Intergenic
1074768822 10:116720208-116720230 CCATTCCCAGAGACGAGGCTGGG - Intronic
1075274802 10:121083799-121083821 ACAGACCCATAGAAGAAGCAAGG - Intergenic
1077704690 11:4473298-4473320 CCATTTCCAGAGAAGAAACAGGG + Intergenic
1078461849 11:11520516-11520538 ACAGTCCCAGAGATGACCTAGGG + Intronic
1078718124 11:13858969-13858991 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1082332234 11:51234017-51234039 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082337145 11:51305091-51305113 ACATTCCTATAGATAGAGCATGG + Intergenic
1082350826 11:51503829-51503851 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082392583 11:52111791-52111813 ACATTCCTATAGATAGAGCATGG + Intergenic
1082394704 11:52142542-52142564 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082468040 11:53203392-53203414 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082528231 11:54072744-54072766 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082532183 11:54129724-54129746 ACATTCCTATAGATAGAGCAGGG + Intergenic
1082885615 11:58078925-58078947 ACCTTACAAGTGATGAAGCAAGG + Intronic
1083179881 11:60978392-60978414 AGATTCCCAGAGCGGAATCAAGG - Intronic
1084290365 11:68161635-68161657 ACATTCAGAGAAATGAAGAAAGG - Intronic
1087815403 11:102652970-102652992 AAATTCCCAGAGAGGAATTAAGG + Intergenic
1088547016 11:110969318-110969340 ACATTTCCACAGTGGAAGCATGG - Intergenic
1089071388 11:115702066-115702088 GGATTCCCAGAGACTAAGCAGGG - Intergenic
1089881326 11:121776410-121776432 ACATTGCCAGAGATTACACAGGG - Intergenic
1089883066 11:121793596-121793618 AAATGCACAAAGATGAAGCATGG - Intergenic
1090544449 11:127747449-127747471 ACATTCCCAGAGGTCTAGGAGGG - Intergenic
1091084890 11:132712101-132712123 CCATTCCCAGAGAGGAGGAAGGG + Intronic
1093817946 12:23572541-23572563 GCATTCCCAAAGATTAAGCATGG - Intronic
1096699321 12:53371681-53371703 CCATTCCCAGAAAAGGAGCATGG - Intergenic
1096844904 12:54401097-54401119 CCTATCTCAGAGATGAAGCAGGG + Intronic
1097653260 12:62330230-62330252 ATATTTCTATAGATGAAGCAAGG + Intronic
1099300796 12:80892136-80892158 ACATTCACAGAGATAAAGGAGGG - Intronic
1101349961 12:103920462-103920484 ACACTCCCAGAGGTTGAGCATGG + Intergenic
1101804168 12:108048912-108048934 AGACTCCCAGAGACCAAGCAAGG + Intergenic
1103101889 12:118183816-118183838 AGATTCCCAAAGCTGAGGCATGG + Intronic
1103296742 12:119893376-119893398 ACATTCCCAGCAATGCACCAGGG + Intergenic
1108016266 13:46079734-46079756 AAGTTCCCAGAGATAAAGCCAGG - Intronic
1108091692 13:46856056-46856078 ATATAACCAGGGATGAAGCAGGG - Intronic
1108951713 13:56102521-56102543 ACATTCCCTGATATCAACCAGGG - Intergenic
1111847170 13:93525512-93525534 AAATTCCCAGAAATAAGGCAAGG - Intronic
1112315140 13:98354403-98354425 ACATAACCAGATATGAAACATGG + Intronic
1112515411 13:100049035-100049057 ACATGACCAGAGCAGAAGCAAGG + Intergenic
1112610291 13:100948701-100948723 TCATTCCCACAGAAGAAGCAGGG - Intergenic
