ID: 933820186

View in Genome Browser
Species Human (GRCh38)
Location 2:86104190-86104212
Sequence AGGTGTAAGGGGAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1825
Summary {0: 1, 1: 0, 2: 3, 3: 99, 4: 1722}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933820186 Original CRISPR AGGTGTAAGGGGAGGGTGGA AGG Intronic
900072663 1:785574-785596 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
900088227 1:908678-908700 AGGTGGGAGGGGAGAGGGGAGGG + Intergenic
900359162 1:2279568-2279590 AGCTGCAGGGGGAGGGGGGAGGG + Intronic
900491654 1:2952320-2952342 AGATGCTTGGGGAGGGTGGAAGG - Intergenic
900551781 1:3260019-3260041 AGTTGTATGGGGAGGTGGGAAGG - Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901921478 1:12540567-12540589 TGGAGTTGGGGGAGGGTGGAGGG - Intergenic
901960857 1:12825543-12825565 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901967452 1:12880145-12880167 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901975251 1:12939276-12939298 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901982853 1:13050409-13050431 AGGGGTGAGTGGAGGGTGGTGGG + Intronic
901986168 1:13076929-13076951 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
901995642 1:13149838-13149860 AGGGGTGAGTGGAGGGTGGTGGG + Intergenic
901999236 1:13178509-13178531 AGGGGTGAGTGGAGGGTGGTGGG - Intergenic
902009924 1:13262488-13262510 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902017721 1:13321641-13321663 AGGGGTGAGTGGAGGGTGGTGGG - Intronic
902030782 1:13420635-13420657 AGGGGTGAGTGGAGGGTGGTAGG - Intronic
902266161 1:15266751-15266773 AGGGGTCAGGGGAAGGTGGGGGG - Intronic
902960079 1:19957242-19957264 AGGAGTTAGGGGTGGATGGAGGG - Intergenic
903757554 1:25673042-25673064 AGGTGAACGGGGAGGGGGAAAGG + Intronic
903830311 1:26170487-26170509 AGGAGTAAGGAGAGGATTGATGG + Intronic
904016883 1:27428528-27428550 AGGTGGAGGGGGAGGGAGGAGGG + Intronic
904044872 1:27603154-27603176 AGGTGGACGGGGAGGGGGGGCGG - Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904396180 1:30224057-30224079 GGGTGTAGGGGGAGGGAGGGGGG + Intergenic
904770092 1:32876256-32876278 AGGAGGACGGGGAGGGGGGAAGG + Intergenic
905137911 1:35814446-35814468 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
905406883 1:37739726-37739748 AGTTGCCAGGGGAGGGTGGTGGG + Intronic
905520906 1:38598957-38598979 AGGCCAAAGGGGAGAGTGGAGGG - Intergenic
905740908 1:40370706-40370728 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
906238394 1:44226074-44226096 AGGTCTTAGGGGATGGGGGAGGG + Intronic
906552445 1:46676635-46676657 AGGTGTGGGGTGAGAGTGGATGG + Exonic
906728900 1:48064455-48064477 AGGTGTAAAGTGAGGGTGCTGGG + Intergenic
907090336 1:51718224-51718246 AAGTGTAGGGGGAGTGGGGATGG + Intronic
907462745 1:54614970-54614992 TGGAGTCAGGGGAGGGCGGAAGG + Intronic
907646369 1:56247959-56247981 TGGGGTGAGGGGAGGGGGGAAGG - Intergenic
907794505 1:57701543-57701565 AGGGGTAGGGGGAGGAGGGAGGG + Intronic
908074180 1:60495987-60496009 GGGGGTGGGGGGAGGGTGGAGGG + Intergenic
908170096 1:61495838-61495860 AGGTGTAAGGGGACAGTTGCTGG - Intergenic
908306758 1:62826733-62826755 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
908322478 1:62991730-62991752 AGGTGGGAGGTGGGGGTGGAGGG - Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908907848 1:69037206-69037228 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
908908734 1:69047502-69047524 AGGTGAATGGGGAGGCTTGAAGG - Intergenic
908968465 1:69796109-69796131 AGGGGTGGGGGGAGGGGGGAGGG - Intronic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
909249190 1:73329697-73329719 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
909302564 1:74031612-74031634 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
909424166 1:75502695-75502717 TGGAGTAGGGGGAGGGGGGAGGG - Intronic
909433984 1:75619107-75619129 AGGAAGAAGGGGAGGGAGGAAGG + Intergenic
909449637 1:75784277-75784299 TGGTGTTGGGGGAGGGGGGAAGG + Intronic
909552630 1:76915693-76915715 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
909689328 1:78389203-78389225 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
909811621 1:79938528-79938550 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
910264134 1:85320821-85320843 AGGGGTGAGGGGAGGGTTGTTGG + Exonic
910297484 1:85664616-85664638 AGGTGAAGGTGGAGGGTGGGAGG + Intronic
910328530 1:86040456-86040478 AGGGGTGGGGGGAGGGGGGAGGG - Intronic
910534719 1:88283967-88283989 AGGGGTAGGGGGTGGGTGGGAGG + Intergenic
910692868 1:89982612-89982634 AAGTGAAAGGGGAGGGTTAATGG + Intergenic
910744358 1:90557157-90557179 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
910869841 1:91823118-91823140 AGGTGTTAAGGGAGCCTGGAGGG + Intronic
910949386 1:92629807-92629829 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
911555351 1:99338177-99338199 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
911812915 1:102307302-102307324 GGGGGTCGGGGGAGGGTGGAGGG - Intergenic
911966352 1:104376523-104376545 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
911995212 1:104758069-104758091 AGGGGGATGGGGAGGGGGGATGG + Intergenic
913022988 1:114805361-114805383 AGGGGGAGGGGGAGGGGGGAGGG + Intergenic
913169110 1:116216232-116216254 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
913196266 1:116458786-116458808 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
913439167 1:118879012-118879034 AGGTGCTGGGGGTGGGTGGAGGG + Intergenic
913710982 1:121483113-121483135 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
913719776 1:121580258-121580280 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
914244592 1:145876309-145876331 AGGTGTGAGGGGAGGGGAGCCGG - Intronic
914746378 1:150504603-150504625 AGGAAAAAGGGGGGGGTGGATGG - Intronic
914992493 1:152510977-152510999 TTCTGGAAGGGGAGGGTGGAAGG + Exonic
915106390 1:153537264-153537286 GGGTGGAGGGTGAGGGTGGAGGG + Exonic
915226668 1:154416928-154416950 AGGGATAAGGGGAGGTTTGAGGG - Intronic
915490281 1:156246797-156246819 AGGTGAAAGGGGCCTGTGGATGG - Intronic
915545373 1:156594039-156594061 CGGTGTCAGGGTAGGGTGGCAGG - Exonic
915757531 1:158277292-158277314 GGGGGTAGGGGGAGGGGGGAGGG - Intergenic
915845920 1:159265040-159265062 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
915851745 1:159331748-159331770 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
915856405 1:159391427-159391449 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915858269 1:159413689-159413711 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915875681 1:159609742-159609764 CGGAGTGGGGGGAGGGTGGAGGG + Intergenic
915882319 1:159685146-159685168 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
915887327 1:159736412-159736434 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
915907230 1:159887774-159887796 GGGAATAAGGGGAGGGCGGAGGG + Intronic
915916211 1:159942372-159942394 AGGTGTACAGAGAGGGTGGCTGG - Intronic
916118381 1:161507035-161507057 AGAGGTGAGGGGAGGGTGAAGGG + Intronic
916154881 1:161834625-161834647 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
916291266 1:163169003-163169025 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
916521483 1:165567341-165567363 AGGGATATGGGGAGGATGGAGGG + Intergenic
916602873 1:166311022-166311044 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
917072183 1:171163853-171163875 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
917234625 1:172877775-172877797 AGGGATGGGGGGAGGGTGGAGGG - Intergenic
917244909 1:172989642-172989664 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
917392358 1:174552314-174552336 GGGTGGAGGCGGAGGGTGGAAGG - Intronic
917481667 1:175417289-175417311 AGATGGAGGGGGATGGTGGAGGG + Intronic
917754803 1:178088431-178088453 AGGTGGCAGGGGAAGGAGGACGG + Intergenic
917780247 1:178387515-178387537 TGGGGTAGGGGGAGGGGGGAAGG - Intronic
917790563 1:178496385-178496407 AGGTGGGAGGGGAGGGCGCAGGG - Intergenic
917997846 1:180460122-180460144 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918412259 1:184272055-184272077 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
918695400 1:187540768-187540790 TGGGGTGAGGGGAGGGGGGATGG - Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918808972 1:189091505-189091527 TGGTGTTAGGGGATGGGGGAGGG - Intergenic
918935805 1:190919266-190919288 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
918952781 1:191160747-191160769 AGGGGGAGGGGGAGGGTGGGGGG + Intergenic
919061616 1:192641360-192641382 AGGGGAAAAGGGAGGGAGGAAGG + Intronic
919183558 1:194116711-194116733 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
919193764 1:194257114-194257136 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
919210936 1:194484879-194484901 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919259971 1:195179443-195179465 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919321604 1:196047633-196047655 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
919598202 1:199590642-199590664 GGGAGTAAGGGGAGAGTGGTAGG + Intergenic
919975557 1:202609018-202609040 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
920001617 1:202803933-202803955 AGGGGTCGGGGGAGGGGGGAGGG + Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920296803 1:204962750-204962772 AGGTGAGAGGGTACGGTGGATGG - Intronic
920377846 1:205518912-205518934 AGGTGGGAGGGGAGGTTGGCTGG + Intronic
920769542 1:208868357-208868379 AAGTGTAAGGGAAGGAGGGAGGG + Intergenic
920956275 1:210622765-210622787 AGGTTTAGGGGGTGGTTGGATGG + Intronic
920999969 1:211034414-211034436 AGGAGTAAGGGCAGGAAGGAAGG + Intronic
921295625 1:213699183-213699205 AGGTGTGAGGGAAGTGGGGATGG - Intergenic
922070302 1:222185939-222185961 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
922479550 1:225929719-225929741 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
923041470 1:230322946-230322968 AGGTGTCAGGGGAGGCCGGAGGG - Intronic
923401841 1:233623281-233623303 AAGGGTACGGGGAGGGGGGATGG + Intronic
923620270 1:235573324-235573346 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
923663943 1:235982251-235982273 AGGTATAAAGGAAGGCTGGATGG + Intronic
923687006 1:236160477-236160499 AGGAGGCAGGGAAGGGTGGAGGG - Intronic
923947512 1:238904607-238904629 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
924064908 1:240210998-240211020 AGGAAGAAGGGGAGGGAGGAAGG - Intronic
924154882 1:241165630-241165652 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
924575901 1:245280745-245280767 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
924639712 1:245822397-245822419 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
924649610 1:245913362-245913384 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1063203892 10:3812183-3812205 AGCTGTCAGTGGATGGTGGAGGG - Intergenic
1063311837 10:4960063-4960085 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1063694309 10:8318424-8318446 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1063801620 10:9585255-9585277 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1063876960 10:10489897-10489919 AGGTTTGGGGGGAGGGTGGGTGG + Intergenic
1064125784 10:12658797-12658819 AGGTGGAAGGGGAGGCCAGAAGG - Intronic
1064225262 10:13478067-13478089 AGGGGAGAGGGGAGGGAGGATGG + Intronic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064612852 10:17121546-17121568 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1064866311 10:19884494-19884516 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1064919001 10:20495769-20495791 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1064949288 10:20829436-20829458 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1064956362 10:20915396-20915418 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065209275 10:23387525-23387547 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1065497275 10:26342066-26342088 AGGAGTAGAGGGAGGGAGGAAGG + Intergenic
1065503632 10:26407488-26407510 AGATGTAAAGGGAGCATGGAAGG - Intergenic
1065765624 10:29026893-29026915 AGGTAGAAAGGGAGGGAGGAAGG + Intergenic
1066228738 10:33411288-33411310 ACCTGTCAGGGGAGGGTGGGGGG - Intergenic
1066507600 10:36061794-36061816 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1066692408 10:38043347-38043369 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1066819958 10:39472681-39472703 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1066934291 10:41805979-41806001 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1066974572 10:42355035-42355057 CGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1067033753 10:42898333-42898355 AGCTGTCCCGGGAGGGTGGAAGG - Intergenic
1067194706 10:44106873-44106895 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1067233622 10:44428335-44428357 AGGAGGAAGGGAAGGGTGGGAGG + Intergenic
1067302666 10:45026634-45026656 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1067494429 10:46749146-46749168 AGATGTCAGGGGAGGATTGAAGG + Intergenic
1067600229 10:47591251-47591273 AGATGTCAGGGGAGGATTGAAGG - Intergenic
1067733402 10:48830290-48830312 ACATGTAAGGGAAGGTTGGAAGG + Intronic
1068015207 10:51507151-51507173 TGGAGTAGGGGGAGGGGGGAGGG + Intronic
1068254662 10:54494086-54494108 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1068776370 10:60872555-60872577 AGGTGGCAGGGGAGGGCGGGAGG - Intronic
1068849917 10:61725609-61725631 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1068866927 10:61903894-61903916 AGCTGGCCGGGGAGGGTGGAGGG - Intronic
1068891352 10:62151289-62151311 AGGAGGAAGGGGATGGGGGAAGG - Intergenic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069282359 10:66670539-66670561 AGGTAGAAGGGGAGGTTAGAAGG - Intronic
1069310276 10:67026108-67026130 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1069740230 10:70682677-70682699 AGGTCTGAGGGGATGGTGGCAGG + Intronic
1070442850 10:76463639-76463661 CGGTGGCAGGGGAGGGGGGAAGG + Intronic
1070561494 10:77570587-77570609 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1071419139 10:85472489-85472511 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1071419617 10:85478925-85478947 AGGTCTTAGGGTAGGGTAGAAGG + Intergenic
1071651769 10:87399130-87399152 AGATGTCAGGGGAGGATTGAAGG - Intergenic
1071696602 10:87881361-87881383 TGGGGTATGGGGAGGGGGGAGGG - Intronic
1071825531 10:89322069-89322091 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
1072015774 10:91344759-91344781 AGGAGTCAGCGAAGGGTGGAGGG - Intergenic
1072211839 10:93253259-93253281 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1072301700 10:94068034-94068056 AGGTTACAGGGGAGGGTGCAAGG - Intronic
1073077324 10:100832317-100832339 AGGTGCCAGGGGAGGGGGGGGGG + Intergenic
1073275694 10:102308725-102308747 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1073597780 10:104817575-104817597 AGGAGGAGGGGGAGGGGGGAGGG - Intronic
1073923712 10:108488778-108488800 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1074085491 10:110206742-110206764 AGGTGTCAGGGGATGATTGAAGG - Intergenic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1074276845 10:112011585-112011607 CAGTGTCAGGGGAGGGTGAATGG - Intergenic
1074296842 10:112197628-112197650 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1074382128 10:112989906-112989928 TGGGGTGAGGGGAGGGTGGTGGG + Intronic
1074419928 10:113299745-113299767 AGGAGGAAGGTGAGGGAGGAAGG + Intergenic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1074827981 10:117228443-117228465 AGGAGGAAGGGAAGGATGGAGGG - Intergenic
1074960995 10:118445819-118445841 GGATGATAGGGGAGGGTGGATGG - Intergenic
1075023207 10:118966225-118966247 AGGTGCCAGGGGAGGGAGGCTGG + Intergenic
1075959928 10:126559580-126559602 AGGTGAAAGGAGAGGAGGGAGGG - Intronic
1075994307 10:126864571-126864593 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1076257800 10:129042309-129042331 AGGAGAGAGGGAAGGGTGGATGG - Intergenic
1076460840 10:130645504-130645526 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1076522140 10:131087917-131087939 AGGAGCGAGGGGAGGGTGGCAGG + Intergenic
1076566124 10:131400666-131400688 AGTGCAAAGGGGAGGGTGGAGGG + Intergenic
1076605553 10:131687081-131687103 AGGGGCCTGGGGAGGGTGGACGG - Intergenic
1077956555 11:7026811-7026833 GGGGGTAGGGGGAGGGGGGAGGG + Intronic
1078384114 11:10872763-10872785 AGGGGTAAGGGGAAGGGGAAGGG - Intergenic
1078467621 11:11561865-11561887 AGGTGAAATGGGAGGGTGTGTGG - Intronic
1078484231 11:11706850-11706872 AGGTGTCGTGGGAGGCTGGAAGG + Intergenic
1078803171 11:14667688-14667710 TGGGGTTGGGGGAGGGTGGAGGG + Intronic
1078803331 11:14669602-14669624 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1078876105 11:15399447-15399469 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1079101602 11:17545275-17545297 AGGTGTTAGGGAAGGTGGGAGGG - Intergenic
1079403015 11:20121409-20121431 AGGAGGAAGGGGAGGGAGGATGG - Intronic
1079633731 11:22710012-22710034 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1079749963 11:24184868-24184890 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1079801507 11:24875243-24875265 TGGGGTGAGGGGAGGGGGGAAGG - Intronic
1079813572 11:25026142-25026164 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1079958078 11:26888489-26888511 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1080009851 11:27447035-27447057 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1080068325 11:28046546-28046568 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1080079938 11:28205247-28205269 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1080082094 11:28233945-28233967 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1080199322 11:29650019-29650041 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1080238878 11:30103530-30103552 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1080587836 11:33697479-33697501 AGGAGTGAGGGGAGAGTGGTAGG - Intergenic
1080617742 11:33959790-33959812 AGGGTCACGGGGAGGGTGGAGGG - Intergenic
1080906541 11:36551748-36551770 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1080912231 11:36614059-36614081 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
1081012634 11:37834247-37834269 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1081149561 11:39610070-39610092 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1081162064 11:39761025-39761047 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081364402 11:42216688-42216710 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1081655645 11:44855751-44855773 AGATGTCAGGGGAAGGTGGGTGG - Intronic
1082151122 11:48739861-48739883 TGGTGTGGGGGTAGGGTGGAGGG + Intergenic
1082153386 11:48771804-48771826 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1082196804 11:49316264-49316286 AGGGGTAAGGGGAAGGGGAAGGG + Intergenic
1082286586 11:50324248-50324270 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082555099 11:54554643-54554665 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1082579017 11:54843846-54843868 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1083128481 11:60597997-60598019 TGGGGTGAGGGGAGGGGGGAAGG + Intergenic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1083887276 11:65579048-65579070 AGGGGGAAGGGGAGGGAGAAAGG - Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084354131 11:68625796-68625818 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1084453744 11:69255241-69255263 AGGGATGAAGGGAGGGTGGAGGG + Intergenic
1084500975 11:69534988-69535010 AGATGTAAAGGGAGAGTGGTGGG + Intergenic
1084600319 11:70141640-70141662 AGGTGTGAGCGGAGAGGGGAGGG + Intronic
1084740976 11:71139352-71139374 AGGGGTAGGGGGAGGGGGGAGGG + Intronic
1084797352 11:71517038-71517060 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1084939292 11:72603779-72603801 AGTTGTTAGGGGAAGGTGAAAGG + Intronic
1084997303 11:72993758-72993780 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1085547276 11:77331635-77331657 TGGGGTCAGGGGAGGGTGGAGGG + Intronic
1085604998 11:77889396-77889418 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1086015542 11:82161728-82161750 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1086067607 11:82762987-82763009 TGGGGTGCGGGGAGGGTGGAGGG + Intergenic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086477834 11:87198542-87198564 AGGGGAGAGGGGAGGGAGGAGGG - Intronic
1087344305 11:96951272-96951294 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1087460362 11:98437663-98437685 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1087762138 11:102111814-102111836 AGGGGAAACGGGAGGGGGGAAGG - Intronic
1087901735 11:103649102-103649124 AGGTGCTTGGGGAGGGAGGAAGG + Intergenic
1088690688 11:112324414-112324436 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1088713604 11:112529431-112529453 AGGTGAAAGGGAAGGGAGGAAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088970080 11:114766269-114766291 AGGTGGAAGGGCAGCTTGGAGGG - Intergenic
1088983421 11:114884573-114884595 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1089090762 11:115872954-115872976 AGGTGTAAGGGGTGGTAGGAGGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089380048 11:118023495-118023517 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1089608598 11:119656749-119656771 AGGCGGAAGGGGAGGGTGGCAGG - Intronic
1089697981 11:120227514-120227536 AGGTGTCAGTGGAGGGGGGCAGG - Intronic
1089704922 11:120271156-120271178 AGGTGTAAAGGGAGGGTAGTTGG - Intronic
1089814871 11:121163449-121163471 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1090229679 11:125092584-125092606 AGGTGTGGGGGTAGGGAGGATGG + Intergenic
1090372801 11:126268584-126268606 AGGTGGGCGGGGAGGGTGGGAGG + Intronic
1090673182 11:128965159-128965181 GGGTGGCAGGGGAGGGAGGAAGG - Exonic
1090892770 11:130941446-130941468 TGGTGTGAGGGGAGGGGGGAGGG - Intergenic
1090963067 11:131574101-131574123 TGGTGTCTGGGGAGGGTTGATGG + Intronic
1091355971 11:134937917-134937939 AGGGATAAGGGCAGGGTGGGAGG + Intergenic
1091676344 12:2493430-2493452 AGGTGTCAGGGAAGGGTTCACGG - Intronic
1091676594 12:2495425-2495447 AGGTGGCAGTGGAGGGTGGGTGG + Intronic
1092100634 12:5880933-5880955 GGGTGGAATGGGTGGGTGGATGG + Intronic
1092183654 12:6463032-6463054 AGGTGCAAGGGGAGGAGGGCAGG - Intronic
1092323520 12:7505105-7505127 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1092394176 12:8110713-8110735 AGGAGTTAGGGGATGGGGGAAGG - Intergenic
1092641865 12:10520360-10520382 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1093063429 12:14631372-14631394 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1093345033 12:18029764-18029786 TGGGGTGAGGGGAGGGGGGATGG + Intergenic
1093724489 12:22488044-22488066 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1093760372 12:22903128-22903150 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
1093835755 12:23826165-23826187 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1093870413 12:24284393-24284415 AGGTGTAAGGAGAATGTGGGAGG + Intergenic
1093872978 12:24314365-24314387 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
1094121846 12:26983238-26983260 AGGTGGTGGGGGTGGGTGGAGGG + Intronic
1094379116 12:29823275-29823297 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1094405763 12:30114828-30114850 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1094555674 12:31497768-31497790 AGCGGCATGGGGAGGGTGGAGGG + Intronic
1094555704 12:31497827-31497849 AGGGGCAAGGGGAGGGGGCAGGG + Intronic
1094727925 12:33141904-33141926 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1095090194 12:38097313-38097335 TGGGGTCAGGGGAGGGGGGAAGG + Intergenic
1095091776 12:38114241-38114263 AGGGTTTAGGGGAGGGTGCAGGG - Intergenic
1095217199 12:39563767-39563789 TGAGGTGAGGGGAGGGTGGAGGG - Intronic
1095236392 12:39801096-39801118 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1095376418 12:41534437-41534459 AGGAGTGAGGGGAAGGGGGAAGG - Intronic
1095443555 12:42261719-42261741 AGGGGTGGGGGGAGGGGGGAGGG - Intronic
1095974669 12:47931072-47931094 AGGTGTAAGCTCAGGCTGGATGG + Intronic
1096286017 12:50300944-50300966 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1096356896 12:50948888-50948910 AGGGGGAGGGGGAGGGGGGAGGG + Intergenic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096685001 12:53282434-53282456 AGGTGAAAGAATAGGGTGGATGG + Exonic
1096843034 12:54390767-54390789 AGGAGGAAGTGGGGGGTGGAAGG - Intronic
1097197960 12:57254721-57254743 AGGAGCAAGGGCAGGGTGGAGGG - Exonic
1097237233 12:57548930-57548952 AAGAGGAAGGGCAGGGTGGATGG - Intergenic
1097326376 12:58282001-58282023 TGGGGTAGGGGGAGGGGGGAAGG - Intergenic
1097389474 12:58992633-58992655 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1097453330 12:59764473-59764495 TGGTGGAGGGGGAGGGGGGAGGG - Intronic
1097588102 12:61539687-61539709 GGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1097710291 12:62910194-62910216 AGGAGAGAGGGGAGGATGGAAGG + Intronic
1097974071 12:65666056-65666078 AGGTGTCAGTGCAGGATGGAGGG - Intergenic
1099041553 12:77659959-77659981 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1099332528 12:81307662-81307684 AGGTCTCAGTGGAGGTTGGAAGG - Intronic
1099385975 12:82014087-82014109 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1099388770 12:82051833-82051855 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1099488685 12:83260117-83260139 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1099499930 12:83401831-83401853 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1099527522 12:83734330-83734352 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1099531049 12:83781620-83781642 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1099692018 12:85966895-85966917 TGGGGTCAGGGGAGGGGGGAGGG + Exonic
1099823897 12:87750594-87750616 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1100966290 12:100016653-100016675 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1101054716 12:100900442-100900464 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101103130 12:101414202-101414224 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1101282279 12:103270719-103270741 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101324537 12:103703530-103703552 AGGTGTGTGGGGATGGTGGGGGG + Intronic
1101628713 12:106472003-106472025 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101652525 12:106690607-106690629 AGGTTCTAGGGCAGGGTGGAAGG - Intronic
1101659213 12:106751077-106751099 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1101795591 12:107970334-107970356 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1102028482 12:109726837-109726859 AGGTGCAAGGCAAGGGCGGATGG - Intronic
1102209364 12:111113428-111113450 AGGTGTAGGGGGTGGGGGAAGGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102390356 12:112544522-112544544 AGGTCTAAGGGTAGGGAGGAAGG + Intergenic
1102720783 12:115014140-115014162 GGGAGTAAAGGGAGGGAGGATGG + Intergenic
1102749163 12:115277210-115277232 AGGGGAAAGGGGAGGGGGGGAGG + Intergenic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102896105 12:116599768-116599790 AGGTGGAAAGGGTGGGTGGGTGG - Intergenic
1103179593 12:118898450-118898472 ATGTTTAAGTGGAGTGTGGAAGG + Intergenic
1103884006 12:124187571-124187593 GGGTGGAGGGGGAGAGTGGAGGG + Intronic
1104010859 12:124929102-124929124 AGGAGTGAGGGGAGGGGGCAAGG + Intergenic
1104114046 12:125731787-125731809 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1104178000 12:126351487-126351509 AGGTGTGAGGGGTAGGGGGATGG - Intergenic
1104236887 12:126947386-126947408 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1104544425 12:129698576-129698598 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1104738644 12:131156225-131156247 AGGAGGAAGGGAAGGGAGGAGGG - Intergenic
1104781276 12:131422094-131422116 AGGTGGAGGAGGAGGGAGGAGGG - Intergenic
1104809544 12:131612020-131612042 AGGTGGAAGGAGCGGGTGGGCGG - Intergenic
1104839910 12:131818504-131818526 AGGAGTCAGAGGAGGGTGGTGGG - Intergenic
1105040455 12:132956851-132956873 AGGAGTCAGCGGAGGGTGGTGGG + Intergenic
1105214374 13:18275588-18275610 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1105339061 13:19502648-19502670 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1105410918 13:20170548-20170570 AGGGGTAAGGGTGGGGAGGAAGG - Intergenic
1105445443 13:20451060-20451082 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