1113215133 13:108031104-108031126 AAAGTCCCAGAGATGAAGCATGG - Intergenic
1113684960 13:112276708-112276730 ACATTCCTTCAGATGGAGCAAGG + Intergenic
1115197801 14:30820476-30820498 AAATTACCAGAGAGAAAGCATGG + Intergenic
1115572340 14:34678460-34678482 AATTTCTCAGAGATGAAGAACGG + Intergenic
1115884617 14:37957713-37957735 ACATCCTCAGAGAAGCAGCAAGG + Intronic
1118167881 14:63356009-63356031 ACATTGCCAGATATGAATAAGGG - Intergenic
1121159142 14:91718877-91718899 ACATTCCCAGAGGTTAAAAATGG - Intronic
1125828425 15:42694433-42694455 AAGATCCCAGAGATGAACCAGGG - Intronic
1126345084 15:47685319-47685341 ACAATCCCAGAGAGGCAGGAGGG + Intronic
1127518945 15:59724117-59724139 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1135109856 16:19682176-19682198 ATAATCCCAAAGATGAAGCAGGG - Intronic
1135420206 16:22300717-22300739 ACAGTCCCAGAGATGGAGGATGG - Intronic
1136698601 16:32110596-32110618 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
1136769006 16:32817238-32817260 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
1136799102 16:33053890-33053912 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
1138667060 16:58579789-58579811 ACATTCACAGAGAGGAATGACGG + Intronic
1138965888 16:62083736-62083758 ACCTGCCCAGAGATGGAGGATGG + Intergenic
1139268368 16:65660279-65660301 ACAATCCCAGAATTGAAGCGGGG - Intergenic
1139430136 16:66906740-66906762 ACATTTCCAGAGAGGTAACACGG + Intergenic
1142201552 16:88763348-88763370 AGAATCCCAGAGAAGAAGCAGGG - Intronic
1203071421 16_KI270728v1_random:1079345-1079367 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
1143006428 17:3838218-3838240 ACCTGACCAGAGATAAAGCATGG + Intronic
1143307052 17:5955742-5955764 ACATACCAAGAGAACAAGCAGGG - Intronic
1143439272 17:6955869-6955891 ACATGGCGAGAGAGGAAGCAAGG - Intronic
1143480949 17:7227059-7227081 ACACTCCCAGAGTTGGGGCAGGG + Intronic
1144875831 17:18396734-18396756 ACTTTCCCAGAGCAGAAGCCAGG + Intergenic
1145156397 17:20547687-20547709 ACTTTCCCAGAGCAGAAGCCAGG - Intergenic
1145692753 17:26760851-26760873 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
1146535618 17:33647999-33648021 CCAAGCCCAGAGATGAAGCCAGG - Intronic
1146696863 17:34915772-34915794 AAATTCCCAGATATCAACCAAGG + Intergenic
1146770860 17:35567792-35567814 TCATTCCCAGTTATGAAACAGGG + Intergenic
1148976488 17:51534574-51534596 ACATTCTGAGAAATGAAACAGGG - Intergenic
1151057134 17:71046102-71046124 ACATTCCAAGAGATGAATTAAGG + Intergenic
1151917335 17:77127967-77127989 ACCTTCCCAGAGCTGCAGGAGGG + Intronic
1153130738 18:1853055-1853077 AAATGCCCAGAGATGAAGGATGG + Intergenic
1158727515 18:59986997-59987019 ACATTCCCACATATACAGCATGG - Intergenic
1160169975 18:76544841-76544863 ACCTTCGGAGAGAAGAAGCAAGG + Intergenic
1160314636 18:77830511-77830533 ACCTTCCCAGAGAAGAAGGTAGG + Intergenic
1162068163 19:8138095-8138117 ACATTCCAAGACTTGAAGGATGG - Intronic
1163166170 19:15499654-15499676 TAATTCCCAGGGAGGAAGCAGGG + Intergenic