1105537199 13:21278390-21278412 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1105544363 13:21340857-21340879 AGTTGTCAGGGGAGGGGGGTTGG - Intergenic
1105663112 13:22521656-22521678 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1106269280 13:28138476-28138498 AGGGGAGAGGGGAGGGAGGAGGG - Intergenic
1106302816 13:28484931-28484953 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1106623622 13:31396109-31396131 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1106649889 13:31679063-31679085 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
1106654063 13:31723509-31723531 TGGGGTAGGGGGAGGGCGGATGG - Intergenic
1106932000 13:34676658-34676680 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
1106970007 13:35128085-35128107 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
1107206294 13:37793427-37793449 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1107365823 13:39674202-39674224 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1107747927 13:43531924-43531946 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1107964064 13:45583912-45583934 AGGTGTAAGGAGAGGTCAGATGG - Intronic
1108021638 13:46133728-46133750 AGGTGAATGGGGAGGGAGGGAGG + Intronic
1108058382 13:46507982-46508004 GGGTTTAAGGGGAGGGTAGGTGG - Intergenic
1108471204 13:50768426-50768448 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108739960 13:53326328-53326350 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1108930617 13:55813425-55813447 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1109089895 13:58029255-58029277 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1109119827 13:58440711-58440733 AGGATCAAGAGGAGGGTGGAAGG - Intergenic
1109624002 13:64950741-64950763 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1109677943 13:65705524-65705546 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1109895102 13:68676766-68676788 AGGGGGAAGGGGAGAGGGGAGGG - Intergenic
1109911209 13:68913072-68913094 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1109930389 13:69208593-69208615 AGGTGTGAAGGGAGCCTGGAAGG + Intergenic
1109998821 13:70167510-70167532 TGGTGTGGGGGGAGGGAGGAAGG + Intergenic
1110400260 13:75081464-75081486 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1110566646 13:76964012-76964034 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1110935260 13:81279696-81279718 AGGTGGAAGGGGAGACAGGAGGG - Intergenic
1111096398 13:83521746-83521768 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1111103351 13:83614168-83614190 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1111234420 13:85390039-85390061 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1111341406 13:86891121-86891143 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1111345866 13:86953527-86953549 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1111369733 13:87301480-87301502 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1111782132 13:92741727-92741749 TGGTGTAGGGGGAGAGGGGAGGG - Intronic
1111838119 13:93414258-93414280 AGCTGTTAGGGGAGGGTGAATGG - Intronic
1112072404 13:95869026-95869048 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441375 13:99426991-99427013 AGGAGAGAGGGGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112464929 13:99635474-99635496 ATGTGGAAGGGGAGGCTGAATGG - Intronic
1112982861 13:105408428-105408450 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1113010154 13:105754992-105755014 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1113179797 13:107612104-107612126 GGGAGGAAGGGGAGGGGGGAGGG + Intronic
1113939739 13:114012373-114012395 CGGTGCACGGGGAGTGTGGAAGG - Intronic
1113975566 13:114225419-114225441 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1114240837 14:20866110-20866132 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1114245116 14:20905581-20905603 AAGAGTAAGGGAAGAGTGGAAGG + Intergenic
1114433531 14:22683788-22683810 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114801318 14:25779002-25779024 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1115010992 14:28544545-28544567 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1115235319 14:31203889-31203911 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1115426333 14:33264272-33264294 TGGGGTAGGGGGAGGGGGGAAGG + Intronic
1115755901 14:36525557-36525579 GGGTGTGAGGGAAGGGTGGAGGG + Intergenic
1115948062 14:38686097-38686119 TGGGGTAAAGGGAGGGGGGAGGG + Intergenic
1116025779 14:39512517-39512539 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1116029181 14:39550342-39550364 CGGGGTGAGGGGAGGGAGGATGG - Intergenic
1116036462 14:39633679-39633701 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1116038914 14:39661872-39661894 TGGTGTTGGGGGAGGGGGGAGGG + Intergenic
1116129470 14:40836116-40836138 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1116136203 14:40927394-40927416 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1116137601 14:40949053-40949075 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1116218328 14:42049184-42049206 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1116487987 14:45474681-45474703 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1116498927 14:45596811-45596833 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1116707973 14:48327719-48327741 GGGGGTAAGGGGAGGGGGGAGGG - Intergenic
1117004445 14:51404921-51404943 ACATGTTGGGGGAGGGTGGAAGG - Intergenic
1117258469 14:54004403-54004425 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1117274405 14:54178397-54178419 AACAGTAAGGGGAGGGTCGATGG + Intergenic
1117661224 14:58006760-58006782 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1117717770 14:58598379-58598401 AGGTGGGAGGCGAGGGTGGGAGG + Intergenic
1118012860 14:61627840-61627862 AAGTGTAAGGGTAGAGTTGAGGG - Intronic
1118077136 14:62311717-62311739 AGCTGGAAGGTGAGGGTGGGAGG + Intergenic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118171983 14:63396335-63396357 AGGAGGAAGAGGAGGGTGGGAGG + Intronic
1118527874 14:66666101-66666123 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118622991 14:67631123-67631145 AGGTCAAGGGGGATGGTGGAGGG - Intronic
1118649404 14:67873938-67873960 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118682660 14:68259301-68259323 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1118882876 14:69843542-69843564 AGGTGTCAGGGCAGGGTGATGGG + Intergenic
1120070245 14:80094519-80094541 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1120170722 14:81245260-81245282 AGGGGGAAGGGGAGGGGGAAGGG + Intergenic
1120170729 14:81245272-81245294 AGGGGGAAGGGGAGGGGGAAGGG + Intergenic
1120201918 14:81546614-81546636 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1120278555 14:82409454-82409476 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1120294437 14:82622529-82622551 AGGTGGATGGGGAGGCTGAAAGG + Intergenic
1120298961 14:82681183-82681205 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1120569969 14:86105597-86105619 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1120738597 14:88082773-88082795 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1121124194 14:91395526-91395548 AGGTGGAATGGGAGGTGGGAAGG - Intronic
1121169536 14:91841955-91841977 AGGTGGAAGGGAAGGATGGATGG - Intronic
1121253731 14:92516951-92516973 AGGCCTAAGGGGATGGTGAAGGG - Intronic
1121618482 14:95330102-95330124 AGCTGGGAGGGAAGGGTGGAGGG + Intergenic
1121799751 14:96764775-96764797 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1121844597 14:97161583-97161605 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1122138913 14:99650486-99650508 AGCTGTAGGGGTAGGGTGCAGGG + Intronic
1122408916 14:101516294-101516316 TGGTGGGAGGTGAGGGTGGAAGG - Intergenic
1122447851 14:101782099-101782121 AGGGGGAGGGGGAGGGGGGAGGG - Intronic
1122557650 14:102590341-102590363 AGGTGTAAGGAGAGGGGAGCAGG + Intergenic
1122600547 14:102919579-102919601 AGATGGAAGGTGATGGTGGATGG - Intergenic
1122832989 14:104412184-104412206 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1123167326 14:106338280-106338302 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1202871781 14_GL000225v1_random:171808-171830 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123489263 15:20767284-20767306 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123545762 15:21336371-21336393 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123727896 15:23123289-23123311 TGGTGTTGGGGGAGGGGGGAGGG - Intergenic
1123828097 15:24104073-24104095 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1123987942 15:25661534-25661556 AGGTGTGGGGGGCTGGTGGATGG - Intergenic
1124055128 15:26235153-26235175 AGGCGTAAGGGCAGGATAGAGGG - Intergenic
1124338792 15:28876649-28876671 TGGTGCAGGGTGAGGGTGGAGGG + Intergenic
1124647664 15:31450409-31450431 AGGGGGAAGGGGAGGGAGAAGGG + Intergenic
1124700980 15:31911765-31911787 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1125219080 15:37312764-37312786 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1125226246 15:37399605-37399627 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1125311669 15:38385893-38385915 AGATGGAAGGTGAGGGAGGAAGG - Intergenic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125458105 15:39881074-39881096 AGGTGAAAAGTGAGGCTGGAGGG - Intronic
1125694273 15:41622030-41622052 CGGGGTAGGGGGAGGGTGGGGGG + Intronic
1125767855 15:42147058-42147080 AGAAGCAAGGGGCGGGTGGAAGG + Intronic
1125977103 15:43963906-43963928 TGGGGTTAGGGGAGGGCGGAGGG + Intronic
1126207408 15:46060970-46060992 AGGTGTAAGGCAAGGAAGGAGGG - Intergenic
1126516580 15:49546099-49546121 TGGGGTGAGGGGAGGGGGGACGG - Intronic
1126877927 15:53064121-53064143 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1126979080 15:54220446-54220468 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1127198342 15:56614930-56614952 TGGTGGAAGGGGAGGGTGGCAGG - Intergenic
1127405381 15:58638854-58638876 AACTGTCAGGGGAGGGAGGAAGG + Intronic
1127534672 15:59879022-59879044 AGGCGTGGGGGTAGGGTGGAGGG + Intergenic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1127756877 15:62101167-62101189 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1127874645 15:63101585-63101607 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1127920168 15:63488148-63488170 AGGTGGAAAGGGAGGGAGGAGGG - Intergenic
1127954901 15:63844914-63844936 TGGGGTGAGGGGAGGGGGGACGG + Intergenic
1128342190 15:66830375-66830397 TGGAGTCAGGGGAGGGTGCAGGG - Intergenic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128471772 15:67959930-67959952 AGCTGTCATGGGAGAGTGGATGG + Intergenic
1128586370 15:68853940-68853962 TGGTGTAAGGGGTTGGGGGAGGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1128817356 15:70621700-70621722 TGGGGTGAGGGAAGGGTGGAGGG + Intergenic
1128952987 15:71907084-71907106 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129451503 15:75653627-75653649 AGGCGAAAGAGGAGGGAGGAAGG + Intronic
1129672836 15:77616613-77616635 AGGTGCAGGGGGAGGAGGGAGGG - Intronic
1129879860 15:78999362-78999384 AGCTGGAAGAGGAGGGTGCAGGG + Intronic
1129912871 15:79242589-79242611 AGGAGTGAGGGGAGGGTTGACGG + Intergenic
1130029941 15:80304307-80304329 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1130445067 15:83992924-83992946 AGCTGAAAGGTGAGGGAGGAAGG - Intronic
1130763370 15:86843889-86843911 GGGACTAAGAGGAGGGTGGAAGG - Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131039550 15:89250545-89250567 TGGAGTGAGGGGAGGGGGGAGGG + Intronic
1131121157 15:89824095-89824117 AGGTGTAGGGGCAGGATGGCAGG - Intergenic
1131284811 15:91048148-91048170 AGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1131337662 15:91565233-91565255 AACTGTAATGGGATGGTGGAGGG - Intergenic
1131342650 15:91616981-91617003 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1131414760 15:92244961-92244983 AGGACTAAGGGGTTGGTGGAAGG - Intergenic
1131951243 15:97683738-97683760 AGGGGGAGGGGGAGGGGGGAGGG + Intergenic
1202954104 15_KI270727v1_random:63642-63664 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1132665710 16:1080512-1080534 AGGTGTAAGGGGAGTGTGGCTGG + Intergenic
1132875393 16:2134932-2134954 AGGGGTAGGGGCAGGGTGGGAGG - Intronic
1133257603 16:4526898-4526920 AGGTGGCAGGGCAGGGTGGTGGG - Intronic
1133392825 16:5423007-5423029 AGGAGAAAGGAGAGGGAGGAAGG + Intergenic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133477203 16:6134986-6135008 TGGGGTCAGGGGAGGGGGGACGG - Intronic
1133558108 16:6924822-6924844 AGGGGGAGGGGGAGGGGGGAGGG - Intronic
1133568806 16:7021973-7021995 AGGGGGAAGGGGAGGGGGAAGGG - Intronic
1133568841 16:7022037-7022059 AGGGGGAAGGGGAGGGGGAAGGG - Intronic
1134323994 16:13190221-13190243 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1134433208 16:14231133-14231155 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1134449430 16:14354290-14354312 AGGGGAAAGGGGAGGGGGAAGGG + Intergenic
1134519591 16:14912428-14912450 AGGGGTAGGGGCAGGGTGGGAGG + Intronic
1134523155 16:14927718-14927740 AGGGGCTAGGGGAGGGGGGAGGG - Intronic
1134549475 16:15132340-15132362 AGGGGCTAGGGGAGGGGGGAGGG + Intronic
1134554340 16:15153807-15153829 AGGGGTAGGGGCAGGGTGGGAGG - Intergenic
1134707263 16:16311084-16311106 AGGGGTAGGGGCAGGGTGGGAGG + Intergenic
1134710822 16:16326369-16326391 AGGGGCTAGGGGAGGGGGGAGGG - Intergenic
1134948779 16:18342276-18342298 AGGGGCTAGGGGAGGGGGGAGGG + Intergenic
1134960278 16:18401041-18401063 AGGGGTAGGGGCAGGGTGGGAGG - Intergenic
1135032715 16:19051393-19051415 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1135066568 16:19314989-19315011 AGGAGGAGGGGGTGGGTGGAGGG + Intronic
1135666380 16:24338813-24338835 AGGTGAAAGGAGAGGGGTGATGG - Intronic
1136071837 16:27792037-27792059 TGGTGGAAGGGAAGGATGGAGGG - Intronic
1136244224 16:28964131-28964153 TGGTGAAAGGGGAGGGGTGAAGG - Exonic
1136452417 16:30360898-30360920 AGGAGCAAGGGGAGGGTTGTTGG - Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136544413 16:30947600-30947622 AGGTGGAAGGGGCGGGGGGCGGG + Exonic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136636676 16:31528752-31528774 AGGTGTCAGGGTAGAGTGGCAGG - Exonic
1136914808 16:34177584-34177606 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1136986284 16:35108631-35108653 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1137007690 16:35293175-35293197 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1137454915 16:48610582-48610604 AGGTAAAAGGGTAGGGAGGAAGG - Intronic
1137731656 16:50694357-50694379 AGGGGTCAGGGGAGGGTGACAGG - Intronic
1137978626 16:53051619-53051641 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1138247933 16:55480695-55480717 AGGTTGAGGGGGAGGCTGGAGGG - Intronic
1138260882 16:55620958-55620980 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1138358552 16:56406029-56406051 AGGGGAGAGGGGAGGGGGGAGGG + Intronic
1138544045 16:57705790-57705812 AGGAGAAATGGGAGGATGGATGG - Intronic
1138544228 16:57706434-57706456 AGGAGAAATGGGAGGATGGATGG - Intronic
1138544357 16:57706856-57706878 AGGAGAGAGGGGAGGATGGATGG - Intronic
1138722896 16:59102382-59102404 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1138973048 16:62170120-62170142 AGGGGTAAGGGCAAGGTGGGAGG + Intergenic
1139163185 16:64535837-64535859 AGGTATCAATGGAGGGTGGATGG + Intergenic
1139272343 16:65695857-65695879 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1139583233 16:67885409-67885431 AGGAGTCAGGACAGGGTGGAGGG - Intronic
1139755716 16:69141979-69142001 CGGGGTGAGGGGAGGGGGGAGGG - Intronic
1140178692 16:72692163-72692185 TGGGGTAAGGGTAGGGGGGAGGG - Intergenic
1140208069 16:72949593-72949615 GGGGGAAAGCGGAGGGTGGAGGG + Intronic
1140538687 16:75734973-75734995 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1140627438 16:76811182-76811204 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1140639398 16:76954363-76954385 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1140655184 16:77132457-77132479 AGGAGGAAGGGGAGGGGAGAGGG - Intergenic
1140923510 16:79561457-79561479 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1141167247 16:81668930-81668952 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141167405 16:81669632-81669654 AGGTGTGAGGTGGGTGTGGAAGG - Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141534708 16:84670939-84670961 TGGGGTCAGGGGAGGGCGGAGGG + Intergenic
1142666712 17:1467682-1467704 AGGTGGATGGGGAGGTGGGAGGG - Intronic
1142825721 17:2508963-2508985 AGGTGAAAGGCGATGGTGGGAGG - Intronic
1144159003 17:12538694-12538716 AGGTGGGAGTGGAGTGTGGATGG + Intergenic
1144228397 17:13174322-13174344 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1144414456 17:15033176-15033198 AGGTGTAAGGGCATGGAAGAAGG + Intergenic
1144697594 17:17315685-17315707 GGGTGGCAGGGGTGGGTGGAGGG + Intronic
1145271564 17:21407556-21407578 ATGGGTAATGGGTGGGTGGATGG - Intronic
1145309778 17:21695004-21695026 ATGGGTAATGGGTGGGTGGATGG - Intronic
1146076794 17:29738068-29738090 TGGGGTCACGGGAGGGTGGAGGG - Intronic
1146126835 17:30237246-30237268 AGGTGCAGGGGGATGCTGGAAGG + Intergenic
1146296358 17:31653648-31653670 AGGGGAGAGGGGAGAGTGGAAGG - Intergenic
1146433570 17:32822374-32822396 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1146688329 17:34856616-34856638 GGGGGTTAGGGGAGGGTAGAGGG + Intergenic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1147139207 17:38452150-38452172 AGGTGGGAGGGGAGGGGGAAGGG - Intronic
1147363592 17:39946154-39946176 AGGGGCAAGGGGAAGGTGGGTGG + Intergenic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147598675 17:41732943-41732965 AGGGGTAAGGGGAGGATGTGGGG - Intronic
1147794589 17:43033451-43033473 AGGGGGAAGGACAGGGTGGATGG + Intergenic
1147969628 17:44212492-44212514 AGGGGCAGGGGGAGGGGGGAAGG + Intronic
1148384916 17:47227518-47227540 AGGTGAAAGGAGAGGCAGGAGGG - Intergenic
1148582282 17:48752348-48752370 AGGTGACAGGAGAGGGAGGAAGG + Intergenic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148852122 17:50560504-50560526 AGGGGCAAGGGGAGGGGAGAGGG + Intergenic
1148889644 17:50798623-50798645 AGGGGTCAGGGGAGGGTTCAGGG + Intergenic
1148949157 17:51294340-51294362 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1149053305 17:52332777-52332799 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1149334847 17:55625108-55625130 AGGAGTAAGGAGAGGGTGAGGGG + Intergenic
1149649810 17:58269635-58269657 GGGTGGAAGGTGAGGGAGGAGGG + Intergenic
1150219479 17:63487936-63487958 AAGTGTGAGGGGAGGCTGGCCGG + Intronic
1150265872 17:63832186-63832208 AGGTGAATGGGGAGGCTGGGAGG - Exonic
1150889019 17:69123013-69123035 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1151145988 17:72041842-72041864 AGGTATAGGGGGTGGGTAGAGGG - Intergenic
1151294046 17:73170503-73170525 AGGTGTGAGGGGTGGGAGGCAGG - Exonic
1151401353 17:73857946-73857968 AGGGGTGTGGGGAGGGTGGCTGG + Intergenic
1151422794 17:74009625-74009647 AGGCGGGAGGTGAGGGTGGAGGG - Intergenic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1152108187 17:78342595-78342617 AGGAGTTAGGGGTGGGTGGAGGG - Intergenic
1152202327 17:78954389-78954411 AGGTGGAAAGGGTGGGCGGATGG - Intergenic
1152266240 17:79296676-79296698 AGGAGGAAGGGGAGGAGGGAGGG - Intronic
1152425611 17:80217006-80217028 AGGTGCAAGGGGCGGGAGGAGGG - Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152526424 17:80890534-80890556 GGGTGGGAGGGGCGGGTGGAGGG + Intronic
1152944266 17:83190642-83190664 CGGTGTCAGGGGAGGCTGGTGGG - Intergenic
1153078860 18:1196852-1196874 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1153675314 18:7451805-7451827 TGGCCTAAGGGGAGGGGGGAAGG - Intergenic
1153727564 18:7972311-7972333 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1153751683 18:8238745-8238767 TGGTGTAAGGTGTGGGGGGAGGG + Intronic
1153806291 18:8711030-8711052 AGGAGTAGGGGGAGTGGGGAGGG - Intronic
1154207300 18:12348066-12348088 AGGTGGCAGGGGACGGTGGCAGG + Intronic
1154359272 18:13645463-13645485 AGCAGTAACGGGAGGATGGAGGG + Exonic
1154416593 18:14178749-14178771 AGCTGTGAGGGGAGGGTGTTAGG + Intergenic
1154532978 18:15367116-15367138 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1154966763 18:21366289-21366311 TGGGGTAAGGGGATGGGGGAGGG - Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155358143 18:24973515-24973537 TGGTAGAAGGGAAGGGTGGAGGG - Intergenic
1155608325 18:27633572-27633594 AGGGGAAAGGTGAGGCTGGAAGG - Intergenic
1155997015 18:32341119-32341141 TGGGGTAAGGGGAGGAGGGAGGG - Intronic
1156075159 18:33266641-33266663 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1156118117 18:33811580-33811602 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1156472798 18:37388050-37388072 AGGAGTTGGGGGAGGGGGGAGGG + Intronic
1156546099 18:37965191-37965213 AGGGGAAAGGGGAGGGAGGGAGG - Intergenic
1157725155 18:49958580-49958602 AGGAGGCAGGGGTGGGTGGATGG - Intronic
1157822818 18:50786309-50786331 AGGACTGGGGGGAGGGTGGATGG - Intergenic
1157924341 18:51746504-51746526 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1158117646 18:54013792-54013814 AGGTGTCAGCGAAGGGTGGTGGG - Intergenic
1158752189 18:60274759-60274781 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1158833934 18:61310740-61310762 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1158909814 18:62048843-62048865 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1159129602 18:64266196-64266218 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1159131935 18:64289388-64289410 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1159235701 18:65670152-65670174 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1159251705 18:65887407-65887429 TGGGGTAGGGGGAGGGGGGAGGG - Exonic
1159569692 18:70098784-70098806 TGGGGTAGGAGGAGGGTGGAGGG - Intronic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1159983266 18:74811881-74811903 AGGGGAAGGGGGAGGGGGGAGGG + Intronic
1160300334 18:77672357-77672379 AGGTGGAAGGGGAGGGCTGTAGG + Intergenic
1160322061 18:77905518-77905540 AGGTGGAAGGGGAGGGAAGGGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160490364 18:79332610-79332632 AGGTGGAAGCGGAGGCAGGAGGG + Intronic
1160545057 18:79647413-79647435 GGGAGGAAGGGGAGGGGGGAGGG + Intergenic
1160821140 19:1058755-1058777 AGGTCTATGGAGAGGGTGGCAGG + Intronic
1160872035 19:1282078-1282100 AGGAGGAAGGGGAGGAGGGAGGG + Intergenic
1160872221 19:1282597-1282619 AGGTGTGAAGGGAGGAGGGAGGG + Intergenic
1161022361 19:2016059-2016081 AGGTGGGAGGGGAGGAGGGAGGG + Intronic
1161229597 19:3166942-3166964 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1161346836 19:3772343-3772365 AGGAGGGAGGGCAGGGTGGATGG + Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161546075 19:4881071-4881093 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1161609249 19:5231786-5231808 AGGTGGGATGGGCGGGTGGATGG + Intronic
1161926417 19:7303575-7303597 AGGGGGAAGGGGAGAGGGGAGGG + Intergenic
1162381588 19:10334844-10334866 AGAGGAAAGGGGAGGGCGGAGGG - Intronic
1162707586 19:12566762-12566784 TGGAGTAGGGGGAGGGGGGAGGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1162884933 19:13689905-13689927 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1163004530 19:14389200-14389222 AGGGGTAGGGGGAGGGAGAAGGG + Intronic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163092473 19:15030336-15030358 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1163383629 19:16985628-16985650 AGGCGCAGAGGGAGGGTGGATGG + Intronic
1164118908 19:22247887-22247909 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1164188443 19:22893926-22893948 AGGTGTTTGGGGAGAGTGGTGGG + Intergenic
1164326964 19:24202293-24202315 TTGGGTCAGGGGAGGGTGGAGGG + Intergenic
1164376927 19:27695580-27695602 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1164872069 19:31654375-31654397 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1165090959 19:33388254-33388276 AGGGGTATGTGCAGGGTGGAAGG - Intronic
1165272235 19:34720663-34720685 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1165288720 19:34866054-34866076 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1166440037 19:42805591-42805613 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1166446213 19:42859351-42859373 TGGGGTGAGGGGAGGGGGGACGG - Intronic
1166690345 19:44818677-44818699 AGGAGTGAGGGGAGAGAGGAGGG - Intronic
1166760926 19:45224165-45224187 AGGAGTGGGGGGAGGGTGGCGGG + Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167131923 19:47592481-47592503 AGTTGTCAGATGAGGGTGGAAGG - Intergenic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1168283960 19:55321316-55321338 AGGTGCAAGGAGAGGCTGGGAGG - Intronic
1168294069 19:55370275-55370297 TGGTTCATGGGGAGGGTGGAGGG - Intronic
1168296637 19:55380291-55380313 AGGGGGGAGGGGAGGGGGGAAGG - Intronic
1168348501 19:55662374-55662396 AGGGATGAGGGGAGGGAGGAGGG - Intronic
1168433802 19:56302313-56302335 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168523179 19:57068823-57068845 AGTGGTAAGAGGAGGCTGGAGGG + Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
925183008 2:1829244-1829266 AGGTGTATGGGAAGGTTGGAAGG - Intronic
925196414 2:1929412-1929434 AGGTGAAAGGGGAACATGGAGGG + Intronic
925366416 2:3315039-3315061 AGGTGTTGGGGGCGGGTGGCGGG - Intronic
925369778 2:3336116-3336138 AGGGTGAAGGGGAGGGTGAAGGG + Intronic
925388816 2:3482127-3482149 AGAGGTAAGGGGAGTGTGGACGG - Intronic
925418401 2:3690314-3690336 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925418409 2:3690326-3690348 AGGGGGGAGGGGAGGGGGGAGGG - Intronic
925476355 2:4221069-4221091 AGGTGCAAGGAGAGGCAGGAGGG - Intergenic
925755363 2:7128037-7128059 GGGAGGAAGGGGAGGGGGGAGGG - Intergenic
925755413 2:7128128-7128150 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755436 2:7128169-7128191 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755459 2:7128210-7128232 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925755489 2:7128264-7128286 GGGGGAAAGGGGAGGGGGGAGGG - Intergenic
925891113 2:8435436-8435458 AGGAGGAAGGGAAGGGAGGAAGG + Intergenic
925976731 2:9146893-9146915 AGGTGTACGGTGAGGCTGCAGGG - Intergenic
926108648 2:10168258-10168280 GGGTGTCAGGGGTGGGGGGAAGG - Intronic
926237172 2:11054692-11054714 AGGTGTGTGGGTGGGGTGGAGGG - Intergenic
926244574 2:11113502-11113524 AGGAAGAAGGGGAGGGAGGAAGG - Intergenic
926266677 2:11328917-11328939 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
926523439 2:13946636-13946658 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
926538882 2:14150156-14150178 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
926543749 2:14212458-14212480 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
926825984 2:16905406-16905428 CGGGGTAGGGGGAGGGGGGAGGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
926917840 2:17909861-17909883 TGAAGTTAGGGGAGGGTGGATGG + Intronic
927106649 2:19833365-19833387 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
927177666 2:20421950-20421972 TGGTGGAGGGGGAGGATGGATGG - Intergenic
927232138 2:20834607-20834629 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
927232145 2:20834619-20834641 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
927232152 2:20834631-20834653 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
927232159 2:20834643-20834665 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
927959392 2:27231411-27231433 AGGTGGAAGGGGTGGGAAGAAGG - Intronic
928021727 2:27710500-27710522 GGGTGGAATGGAAGGGTGGATGG + Intronic
928022537 2:27715825-27715847 AGGGGTGTGGGGAGGGGGGAGGG - Intergenic
928268060 2:29829165-29829187 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
928363898 2:30687167-30687189 AGGTGAAAGTGGAGGCTGGACGG + Intergenic
928384213 2:30850851-30850873 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
928390879 2:30910060-30910082 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
928720341 2:34113994-34114016 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
928855725 2:35800495-35800517 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929316617 2:40486863-40486885 AGGGGTGGGGGGAGGGGGGAGGG - Intronic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
929757321 2:44778526-44778548 AGGTGCAAGGGGAGGGGGCGGGG + Intergenic