1163734086 19:18968072-18968094 AGGTAACCAGAGATGAAGCAGGG - Intergenic
1165358111 19:35316544-35316566 AAATTCCAGGAGCTGAAGCAAGG + Intergenic
1166342864 19:42149253-42149275 ACACTCGCAGAGATGGAGCTGGG - Intronic
1167154563 19:47730204-47730226 GCTTTTCCAGAGAGGAAGCAGGG - Intronic
1202682754 1_KI270712v1_random:23768-23790 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
926008905 2:9393306-9393328 CCATTCACAGGGAGGAAGCAGGG - Intronic
926316506 2:11714317-11714339 ACAATCCCAGAGATGCTGAAGGG - Intronic
933814502 2:86054879-86054901 ACATTCCCAGAGATGAAGCAGGG + Intronic
934249047 2:90331407-90331429 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
934260530 2:91472067-91472089 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
934542578 2:95188288-95188310 ACATTCCCAGATATTCATCAGGG + Intergenic
935047496 2:99495179-99495201 TCATTCCAAGAGAGGAAGCAAGG + Intergenic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
942607755 2:177710139-177710161 AAAGTCCCAGAGGAGAAGCAAGG + Intronic
943419523 2:187653426-187653448 ACATTCCCACCAATGCAGCAAGG - Intergenic
944112179 2:196144588-196144610 ACATTTCCAGAAATGAAAAATGG + Intronic
944178748 2:196863490-196863512 AAATTCCCAGATATGAATGAGGG - Intronic
944925243 2:204457429-204457451 ACATTCTCAGAGATGAGGCCAGG - Intergenic
946564098 2:220944098-220944120 AGAATCCCAGAGATAAGGCATGG + Intergenic
948139058 2:235659653-235659675 CCATCCCCAGAGTTGATGCAGGG - Intronic
1171451505 20:25239142-25239164 ACATGGCCAGAGCAGAAGCAAGG + Intergenic
1172129243 20:32644922-32644944 ACATGTCCAGGGATGCAGCAGGG + Intergenic
1172435145 20:34923678-34923700 ACATGGCAAGAGAGGAAGCAAGG + Intronic
1173262030 20:41445073-41445095 ACACTGCCAGAGGTGAAGAAAGG + Intronic
1174867007 20:54147196-54147218 AGATTCCCAGAGATTTGGCAAGG + Intergenic
1177848733 21:26321665-26321687 CTATTGCCAGAGAGGAAGCAAGG + Intergenic
1179181831 21:39051815-39051837 TGATTCCCAGGGATGAATCAAGG - Intergenic
1179946390 21:44680841-44680863 ATATTACCAGAGGTGAAGAACGG + Intronic
1179957789 21:44750768-44750790 ACATTCACAGGGAGGAAGCGGGG - Intergenic
1182002313 22:26929948-26929970 ATATTCCCAGATATGAAATATGG + Intergenic
1183706089 22:39475646-39475668 ACAGTCACAGAGCTGGAGCAAGG - Intronic
1184847696 22:47099260-47099282 ACATTACCAGATAAGAAGCCTGG + Intronic
1185115864 22:48937481-48937503 AAATTCCCAGGAGTGAAGCAGGG - Intergenic
949163549 3:910459-910481 TCATTCTCATAGAAGAAGCAAGG - Intergenic
949255940 3:2046182-2046204 ACATTCTTAGGGATGAGGCAAGG + Intergenic
949343005 3:3049727-3049749 ACATTCCCAGAGAGGTGCCAAGG - Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
951943633 3:28110059-28110081 TCACTTCCAGAGTTGAAGCATGG - Intergenic
952759264 3:36899406-36899428 ACATTCCGAGAGATCAAGGCAGG + Intronic
953693404 3:45139013-45139035 ACATAGCAAGAGAAGAAGCAAGG + Intronic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956292874 3:67679731-67679753 ACATTCCCAGGGTTGAACCATGG - Intergenic