929809150 2:45174198-45174220 GGATGCAAGGGGAAGGTGGAGGG + Intergenic
929956115 2:46460047-46460069 AGGTGGAAGGAGGGGGAGGAGGG - Intronic
930169276 2:48234226-48234248 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
930606925 2:53502502-53502524 TGGTGTCGGGGGAGGGGGGAGGG - Intergenic
930639513 2:53840578-53840600 AGGGGAGAGGGGAGGGGGGAGGG + Intergenic
930673839 2:54179233-54179255 TGGTGTGAGGGGTGGGTGGGTGG + Intronic
930995646 2:57714323-57714345 AGGAGAAAGGGGTGAGTGGAAGG + Intergenic
931566655 2:63622025-63622047 AGGGGTGAGGGGAGTGGGGAGGG - Intronic
931590672 2:63880156-63880178 AGGGGTAGGGGGAAGGGGGAAGG - Intronic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
931937309 2:67213740-67213762 TGGTGTCAGGGGAGCCTGGATGG - Intergenic
931951078 2:67362102-67362124 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
932377944 2:71254773-71254795 AGATGCAAGGGGAGGGTACATGG - Intergenic
932392743 2:71411616-71411638 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
932433053 2:71686831-71686853 GGGTGGGCGGGGAGGGTGGACGG + Intergenic
932481006 2:72039318-72039340 AGGGGTTTGGGGAGGGTGCAGGG - Intergenic
932505615 2:72228408-72228430 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
932520790 2:72409717-72409739 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
932526073 2:72470608-72470630 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
932732604 2:74231790-74231812 AGGTGTCAGGGGTGGGAGGCAGG + Intronic
932979558 2:76648136-76648158 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
933000063 2:76910346-76910368 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
933017118 2:77141471-77141493 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
933081263 2:77989620-77989642 TGGGGTGAGGGGAGGGCGGAGGG - Intergenic
933102428 2:78276868-78276890 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
933112639 2:78423127-78423149 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933177977 2:79197303-79197325 AGTGGTAAGGGGAAGCTGGAGGG + Intronic
933197455 2:79408445-79408467 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
933268724 2:80210354-80210376 TGGGGTATGGGGAGGGGGGAAGG - Intronic
933386641 2:81619182-81619204 TGGAGTAGGGGGAGGGGGGAGGG + Intergenic
933562477 2:83905727-83905749 GGGTTTAAGGGGAGGAGGGAAGG + Intergenic
933594432 2:84268342-84268364 TGAGGTAGGGGGAGGGTGGAGGG + Intergenic
933653524 2:84868436-84868458 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
933716162 2:85362394-85362416 GGGAGTGAGGGGAGGGTGTATGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
933833028 2:86225762-86225784 TGGTGTCAGGGGAGGAAGGAAGG - Intronic
934118698 2:88819551-88819573 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
934192202 2:89809614-89809636 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
934299947 2:91771153-91771175 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
934636913 2:95998159-95998181 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
934796738 2:97107262-97107284 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
934836681 2:97596169-97596191 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
935092526 2:99909337-99909359 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
935147586 2:100406395-100406417 AGGTGTGAGGGGAGGTAGGGTGG - Intronic
935622318 2:105141012-105141034 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
935713491 2:105919432-105919454 AGCTGTAAGTAGAGGGAGGATGG + Intergenic
935958306 2:108400122-108400144 AGCTGGAAGGGGAGGGGGTAAGG - Intergenic
936078557 2:109417269-109417291 AGGTGTAGGTGGGGGCTGGAGGG - Intronic
936328158 2:111523260-111523282 AGGTCTCAGGGAATGGTGGAGGG + Intergenic
936523250 2:113225786-113225808 AGGCGGCAGGGGAAGGTGGAGGG + Intronic
936997377 2:118429725-118429747 ATGTGTAAGGGGTGGATGGCAGG + Intergenic
937089607 2:119197061-119197083 GGGGGTGAGGGGAGGATGGAGGG + Intergenic
937137021 2:119562513-119562535 AGGTGATTGGAGAGGGTGGAGGG + Intronic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937159739 2:119748834-119748856 AGGTGAAAGGGGAGGGGAGAGGG - Intergenic
937250638 2:120521688-120521710 AGCTGCAAGGGGCAGGTGGAGGG - Intergenic
937303574 2:120857626-120857648 AGGTGTTTGGGTAGGATGGATGG - Intronic
937648486 2:124294045-124294067 GGGAGAAAGGGTAGGGTGGAAGG + Intronic
937958421 2:127437069-127437091 AGGTGGAAGGGAAGGGGTGAGGG - Intronic
938218001 2:129537803-129537825 TGGGGTTAGGGGAGGGGGGAGGG + Intergenic
938808712 2:134831295-134831317 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
938857056 2:135324222-135324244 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
939205858 2:139102985-139103007 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
939274750 2:139986731-139986753 AGGTATACGGGGAGGGGGGAGGG - Intergenic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
940413880 2:153398063-153398085 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
940503934 2:154528274-154528296 AGCTGCAAGGGGATGGGGGAGGG + Intergenic
940586470 2:155658448-155658470 AGGGGGAAGGGGAGGGGGAAGGG + Intergenic
940586477 2:155658460-155658482 AGGGGGAAGGGGAGGGGGAAGGG + Intergenic
940586484 2:155658472-155658494 AGGGGGAAGGGGAGGGGGAAGGG + Intergenic
940602434 2:155878627-155878649 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
940759795 2:157725259-157725281 AGGGGTAAGAGGAGGGGGAATGG + Intergenic
941015510 2:160351176-160351198 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
941135960 2:161719044-161719066 TGGGGTGAGGGGAGGGGGGAAGG - Intronic
941337791 2:164266983-164267005 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
941627061 2:167841628-167841650 AGGAGAAGGGGGAGGCTGGAAGG - Intergenic
941673800 2:168322601-168322623 AGGTGGGTGGGGAGGGTGAAAGG + Intergenic
942006838 2:171711009-171711031 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
942628043 2:177924870-177924892 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
942799496 2:179860486-179860508 AGGTGTCAGGGAAGGGTGGGAGG - Intronic
943120969 2:183734784-183734806 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
943284678 2:185982491-185982513 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
943444153 2:187962657-187962679 AGGTATGAGGGGATGGTGGTGGG + Intergenic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
943659083 2:190538124-190538146 AGAGGTAAGGGGATGGTGGGAGG - Intergenic
943688342 2:190842926-190842948 AAATGCATGGGGAGGGTGGATGG + Intergenic
943799004 2:192034393-192034415 AGGAGTGATGGGAGAGTGGAAGG - Intronic
943921491 2:193713179-193713201 AGGGGTAAGGGGAGGGGAAAGGG - Intergenic
943921508 2:193713215-193713237 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
943921515 2:193713227-193713249 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
943967666 2:194357988-194358010 AGGTGGGAGGGAAGTGTGGATGG + Intergenic
944046335 2:195415587-195415609 AGGTATGGGGGGAGGGGGGAGGG + Intergenic
944340123 2:198586100-198586122 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
944421269 2:199533457-199533479 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
944625657 2:201566347-201566369 AGGGGTGGGGGGAGGGGGGAGGG - Intronic
944677904 2:202049422-202049444 AGGTGAAGGGGAAGGGAGGAGGG + Intergenic
944687180 2:202127960-202127982 AGGGGCTAGGGGAGGGAGGAGGG - Intronic
945349248 2:208758240-208758262 TGGGGTGAGGGGAGGGTGGAGGG - Intronic
945553759 2:211254058-211254080 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
945770669 2:214038683-214038705 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946308149 2:218867795-218867817 AGGTGAAAGGTGAGTGGGGATGG + Intronic
946324974 2:218980590-218980612 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946324997 2:218980660-218980682 TGGGGTGAGGGGCGGGTGGAAGG + Intergenic
946393565 2:219431285-219431307 GGGAGCAAGGGGAGAGTGGAAGG - Intergenic
946553085 2:220823842-220823864 AAGAGGAAGGGGAGGGAGGAAGG - Intergenic
946674917 2:222149043-222149065 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
946684223 2:222251245-222251267 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
946832647 2:223741826-223741848 AGGAGGAAGGGGAGGAGGGAGGG - Intergenic
947093095 2:226535848-226535870 GGGAGGAAGGGTAGGGTGGAAGG - Intergenic
947117339 2:226785884-226785906 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
947132961 2:226948417-226948439 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947293684 2:228606481-228606503 TGGTGTAGGGGGAGGGGGGAGGG - Intergenic
947341359 2:229143196-229143218 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
947377044 2:229506660-229506682 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
947540455 2:230973935-230973957 AGGTGGAAGGGGACAGTGGGAGG - Intergenic
947550101 2:231039173-231039195 TGGCGTAGGGGGAGGGAGGAGGG + Intronic
947651875 2:231793668-231793690 AGATGAAAGGGGAGGGGAGAGGG - Intronic
947830192 2:233134157-233134179 AGGAGGAAGGAGAGGGTGGTGGG + Intronic
947960898 2:234236351-234236373 GGGTGGAAAGGGAGGGAGGAAGG - Intergenic
948210541 2:236189956-236189978 GGGTGGAAGGGGTGGCTGGAGGG + Intergenic
948527564 2:238580971-238580993 AGGTCTAAGGGGTCGGGGGAGGG - Intergenic
948644214 2:239393605-239393627 AGGAGGAAGGGGAGGCTGGGTGG - Intronic
948695721 2:239732192-239732214 TGGAGGAAGGAGAGGGTGGAGGG - Intergenic
948995498 2:241576240-241576262 AGGAGGAAGGGGAGGGAGTAGGG - Intergenic
1168787967 20:556298-556320 ACGTATATGGAGAGGGTGGAGGG + Intergenic
1168791392 20:578950-578972 TGGGGTAAGGGGAGGAGGGAGGG - Intergenic
1168901583 20:1369490-1369512 GGGTTTAAGGGGAGGGTGGGTGG + Exonic
1169423351 20:5476990-5477012 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1169603776 20:7292231-7292253 AGGAATTAGGGGAGAGTGGATGG + Intergenic
1169708298 20:8533004-8533026 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1169821497 20:9715896-9715918 AGGGGTTGGGGGAGGGGGGAGGG + Intronic
1170457740 20:16549181-16549203 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1170482384 20:16779360-16779382 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1170503058 20:16994587-16994609 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1170510949 20:17076177-17076199 AGGTGTGAGGTGAGAGTGGTAGG + Intergenic
1170607287 20:17883654-17883676 AGGGGCAAGGGGAGGGAGAAGGG + Intergenic
1171026659 20:21636924-21636946 AGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171068240 20:22040603-22040625 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1171188385 20:23139985-23140007 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1171480435 20:25451706-25451728 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1171515581 20:25730058-25730080 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1171841232 20:30214247-30214269 TGGGGTGAGGGGAGGGGGGATGG - Intergenic
1171910158 20:30944253-30944275 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1171982095 20:31635417-31635439 TGGTTAAAGGGGAGGCTGGATGG - Intergenic
1172107084 20:32523206-32523228 GGGTGGAAGGGGAGGATAGAAGG + Intronic
1172123964 20:32614221-32614243 AGGCTGAATGGGAGGGTGGATGG + Intergenic
1172270712 20:33654316-33654338 AGGTGCAGGGAGTGGGTGGAAGG + Intergenic
1172834478 20:37864114-37864136 AGGTGGAAGGGGTGGGAGGCTGG + Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173011023 20:39182328-39182350 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1173043092 20:39483863-39483885 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1173313030 20:41917377-41917399 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1173366366 20:42389126-42389148 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1174035500 20:47666055-47666077 AGGTGGAAGTCGAGGGTGAAGGG - Intronic
1174035540 20:47666227-47666249 AGGTGGAAGTCGAGGGTGAAGGG - Intronic
1174039343 20:47688029-47688051 GGGTGCATGGGGAGGGTGCAGGG + Intronic
1174098693 20:48109983-48110005 AGGGTGAAGGGGTGGGTGGATGG - Intergenic
1174145044 20:48447531-48447553 AGGAGGCAGGGGAGGGAGGAGGG + Intergenic
1174379788 20:50149260-50149282 AGGGGGAAGGGAAAGGTGGAGGG - Intronic
1174448554 20:50606498-50606520 AGATGGAAAGGGAGGGTGTATGG + Intronic
1174905520 20:54546539-54546561 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1175097284 20:56551686-56551708 AGCTGGGAGGGGAGGGTGTACGG + Intergenic
1175296729 20:57913740-57913762 ATGTGCATGGGCAGGGTGGACGG + Intergenic
1175388388 20:58611542-58611564 AGGTGCCAGGGGAGGGAGGTGGG + Intergenic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175889393 20:62309634-62309656 AGGGGTGGGGGGAGGGTGGTAGG + Intronic
1175918811 20:62440369-62440391 AGGAGAAAGGTGAGGGAGGAAGG - Intergenic
1176090539 20:63316488-63316510 AGATGGCAGGGGAGGGAGGAAGG - Intronic
1176136555 20:63524988-63525010 AGGAGTGAGCGGAGGATGGAAGG + Intergenic
1176644135 21:9333862-9333884 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1177024029 21:15899275-15899297 ACTTGAGAGGGGAGGGTGGAAGG - Intergenic
1177164670 21:17586879-17586901 TGGGGTGAGGGGAGGGAGGAGGG - Intronic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1177482554 21:21709512-21709534 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1177833566 21:26167248-26167270 GGGAGTAAGGGGAGGGAGGAGGG + Intronic
1177852001 21:26359659-26359681 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1177877506 21:26651669-26651691 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1178049406 21:28731606-28731628 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1178220926 21:30658997-30659019 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1178257389 21:31066736-31066758 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1178379137 21:32093566-32093588 AGGGGTAAGGGAAGGAAGGAAGG - Intergenic
1179628531 21:42662344-42662366 ACAGGTAGGGGGAGGGTGGATGG - Intronic
1179646941 21:42781980-42782002 AGGAGGAAGGGGAGAGGGGAGGG - Intergenic
1179649526 21:42798423-42798445 GGGTGGGAGGGGAGGGTGGGGGG + Intergenic
1179662228 21:42883956-42883978 GGGTTTATGGGGAGGGTGAAAGG - Intronic
1179714462 21:43280249-43280271 AGGTGGAGGGGGAGGGGGAAGGG + Intergenic