956885367 3:73553789-73553811 ACTTTGCCAGAGCTGAAGTAGGG - Intronic
957444411 3:80296425-80296447 ACATGGCAAGAGAGGAAGCAAGG + Intergenic
957899773 3:86474112-86474134 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958689974 3:97451892-97451914 ACATTCATAGAGATGAGGTATGG + Intronic
959750299 3:109826936-109826958 AAATTCCCAGAGATGAGGAGAGG + Intergenic
960266278 3:115624513-115624535 ACAATCCCAGGAAAGAAGCAAGG - Intronic
961159826 3:124714549-124714571 AACTTCCCAGAGATGTTGCAGGG + Intronic
961844842 3:129753073-129753095 ACATTCCCAGAGTTGGAGGAAGG - Intronic
962255593 3:133868014-133868036 ACTTCCCCAGAGACAAAGCATGG - Intronic
963112911 3:141701532-141701554 TACTTCCCAGAGAGGAAGCAAGG + Intergenic
963223666 3:142838442-142838464 ACATGGCCAGAGTAGAAGCAAGG - Intronic
963261117 3:143191892-143191914 ACATGCCCAGAGAGAAACCAGGG - Intergenic
964009178 3:151869423-151869445 ACATTCCCAGAGACGTTGCTAGG + Intergenic
967281981 3:187831718-187831740 ACATTGGTAGAGATGAAGAAGGG + Intergenic
968222468 3:196948785-196948807 ACAGTCCCAGGGATTACGCAGGG - Intronic
970225511 4:13852577-13852599 ACATTCCCTGACATGAAGGGAGG + Intergenic
970869336 4:20797466-20797488 ACATTCCCAGAGATTATGCAGGG - Intronic
972341672 4:38157484-38157506 ACATAGCAAGAGAGGAAGCAAGG + Intergenic
973323485 4:48833416-48833438 ACATTCCAACAGAGGAAGAAAGG + Exonic
976589479 4:86834870-86834892 ACATGGCCAGAGAGGGAGCAAGG + Intronic
977249020 4:94667931-94667953 GCCTTCTCAGACATGAAGCAAGG + Exonic
978088374 4:104683748-104683770 ACATTCTCAAAGAAGAGGCATGG + Intergenic
979517169 4:121623052-121623074 ACATGGCAAGAGATGAAGCTGGG - Intergenic
981452515 4:144914896-144914918 ATACTCCCAGAGAACAAGCATGG + Intergenic
982415741 4:155129496-155129518 AAATTCCCAGAGAAGCAGGAAGG + Intergenic
983737595 4:171082394-171082416 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
984492773 4:180456788-180456810 TAATTCCCAGAGACAAAGCAGGG + Intergenic
985420627 4:189781755-189781777 AGATTCCCAGAGGTTCAGCAGGG + Intergenic
986631610 5:9779209-9779231 ACATGACAAGAGATGGAGCAAGG - Intergenic
989384061 5:40837158-40837180 ACATTCCCAGAATTGAAGACAGG + Intergenic
990550438 5:56871430-56871452 ACTTTCCCAGAAATGAATCTAGG - Intronic
990913941 5:60882164-60882186 ACATTCTCAGACATGCAGTAGGG - Intronic
991188431 5:63838954-63838976 ACATAGCAAGAGATGCAGCAAGG + Intergenic
992124551 5:73626713-73626735 TCAGTCCCGGAGCTGAAGCATGG - Intronic
992559954 5:77941509-77941531 ACATCTCCAGTGATGAATCATGG + Intergenic
992643980 5:78795253-78795275 AGACTCCCAAAGATGAACCAAGG - Intronic
994190735 5:96866860-96866882 ACATCCCCAGAGAGGCAGTATGG - Intronic
998593588 5:143503579-143503601 ACATTCTCAGAGAAGAACCTTGG + Intergenic
998959818 5:147473127-147473149 ACATGCCAAAACATGAAGCAGGG + Intronic
999998797 5:157118103-157118125 ACATTCTCATAGATGAATCCTGG + Intronic
1000286087 5:159827269-159827291 ACATGCACAGAGGTAAAGCAGGG - Intergenic