1180286309 22:10747634-10747656 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1180368809 22:11965366-11965388 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180794062 22:18593295-18593317 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1180941693 22:19663786-19663808 AGGGGAAAGGGGATGGGGGAAGG - Intergenic
1181049429 22:20231588-20231610 GGGTGTAAGTGGAGGAGGGAGGG - Intergenic
1181227677 22:21402025-21402047 GGCTTTATGGGGAGGGTGGATGG - Intergenic
1181250974 22:21532814-21532836 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181361618 22:22342062-22342084 AGGGGTTAGGGGAGTGGGGAGGG + Intergenic
1181537080 22:23551959-23551981 AGGATTGATGGGAGGGTGGATGG - Intergenic
1181844741 22:25698124-25698146 AGGAGGAAGGAGAGGGAGGAAGG + Intronic
1181907322 22:26209711-26209733 AGGAGGAAGGGGAGGAAGGAAGG + Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1182179655 22:28333992-28334014 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184210862 22:43034906-43034928 AGGGGGGAGGGGAGGGGGGAGGG + Intergenic
1184212547 22:43044329-43044351 AGGTGCAAGGGGAGTTTAGATGG - Intronic
1184482592 22:44756579-44756601 AGGTGTATGGGGTGGGGGGGCGG - Intronic
1184729814 22:46366055-46366077 AGGTGGAGGGGGAAGGTGGAGGG + Intronic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1184980387 22:48091440-48091462 AGGTGCATGGGGAGGGAGGGGGG - Intergenic
1185150002 22:49158994-49159016 AGGCGTCAGGGGAGGAAGGAAGG - Intergenic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185411175 22:50683795-50683817 TGGTGGAGGGGGATGGTGGAGGG + Intergenic
949207624 3:1459202-1459224 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
949223057 3:1658798-1658820 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
949430879 3:3974435-3974457 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
949457956 3:4259113-4259135 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949523386 3:4878132-4878154 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
950053211 3:10007583-10007605 GGGTGTCAGGGGAGGGTTGATGG + Intronic
950054959 3:10017187-10017209 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
950421624 3:12902965-12902987 AGGTGTGAGGGGTCGGAGGAGGG + Intronic
950514383 3:13454648-13454670 AGGAGGAAGGGGAGGTTGGGGGG + Intergenic
950989459 3:17417332-17417354 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
951167837 3:19503778-19503800 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
951238297 3:20261074-20261096 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
951861454 3:27258361-27258383 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
951920584 3:27849993-27850015 TGGTATAAGGGGAGAGTTGATGG + Intergenic
952062532 3:29527784-29527806 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952107551 3:30087617-30087639 AGGTGGAGGGGGAGGGGGGAGGG - Intergenic
952436962 3:33281185-33281207 AGGGGTAGGGGGAGGGCGGAGGG - Intronic
952810246 3:37396240-37396262 AGGAGTGAGTGGAGGTTGGATGG - Intronic
952831880 3:37571797-37571819 AGGTGGCAGGGGAGCATGGAAGG + Intronic
953132628 3:40155132-40155154 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
953271174 3:41446727-41446749 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
953541035 3:43818398-43818420 AGATATAAGTGGAGGCTGGAAGG - Intergenic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954411847 3:50374318-50374340 AGGAGAAAGGGGAGGGTAGGGGG + Intronic
954449361 3:50563363-50563385 GGGTCTCAGGGGAGGGAGGAGGG - Intronic
954750579 3:52811224-52811246 AGGTGGAAGGGGAGGGGGACCGG - Intergenic
955051318 3:55413972-55413994 AGGTGGATGGCAAGGGTGGATGG + Intergenic
955653248 3:61216994-61217016 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
955710693 3:61775927-61775949 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
956243277 3:67153638-67153660 CGGGGTAGGGGGAGGGGGGAGGG + Intergenic
956298606 3:67743272-67743294 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
957084466 3:75667730-75667752 AGGTGGGGGGGGAGGGAGGAAGG + Intergenic
957123291 3:76124986-76125008 AGGTGGAAGGAGGGGGTGAATGG - Intronic
957485805 3:80861432-80861454 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
957696109 3:83639555-83639577 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958059741 3:88464163-88464185 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
958089210 3:88854611-88854633 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
958536030 3:95404751-95404773 GGGTGGAAGGGGAGGGTTGGAGG + Intergenic
958717352 3:97801856-97801878 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
958725790 3:97904879-97904901 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
958854100 3:99363394-99363416 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
959078673 3:101778119-101778141 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
959773164 3:110124351-110124373 AGGTGAAAAGGGAGGTAGGAGGG + Intergenic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959951855 3:112188376-112188398 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
959954286 3:112217205-112217227 TGGGGTGAGGGGAGGGGGGAAGG + Intronic
959992366 3:112643486-112643508 AGGGGTTGGGGGAGGGTGGTGGG + Intronic
960128286 3:114024700-114024722 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
960231131 3:115228933-115228955 AGGTGTCACAGGAGAGTGGAAGG + Intergenic
960403895 3:117236432-117236454 GGGTGTTGGGAGAGGGTGGAAGG - Intergenic
960731492 3:120732704-120732726 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
960953185 3:123012752-123012774 AGGAGGAAGAGGAGGGGGGAAGG - Intronic
961431465 3:126886910-126886932 AGGGGTGAAGGGAGGGTGGAAGG - Intronic
961463111 3:127065545-127065567 AGGAGGAAGGGGAGGGCCGAGGG - Intergenic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961542637 3:127610443-127610465 AGGCTTCAGGGGAAGGTGGATGG - Intronic
961572096 3:127806479-127806501 GGATGTATGGGGTGGGTGGATGG + Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961739288 3:129022658-129022680 GGGTGTGAGGGGAGGGTGGGTGG + Intronic
961786092 3:129347754-129347776 GGGGGTCAGGGGAGGGTTGACGG + Intergenic
961940852 3:130636737-130636759 AGGAGGAAGGGGAGGGGGAAGGG - Intronic
961992148 3:131203429-131203451 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
962549840 3:136479218-136479240 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
962763765 3:138542592-138542614 AGGTGCCAGTGGAGGGTGGGAGG + Intronic
962774537 3:138647012-138647034 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
963025878 3:140918094-140918116 AGGTGTAAGGCAAGGGTGGAGGG + Intergenic
963060706 3:141222492-141222514 AGGTATGATGGGAGGGAGGAAGG + Intergenic
963664892 3:148170309-148170331 AAGTATAAGAGGAGGGTGTATGG + Intergenic
963839152 3:150087281-150087303 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
964189293 3:153983539-153983561 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
964476386 3:157101368-157101390 AGGTGGAAGGCTAGGGAGGAAGG - Intergenic
964552735 3:157902680-157902702 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
965037972 3:163467322-163467344 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
965171121 3:165265691-165265713 AGGGGTGAAGGGAGGGGGGAGGG - Intergenic
965316959 3:167204382-167204404 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
965343264 3:167516240-167516262 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
965343409 3:167517875-167517897 TGGGGTTGGGGGAGGGTGGAGGG - Intronic
965373891 3:167897614-167897636 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965373905 3:167897638-167897660 AGGAGGGAGGGGAGGGGGGAGGG + Intergenic
965731288 3:171774791-171774813 AGGAGGAAGGGCAGGGTGGTGGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
966010565 3:175070012-175070034 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
966053587 3:175653204-175653226 AGATGGAAGGGGAGGAAGGAAGG + Intronic
966437851 3:179908609-179908631 TGGAGTAGGGGGAGGGGGGAGGG - Intronic
966582623 3:181585561-181585583 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
966655043 3:182346615-182346637 TGGGGTTAGGGGAGGGGGGAGGG + Intergenic
966947294 3:184785775-184785797 AGGTGGAAGGTGTGGGTGCAGGG + Intergenic
967036417 3:185651727-185651749 AGGTGTAAGGGGAAGTAGCATGG - Intronic
967065284 3:185909914-185909936 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
967288426 3:187896066-187896088 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
967443785 3:189540728-189540750 AGGAGCAAGGTGAGGGGGGAAGG - Intergenic
967680941 3:192363089-192363111 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
967736682 3:192960443-192960465 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1202742753 3_GL000221v1_random:71206-71228 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
968535507 4:1125487-1125509 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
968741730 4:2334743-2334765 AGGGGGAAGGGGAGGGGGAAGGG - Intronic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
969046312 4:4339226-4339248 AGGGGTATGGGGGGGGTGCATGG - Intergenic
969204040 4:5629030-5629052 AGGTGGAAAGGGAGCGTGCATGG - Intronic
969223467 4:5777979-5778001 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
969383271 4:6822919-6822941 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
969543178 4:7806689-7806711 AGGGGAAAGGGGAGAGGGGAGGG - Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969783775 4:9435248-9435270 TGGGGTAATGGGAGGGGGGAGGG - Intergenic
969971324 4:11051422-11051444 AGGTGCGAGGGCAGGGAGGAAGG - Intergenic
970032707 4:11695126-11695148 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
970085443 4:12340796-12340818 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
970171433 4:13295005-13295027 AGGAGAAAGGGGAGGGTGAGAGG - Intergenic
970401508 4:15721656-15721678 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
970572043 4:17392879-17392901 AGAAGGAAGGAGAGGGTGGAAGG + Intergenic
970572047 4:17392892-17392914 GGGTGGAAGGAGAGGGTGGAAGG + Intergenic
970717059 4:18938736-18938758 TGGTGGAAGGTGGGGGTGGAAGG - Intergenic
971506831 4:27375830-27375852 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971573310 4:28241824-28241846 AGGTGTAAGGGAAGGGGAGAAGG - Intergenic
971706449 4:30049240-30049262 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
971890626 4:32516977-32516999 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
971949626 4:33327945-33327967 AGGTGTTTGGTGAGGGTGGTGGG - Intergenic
971958825 4:33457779-33457801 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
971965973 4:33556968-33556990 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
972121979 4:35714571-35714593 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
972147324 4:36043842-36043864 AGGGGGGAGGGGAGGGGGGAGGG + Intronic
972686165 4:41355456-41355478 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
972845288 4:42982196-42982218 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
972892637 4:43577426-43577448 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
972902000 4:43696605-43696627 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
973060912 4:45722903-45722925 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
973087035 4:46077150-46077172 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
973554635 4:52070534-52070556 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
974114346 4:57562458-57562480 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
974131873 4:57766983-57767005 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
974266535 4:59592858-59592880 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
974342793 4:60636099-60636121 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
974427008 4:61754760-61754782 TGGTGTGGGGGGAGGGGGGAAGG - Intronic
974861919 4:67532747-67532769 GGGGGTAGGGGGAGGGGGGAAGG + Intronic
975062721 4:70022459-70022481 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
975079551 4:70259671-70259693 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975340039 4:73229133-73229155 TGGGGTAGGGGGAGGGAGGAGGG + Intronic
975411077 4:74050519-74050541 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
975505527 4:75132675-75132697 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
975829461 4:78353848-78353870 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
975955921 4:79838376-79838398 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
975962799 4:79933692-79933714 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
976222484 4:82768853-82768875 AGGTGTAGTGTGAAGGTGGAAGG + Intronic
976323344 4:83742276-83742298 AGGTGTAAGGGAAATGAGGATGG - Intergenic
976346190 4:84004385-84004407 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
976352724 4:84078357-84078379 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
976357269 4:84132651-84132673 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
976533403 4:86183280-86183302 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
976879535 4:89902176-89902198 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
977175286 4:93812661-93812683 AGGGGTGAGGGAAGGGTTGATGG - Intergenic
977353858 4:95920625-95920647 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
977519446 4:98062293-98062315 AGTTGTAGGTGGAGGGTGGGAGG + Intronic
977589101 4:98806897-98806919 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
978021890 4:103824697-103824719 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
978022050 4:103826579-103826601 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
978364135 4:107962665-107962687 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
979112276 4:116775185-116775207 TGGGGTTAGGGGAGGGGGGAGGG - Intergenic
979141002 4:117174500-117174522 AGGTGGAAGGAGAGAGGGGAGGG + Intergenic
979224378 4:118267043-118267065 AGGAGTCAGGGAAGGGAGGAAGG - Intergenic
979445780 4:120809243-120809265 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
980333240 4:131436516-131436538 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
980390198 4:132134726-132134748 TGGGGTAGGGGGAGTGTGGAGGG + Intergenic
980399392 4:132259990-132260012 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
980510940 4:133786800-133786822 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980791950 4:137631971-137631993 AGGAGGAAGTGGTGGGTGGAGGG - Intergenic
981027140 4:140088201-140088223 AAGTGTGATGGGAGGGAGGAAGG + Intronic
981086541 4:140689655-140689677 AGGAGAAAGGGGAGGGGGGAAGG - Intronic
981235082 4:142406124-142406146 AGGTGGGAGGCGAGGGTGGCGGG - Intronic
981284284 4:142996887-142996909 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
981408350 4:144397528-144397550 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
981481899 4:145247349-145247371 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG + Intergenic
981680011 4:147386577-147386599 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
981829963 4:148988062-148988084 AGTTGGAAGGGGTGGGTGGAAGG + Intergenic
981975379 4:150722100-150722122 TGTTCTGAGGGGAGGGTGGAAGG - Intronic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
982156013 4:152521638-152521660 AGAAATAAGGGGACGGTGGAAGG + Intronic
982383189 4:154771912-154771934 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
982500538 4:156149884-156149906 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
982760439 4:159277064-159277086 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
982816494 4:159891948-159891970 AGGAGCAAGGGAAGGGGGGAAGG - Intergenic
982835962 4:160120356-160120378 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
983137854 4:164106616-164106638 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
983278175 4:165644172-165644194 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
983315411 4:166126881-166126903 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984201385 4:176724913-176724935 AGGGGCAAGGGTAGGGAGGATGG + Intronic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
984766937 4:183406877-183406899 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
984780625 4:183522891-183522913 AGGTGGAAGGGTAGGAAGGAGGG - Intergenic
984921742 4:184770556-184770578 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
985054621 4:186025590-186025612 GAGTGTGAGAGGAGGGTGGATGG + Intergenic
985086485 4:186318205-186318227 AGGTGGAAGGAAAGGATGGATGG + Intergenic
985234188 4:187854944-187854966 GGGTGTAAGGGGAGGGGAAATGG + Intergenic
985575917 5:673452-673474 AGGTGAATGGGGAGGGGGGGAGG + Intronic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986015200 5:3751542-3751564 GGGTGAGAAGGGAGGGTGGAGGG + Intergenic
986033038 5:3910921-3910943 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
986105774 5:4658116-4658138 AGGCAGAAGGGGAGGATGGAGGG - Intergenic
986357688 5:6944771-6944793 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
986373673 5:7107560-7107582 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
986471915 5:8084357-8084379 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
986813349 5:11383021-11383043 AGAGGTTAGGGGAGGGTGAATGG - Intronic
986848995 5:11788819-11788841 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
986970040 5:13322759-13322781 AGGTGAAGGGGGCTGGTGGATGG - Intergenic
987781122 5:22436269-22436291 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
987959016 5:24779947-24779969 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
987990662 5:25207396-25207418 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
988178196 5:27754701-27754723 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
988305605 5:29490159-29490181 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
988314426 5:29604486-29604508 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
988333948 5:29880518-29880540 AGGGTTGAGGGTAGGGTGGATGG - Intergenic
988397298 5:30710907-30710929 TGGGGTACGGGGAGGGGGGAGGG + Intergenic
988646012 5:33096045-33096067 TGGGGTAAGGGGAGCGGGGAGGG - Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
989158973 5:38371935-38371957 AGTTCCATGGGGAGGGTGGATGG - Intronic
989194934 5:38707442-38707464 GGGTGAAAGGGGAGGTGGGAGGG - Intergenic
989227034 5:39040317-39040339 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
989284392 5:39682656-39682678 TGGGGTGAGGGGAGGGAGGAGGG - Intergenic
989485158 5:41981890-41981912 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
989616976 5:43346825-43346847 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
989661006 5:43797615-43797637 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
989804609 5:45587549-45587571 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
990065077 5:51702078-51702100 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
990456188 5:55990880-55990902 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
990482710 5:56227338-56227360 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
990676697 5:58194428-58194450 AGGGGGAGGGGGAGGGGGGAGGG + Intergenic
990929112 5:61067300-61067322 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
990934206 5:61129642-61129664 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
991160377 5:63492083-63492105 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
991170071 5:63614615-63614637 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
991231454 5:64337647-64337669 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
991445578 5:66696468-66696490 GGGTGAAAGGTGAGGGAGGAAGG - Intronic
991490036 5:67173718-67173740 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
991541665 5:67737041-67737063 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
991693165 5:69245292-69245314 AGGGGGAAGGGGAGGGGGAAGGG - Intronic
992067164 5:73119594-73119616 AGGGGTCAGGGCACGGTGGAAGG - Intergenic
992208114 5:74450976-74450998 AGCTGTAGAGGGAGTGTGGAAGG + Intergenic
992461691 5:76966464-76966486 TGGTGGAAGGGGAGGGTTGTAGG + Intronic
992485790 5:77193336-77193358 TGGTGTAAAGTAAGGGTGGAAGG + Intergenic
992632269 5:78693058-78693080 AGATCTTAGGGAAGGGTGGAAGG + Intronic
992639252 5:78754363-78754385 AGGTGGAATGGGTGGGGGGAAGG - Intronic
992772634 5:80062675-80062697 TGGGGTAGGGGGAGGGGGGAAGG - Intronic
992821171 5:80497793-80497815 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
993204587 5:84863344-84863366 AGGGGGGAGGGGAGGGAGGAAGG - Intergenic
993204634 5:84863465-84863487 AGAGGGAAGGGGAGGGAGGAAGG - Intergenic
993212731 5:84975536-84975558 TGGGGTAGGGGGAGGGTGGAGGG - Intergenic
993229940 5:85221957-85221979 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
993296344 5:86146385-86146407 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
993374628 5:87135646-87135668 AGGGGAGAGGGGAGGGAGGAGGG + Intergenic
993398033 5:87414920-87414942 AGGTGTGGGTGGAGGGTAGAAGG - Intergenic
993462750 5:88204583-88204605 AGCTGAAAAGGGTGGGTGGAGGG - Intronic
993659815 5:90619742-90619764 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
993926339 5:93870733-93870755 GGGTGGAAGTGGAGGTTGGAGGG + Intronic
994417241 5:99487426-99487448 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
994825002 5:104702022-104702044 TGGAGTAGGGGGAGGGGGGAGGG - Intergenic
994843804 5:104959220-104959242 AGGGGTAAGGGGAGGGATAAGGG + Intergenic
994951643 5:106471020-106471042 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
995276015 5:110278806-110278828 TGGGGTATGGGGAGGGGGGAGGG - Intergenic
995508800 5:112887205-112887227 ATGGGTAACAGGAGGGTGGAGGG + Intronic
995881402 5:116848232-116848254 AGGTTGAAGGAGAGGCTGGAAGG - Intergenic
996171131 5:120293178-120293200 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
996364519 5:122686537-122686559 CGGGGTCAGGGGAGGGGGGAGGG + Intergenic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996434658 5:123421596-123421618 AGGTTTGAGGGTAGGGTGGGTGG - Intronic
996630601 5:125626782-125626804 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
996790638 5:127290224-127290246 AGGTGAAGGCAGAGGGTGGAGGG - Intergenic
997008384 5:129847873-129847895 AGGTGAAAGGGGATGGTAAAAGG - Intergenic
997095440 5:130905436-130905458 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
997112775 5:131093155-131093177 AGGGGTGTGGGGAGGGGGGAGGG + Intergenic
997597851 5:135119067-135119089 AGGTGTTAGGGCAGGGCTGAGGG + Intronic
997703568 5:135925256-135925278 GGGTGGGATGGGAGGGTGGAGGG - Intronic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
997805423 5:136912705-136912727 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
997966268 5:138358934-138358956 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
998188947 5:140005842-140005864 AGGGTTCAGGGGAGGGTGCAGGG + Intronic
998234165 5:140383504-140383526 AGGAGGAAGTGGAGGGTGGAGGG + Intergenic
998405473 5:141872122-141872144 AGGTGGAGGGGGGGGGTGGGGGG - Intronic
998487465 5:142515729-142515751 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
998710829 5:144823485-144823507 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
998916248 5:147014734-147014756 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
998922927 5:147089709-147089731 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
999295860 5:150459065-150459087 AGGTACACGTGGAGGGTGGAGGG + Intergenic
999319275 5:150603342-150603364 AGGTGCACTGGGAGGGTGCAAGG + Intronic
999415257 5:151389551-151389573 AGGGGTCGGGGGAGGGGGGAGGG - Intergenic
999572790 5:152939644-152939666 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
999692690 5:154162385-154162407 AGGAGAAAAGGAAGGGTGGAAGG + Intronic
999814004 5:155157735-155157757 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
999972996 5:156883589-156883611 TGGTGTAAGGGGCAGGTGAAGGG - Intergenic
1000020091 5:157311096-157311118 AGGTAGAGGGGGTGGGTGGAGGG + Intronic
1000542110 5:162553130-162553152 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1000612967 5:163395429-163395451 AGGGGGAAGGGGTGGGAGGAGGG + Intergenic
1000752460 5:165113876-165113898 AGGTGGAAGGGGAGCCTGGAGGG - Intergenic
1001025903 5:168224343-168224365 AGGTGTTGGGGGAGAGAGGAGGG - Intronic
1001071841 5:168592688-168592710 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1001292982 5:170477997-170478019 AGGTGTCAGGGGAGGGTTCATGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001863848 5:175085435-175085457 AGGGGTAGAGGGAGGGGGGAGGG - Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466948 5:179412670-179412692 TGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002467057 5:179412921-179412943 AGGTCGGGGGGGAGGGTGGAAGG - Intergenic
1002674812 5:180902666-180902688 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1002870261 6:1160812-1160834 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1003186393 6:3835143-3835165 TTGTGTTAGGGCAGGGTGGAAGG + Intergenic
1003355537 6:5366017-5366039 AGGCGGAAGGGGAGGCAGGAAGG + Intronic
1003406753 6:5832552-5832574 AGGAGGAAGAGGAGGGGGGAGGG + Intergenic
1003491732 6:6628251-6628273 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
1004311903 6:14553386-14553408 AGGGGTCAGGGGTGGGGGGATGG + Intergenic
1004627446 6:17390199-17390221 AGGAGCAAGGGGAGGAGGGAGGG - Intergenic
1005173456 6:23015061-23015083 AGGAGGAAGTGGAAGGTGGAAGG + Intergenic
1005804566 6:29462244-29462266 AAGGGCAAGTGGAGGGTGGATGG - Exonic
1005821774 6:29604752-29604774 AGGAGTGAGAGGAGGGTGAACGG + Intronic
1006054495 6:31373354-31373376 TGGTGGCAGGGGAGAGTGGAAGG + Intergenic
1006369623 6:33635832-33635854 AGGGGTGAGGGGAAGGGGGATGG + Intronic
1006369739 6:33636525-33636547 AGGTGTGAGGTGTGAGTGGAAGG + Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006806446 6:36792538-36792560 ATGTGTCACGGGAGGGAGGAAGG + Intronic
1006861962 6:37177754-37177776 AGTTTTAGGGGGAGGGTGAAAGG + Intergenic
1006945046 6:37779307-37779329 AGGGAAAAGGGTAGGGTGGAGGG + Intergenic
1006988444 6:38192905-38192927 AGGGGTGGGGGGAGGGGGGAGGG + Intronic
1007265878 6:40595534-40595556 AGCTGTGAAAGGAGGGTGGAAGG + Intergenic
1007816069 6:44526331-44526353 AGGTTTCAGGGGAGGCTGGGTGG + Intergenic
1008403109 6:51087440-51087462 AGCTTTAAGGTGAGGGTGGCTGG + Intergenic
1008464416 6:51814708-51814730 AGGTGGAAGGTGTGGGAGGAGGG + Intronic
1008529726 6:52445440-52445462 CGGGGTAGGGGGAGGGGGGAGGG - Intronic
1008862753 6:56169751-56169773 AAGTGTTAGTGGAGTGTGGATGG - Intronic
1008978051 6:57451923-57451945 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1009293565 6:61914509-61914531 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1009372853 6:62929162-62929184 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1009384322 6:63070418-63070440 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1009398106 6:63226115-63226137 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1009429629 6:63551677-63551699 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1009486830 6:64235230-64235252 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1009675477 6:66814011-66814033 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1009731899 6:67619910-67619932 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1009751991 6:67886640-67886662 AGATGAAAGGGGAGGTTGGAGGG + Intergenic
1009844945 6:69122469-69122491 AGGGGGAGGGGGAGGGGGGAGGG + Intronic
1009874340 6:69486191-69486213 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1009949336 6:70377848-70377870 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1010271773 6:73923507-73923529 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1010289538 6:74119575-74119597 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1010301137 6:74261691-74261713 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1010331659 6:74630130-74630152 AGGTGTTTGGGGAGGGAGGGAGG - Intergenic
1010392430 6:75353056-75353078 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1010485167 6:76402538-76402560 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1010669108 6:78665787-78665809 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1010884844 6:81223462-81223484 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1011065244 6:83319153-83319175 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1011119177 6:83931941-83931963 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1011282920 6:85694938-85694960 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1011331537 6:86212628-86212650 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1011471189 6:87709418-87709440 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1011474405 6:87736866-87736888 AGGGGGAGGGGGAGGGGGGAGGG + Intergenic