1000677034 5:164133377-164133399 ACATGGCCAGAGAAGGAGCAAGG - Intergenic
1000767531 5:165310322-165310344 ACATGGCCAGAGCAGAAGCAAGG - Intergenic
1001001829 5:168014832-168014854 ACAGCCCCAGAGATGAAGAAGGG + Intronic
1001132229 5:169073724-169073746 ACATGGCAAGAGAAGAAGCAAGG - Intronic
1002412219 5:179090096-179090118 AGATTCCCAGAAATCAAGGAAGG - Intergenic
1002516901 5:179765683-179765705 ACAGTCCCAGTGATCATGCAAGG - Exonic
1003747771 6:9022453-9022475 ACATTCCCAGAGACACAGAAGGG - Intergenic
1004246811 6:13985855-13985877 ACATGGCCAGAGAGGAAGCAAGG - Intergenic
1004635118 6:17459961-17459983 AATTTCCCAGAAATGAAGAAAGG + Intronic
1005986453 6:30878783-30878805 AGATTTGCAGAGATGAGGCAAGG - Intronic
1006737193 6:36282652-36282674 ACATACACACAGATCAAGCAAGG - Intronic
1009034064 6:58095068-58095090 TCATACCCACAGATGAAGGATGG - Intergenic
1009521274 6:64685162-64685184 ACATTACCAGAGATAAAGAAGGG + Intronic
1010776807 6:79896211-79896233 ACAGTGGCAGAGATGGAGCAGGG - Intergenic
1011545937 6:88481369-88481391 ACAATGCCTGAGATGAACCAAGG - Intergenic
1013088212 6:106874943-106874965 ACATGGCCAGAGAAGAAGTAAGG + Intergenic
1013455049 6:110322936-110322958 ACAGTATCAGAGAGGAAGCAAGG + Intronic
1013617455 6:111858228-111858250 AGAGTCCCAGAGAGGAGGCAGGG + Intronic
1014421056 6:121245803-121245825 ACATTCCCACAGATGAAAAGAGG + Intronic
1014512732 6:122344314-122344336 TCAATCCCAGAGATGATGCAGGG + Intergenic
1015329063 6:131955976-131955998 ACATTTCCAGGGATGAATGATGG - Intergenic
1016029519 6:139323170-139323192 ACATTGCACGAGATGAAGAAGGG + Intergenic
1016196200 6:141344929-141344951 AAATTTCCAGGGATGAAGAAGGG - Intergenic
1017240972 6:152168406-152168428 ACATTCCAGGAGATCAAGCCTGG - Intronic
1017375274 6:153761171-153761193 ACATTCCCACAGATGAAAAGAGG + Intergenic
1018595052 6:165470185-165470207 ACATGACCAGAGAGGAAGCAAGG + Intronic
1018766380 6:166936565-166936587 ACATGGCCAGAGAGGAAGCCAGG + Intronic
1020198903 7:6063913-6063935 ACATGGCCAGAGAAGAAGAAAGG - Intergenic
1021592668 7:22280764-22280786 ACATTCCCAGACATAAAACAAGG - Intronic
1021604984 7:22401038-22401060 ACATTCAGACAGATGAAGGATGG - Intergenic
1021794017 7:24235168-24235190 ACATTCCCAGAGTTAAAGGCAGG + Intergenic
1021796440 7:24259285-24259307 GAATGCCAAGAGATGAAGCAGGG - Intergenic
1022662157 7:32377223-32377245 TCTTTCCCAGAGATGCAGCTTGG - Intergenic
1022735437 7:33071347-33071369 ACATGGCCAGAGAAGGAGCAGGG - Intergenic
1023714028 7:43024902-43024924 GGCTTCCCAGAGTTGAAGCAGGG + Intergenic
1025307382 7:57874380-57874402 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
1025481298 7:60986781-60986803 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
1025838326 7:65118063-65118085 ACGTTCCCAGTGAGGAAGCCTGG + Intergenic
1025878950 7:65515019-65515041 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
1025884747 7:65577914-65577936 ACGTTCCCAGTGAGGAAGCCTGG - Intergenic
1028603440 7:92628613-92628635 AATTACCCAGAGATGAACCAAGG - Intronic
1028606157 7:92658105-92658127 AGATTCTCAAAGATGAAGAAAGG - Intronic
1028910169 7:96199083-96199105 GGATTCAAAGAGATGAAGCAGGG - Intronic
1030079795 7:105767410-105767432 TCATTCCCAGAGAGGACGCATGG - Intronic
1031833608 7:126655975-126655997 ACATTACCAGCTATGAAGAAAGG - Intronic
1031952154 7:127903562-127903584 ACATCCCCTGGGATGAAGCAAGG + Intronic
1032656519 7:133936483-133936505 ACCTTACCTGAGAAGAAGCAAGG - Intronic
1035564353 8:631276-631298 ACACTCACAGAGGTGGAGCAGGG - Intronic
1037415383 8:18644053-18644075 ACAGTCCCAGAGGTGTAGGAGGG - Intronic
1037759408 8:21732151-21732173 ACATTCCTAGAGACACAGCAGGG + Intronic
1038278521 8:26141866-26141888 ACATGGCCAGAGAGGGAGCAAGG - Intergenic
1039007089 8:33051284-33051306 ACATGCCCAGAAGTGAAGCCAGG + Intergenic
1039226115 8:35390116-35390138 ACATGGCCAGAGGAGAAGCAAGG + Intronic
1039501439 8:38020768-38020790 GGATTCCCAGTGGTGAAGCAGGG + Intergenic
1040362715 8:46683103-46683125 ACATTCCTAGAGATGAAACATGG - Intergenic
1043300844 8:78729578-78729600 GCATCCCCAGAGCTGAAGAAAGG - Intronic
1043646575 8:82528249-82528271 ACATTACCAGAGATGAATAGGGG + Intergenic
1044641881 8:94391401-94391423 ACACTCCTAGAGCTGAAGTAGGG - Intronic
1044998804 8:97862255-97862277 TCATTCCTATAGATGATGCAAGG + Intergenic
1045430762 8:102112846-102112868 ACATGGCCAGAGAGGAAGCAAGG - Intronic
1045660765 8:104435400-104435422 ACTTTTGCAGAGATGAGGCAAGG - Intronic
1045732960 8:105263317-105263339 AAATTCCCAGAGAGGAGGGATGG + Intronic
1046676257 8:117111909-117111931 ACATTTCCAGATATTAAACAAGG - Intronic
1047022291 8:120787138-120787160 AAATACCCAGAGCTGAAGCTAGG + Intronic
1047348147 8:124048448-124048470 ACATTCCCCCAGAGGCAGCATGG - Intronic
1047844369 8:128789958-128789980 AATTCCCCAGAGATGAAGAAGGG + Intergenic
1048894878 8:138982856-138982878 TCATTCCCAGGGAGAAAGCATGG + Intergenic
1051616430 9:19011359-19011381 CCAGTGCAAGAGATGAAGCAGGG - Intronic
1052219173 9:25998567-25998589 AGACTCCCAGAGATGCAGCAAGG - Intergenic
1058185128 9:101845770-101845792 AATTTCCCAGTGGTGAAGCAGGG - Intergenic
1058938837 9:109794513-109794535 ACATTCCCTGAGTCCAAGCAGGG + Intronic
1059976228 9:119720238-119720260 ACTTTTCCAGAGATGAAGGCAGG - Intergenic
1060403905 9:123363476-123363498 ACACTGCCAGAGATGAATGAGGG - Intronic
1061757316 9:132824223-132824245 AGATGCCCACAGATGAGGCACGG + Intronic
1187020486 X:15376206-15376228 ACATTACAAGACATGATGCAAGG + Intronic
1187722698 X:22167919-22167941 ACATTCCAGGAGAAGAAACAGGG - Intronic
1188150036 X:26661979-26662001 ATATTACCAGAGATAAAGAAGGG + Intergenic
1192764051 X:74124753-74124775 CCTTTCCCAAAGATGAAGGATGG + Intergenic
1193205332 X:78740958-78740980 ACATGGCCAGAGAGGAACCATGG + Intergenic
1196780854 X:119382929-119382951 ACATGGCAAGAGAGGAAGCAAGG - Intergenic
1199328237 X:146527372-146527394 ACATTTGAAGAGGTGAAGCAGGG + Intergenic
1200344900 X:155438393-155438415 ACATGACAAGAGAGGAAGCATGG - Intergenic