1011598951 6:89042139-89042161 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1011632371 6:89339616-89339638 AGGGGGAAGGGGAGGAGGGAAGG + Intronic
1011718744 6:90133682-90133704 TGGGGTGTGGGGAGGGTGGAGGG - Intronic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012528161 6:100202327-100202349 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1012613432 6:101246118-101246140 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1012682695 6:102203054-102203076 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1012692706 6:102334914-102334936 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1012862003 6:104571259-104571281 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1013088219 6:106874956-106874978 AGAAGTAAGGGCAGGGTGGAGGG + Intergenic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1013246173 6:108289548-108289570 GGGTGTAAGGTGAGAGTGAATGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013486505 6:110601446-110601468 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1014091539 6:117409064-117409086 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1014091680 6:117411275-117411297 AGGTGAAAGGAGTGGGGGGATGG - Intronic
1014380112 6:120729312-120729334 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1014424845 6:121290999-121291021 TGGGGTTGGGGGAGGGTGGATGG + Intronic
1014649799 6:124022035-124022057 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1014660521 6:124165657-124165679 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1014664608 6:124221406-124221428 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1014713278 6:124834254-124834276 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1015050636 6:128835462-128835484 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1015163966 6:130182625-130182647 AGGAGGGAGGGGAGGGAGGAAGG + Intronic
1015197959 6:130544594-130544616 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1015335776 6:132036365-132036387 AAGTGAAAGGCGAGTGTGGAGGG + Intergenic
1015420665 6:133004263-133004285 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1015631566 6:135236900-135236922 AGGTGTTAGGAGAGGCAGGAAGG - Intergenic
1016335324 6:142998763-142998785 TGGTGTGGGGGGAGGGAGGATGG - Intergenic
1016440932 6:144082625-144082647 GGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1016792364 6:148079160-148079182 AGGTAGAAGGGGAGTGAGGAAGG + Intergenic
1017084525 6:150701595-150701617 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1017299851 6:152844410-152844432 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1017306457 6:152923731-152923753 TGGAGTAGGGGGAGGGGGGAGGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017645964 6:156540442-156540464 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1017694900 6:157004728-157004750 CGGTGTTAGGGGAGGGTGTTGGG + Intronic
1017754551 6:157518388-157518410 AGGGGTGGGGGGAGGGTGGAAGG + Intronic
1017981410 6:159403594-159403616 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1017997696 6:159547354-159547376 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1018461677 6:164004711-164004733 AGGGGGAGGGGGAGGGGGGATGG + Intergenic
1018793905 6:167171474-167171496 AGGTGTGAGGGGAATGTGAATGG - Intronic
1018837902 6:167498812-167498834 AGGTCAGTGGGGAGGGTGGATGG - Intergenic
1019097769 6:169599129-169599151 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1019160917 6:170066459-170066481 AGATGGAAGGATAGGGTGGATGG - Intergenic
1019438579 7:1034766-1034788 AGGAGGAAAAGGAGGGTGGAGGG - Intronic
1019563714 7:1669871-1669893 AGGTGGAGGGGGTGGGTGGGTGG - Intergenic
1019753502 7:2749511-2749533 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1019880046 7:3850858-3850880 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1019891901 7:3954231-3954253 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891965 7:3954411-3954433 AGGCAGGAGGGGAGGGTGGAGGG - Intronic
1019891991 7:3954475-3954497 AGGGGAGGGGGGAGGGTGGAGGG - Intronic
1020719512 7:11723325-11723347 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1020905828 7:14062983-14063005 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1020925536 7:14319137-14319159 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1021320169 7:19199688-19199710 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1021389460 7:20073787-20073809 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1021398563 7:20182191-20182213 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1021430739 7:20555959-20555981 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1021741204 7:23687273-23687295 AGGTGGAAGGGCAGGTTAGAAGG + Intronic
1022119216 7:27291234-27291256 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022449577 7:30502750-30502772 TGGTGGCAGGGCAGGGTGGATGG - Intronic
1022525208 7:31032715-31032737 ATGTGTAAGGGAAGGGAAGAAGG + Intergenic
1022634359 7:32118117-32118139 AGGGCTAAGGAGAGAGTGGAGGG + Intronic
1022655920 7:32319299-32319321 AGGGGCAGGGGCAGGGTGGAAGG - Intergenic
1022677286 7:32511776-32511798 AGGAGTAAGGGGAGGAAGAAGGG + Intronic
1022694974 7:32696105-32696127 TGGAGTGAGGGGAGGGGGGAGGG - Intergenic
1023050132 7:36243897-36243919 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1023165288 7:37337376-37337398 TGGGGTAAGGGAAGGGGGGAGGG + Intronic
1023193765 7:37612194-37612216 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1023346503 7:39276902-39276924 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1023419262 7:39961777-39961799 TGGGGTAGGGGGAGGGAGGAGGG - Intronic
1023421220 7:39982156-39982178 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1023454195 7:40320923-40320945 AGGTGGAAGGGGAGTGAGGGAGG - Intronic
1023533115 7:41180075-41180097 TGGGGTAGGGGGAGGGGGGAAGG - Intergenic
1023718148 7:43064954-43064976 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1023890093 7:44385851-44385873 AGATGCAAGGTCAGGGTGGAAGG + Exonic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023996688 7:45162884-45162906 AGGAGTAAGGGCATGGGGGATGG - Intronic
1024479923 7:49852613-49852635 AGGAGTGAGGGGTGGGTGCAAGG + Intronic
1024626927 7:51215830-51215852 AGGTGCAAGGGAAGGGAGGCTGG - Intronic
1024920127 7:54546219-54546241 AGGGGAATGGGGAGTGTGGAGGG + Intronic
1025115088 7:56250838-56250860 AGTTGAGAGGTGAGGGTGGAGGG + Intergenic
1025183584 7:56838555-56838577 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1025574356 7:62617036-62617058 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1025582390 7:62736937-62736959 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1025673199 7:63627374-63627396 AGGTAGAAGGGGAGGGAGGAGGG + Intergenic
1025688341 7:63738431-63738453 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1025762414 7:64406981-64407003 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1025922656 7:65927934-65927956 GGGTGAAAGGGGAGGCAGGAAGG + Intronic
1026148891 7:67771662-67771684 AGGGGAGAGGGCAGGGTGGACGG - Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027542470 7:79485116-79485138 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1027566940 7:79807039-79807061 AGGTGGGGGGGGAGGGGGGAGGG - Intergenic
1027730401 7:81864635-81864657 CGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1027770616 7:82401556-82401578 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1027884735 7:83890367-83890389 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1028036710 7:85992831-85992853 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1028042778 7:86076421-86076443 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1028068185 7:86414377-86414399 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1028241563 7:88427237-88427259 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1028622093 7:92836361-92836383 TGGGGTAAGTGGAGGGTGGCGGG - Intronic
1028840876 7:95429174-95429196 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1029020215 7:97357234-97357256 AGGAGTGGGGGGAAGGTGGAAGG + Intergenic
1029057967 7:97766396-97766418 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1029418864 7:100461618-100461640 GGTTGTTAGGGGAAGGTGGAGGG - Intronic
1029827170 7:103209807-103209829 TGGGGTAGGGGGAGGGGGGACGG + Intergenic
1029953598 7:104613602-104613624 AGGGGTGAGTGGAGGGTAGATGG - Intronic
1030449131 7:109687274-109687296 TGGGGTAGGTGGAGGGTGGAGGG - Intergenic
1030626219 7:111848833-111848855 TGGTGGAAGGGGAGGGTTGTAGG - Intronic
1030997600 7:116377227-116377249 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1031826090 7:126567408-126567430 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1031892543 7:127311390-127311412 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1032005366 7:128297987-128298009 AGGGGTGGGGGGAGGGGGGAGGG + Exonic
1032129711 7:129218086-129218108 AGGTGTAAGAGGATGTGGGATGG - Intergenic
1032274762 7:130444923-130444945 AGGTCTGAGGGGAGGGTGTTGGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1032939295 7:136770025-136770047 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1032943350 7:136821827-136821849 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1033597054 7:142865870-142865892 AGGAGCCAGGGGAGGGTGGGTGG - Intronic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033917984 7:146351029-146351051 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1034208303 7:149339009-149339031 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034490833 7:151392335-151392357 AGGAGTCAGTGGTGGGTGGATGG - Intronic
1034982902 7:155489946-155489968 AGGTGGAAGGGCAGGTGGGAGGG + Intronic
1035025071 7:155819908-155819930 TTGGGTAAGGGGAGGGAGGAGGG + Intergenic
1035293172 7:157853027-157853049 GGGTGAATGGGGAGGGTGGATGG + Intronic
1035435850 7:158858824-158858846 AGGGGAAAGGGGAGGGGGGAGGG - Intronic
1035552984 8:544581-544603 AGGTGGAGGGCGAGGGTGGGCGG - Intronic
1035711628 8:1720835-1720857 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1035722024 8:1799257-1799279 AGGGGGAGGGGGAGGGGGGAGGG - Intergenic
1035861339 8:3031314-3031336 TGGGGTGGGGGGAGGGTGGAGGG + Intronic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1035971900 8:4258377-4258399 AGGAGGGAGGGGAGGATGGAAGG + Intronic
1036293760 8:7518288-7518310 AGGGGTGCGGGCAGGGTGGAGGG - Intergenic
1036328801 8:7802707-7802729 AGGGGTGCGGGCAGGGTGGAGGG + Intergenic
1037194999 8:16178245-16178267 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1037628425 8:20629297-20629319 AGGGTTCAGGGGAGGTTGGAAGG + Intergenic
1037652534 8:20851901-20851923 AGGGGAAAGGGGAAGATGGAGGG + Intergenic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1038251683 8:25911042-25911064 TGGTGGATGGAGAGGGTGGAGGG - Intronic
1038571659 8:28667712-28667734 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1038584524 8:28777156-28777178 AGGAGTGAGATGAGGGTGGAGGG - Intronic
1038721196 8:30037078-30037100 TGGAGTCAGGGGAGGGAGGATGG - Intergenic
1038761042 8:30384482-30384504 AGGGGAGAGGGGAGGGAGGAAGG + Intronic
1038882753 8:31632678-31632700 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1039090378 8:33821973-33821995 ACCTGTAGGGGGAGGGTGGGAGG - Intergenic
1039232854 8:35467726-35467748 AGATGTTGGGGTAGGGTGGAGGG + Intronic
1039458932 8:37727318-37727340 AGGAGGAGGGGAAGGGTGGAGGG + Intergenic
1039862807 8:41473559-41473581 AGGAGCAAGGGCGGGGTGGAGGG + Intergenic
1040631871 8:49223678-49223700 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1040730056 8:50434030-50434052 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1040738785 8:50546523-50546545 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1041846143 8:62331033-62331055 AGGTAGAAGAGGAGGGAGGAAGG - Intronic
1041846154 8:62331126-62331148 GGGTGGAAGAGGAGGGAGGAAGG - Intronic
1041881833 8:62760626-62760648 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1042020549 8:64369305-64369327 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1042034841 8:64521442-64521464 AGGTTCAGGGGGAGGGTGCAAGG + Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042281922 8:67064552-67064574 TGGTGTAGGTTGAGGGTGGAGGG + Intronic
1042713109 8:71741657-71741679 TGGGGTAGGGGGAGGGGGGACGG - Intergenic
1042713719 8:71748061-71748083 TGGTGATTGGGGAGGGTGGAGGG - Intergenic
1042864507 8:73345517-73345539 ATGTGTTAGGGGTGGGAGGAGGG - Intergenic
1042999821 8:74744466-74744488 TGGGGTAGGGGGAGGGGGGACGG - Intronic
1043178205 8:77048142-77048164 GGGAGAAAGGGGAGGGGGGAGGG + Intergenic
1043260691 8:78192102-78192124 TGGGGTTGGGGGAGGGTGGACGG - Intergenic
1043379528 8:79687704-79687726 AGGTGGAGGTGGAGGGTGGTTGG + Intergenic
1044098595 8:88100977-88100999 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1044109207 8:88250918-88250940 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1044219777 8:89656535-89656557 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1044316290 8:90752697-90752719 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1044322216 8:90815551-90815573 AGGAGTTTGGGGAGGTTGGAGGG - Intronic
1044493335 8:92846901-92846923 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1044715134 8:95093116-95093138 GAGTGTAAGGGGTGGGTGGGAGG + Intronic
1045080499 8:98620316-98620338 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1045159322 8:99519801-99519823 TGGGGTGGGGGGAGGGTGGATGG + Intronic
1045290001 8:100824966-100824988 AGGTGGAAGGGGAAGGATGAAGG - Intergenic
1045477923 8:102569059-102569081 AGATGTAAAGGGAGCCTGGAAGG - Intergenic
1045662544 8:104453034-104453056 AGCTGTTGGGGGAGGGTGGTGGG - Intronic
1045669143 8:104527682-104527704 TGGGGTAAGGGGAGCGAGGAGGG + Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1045973876 8:108109524-108109546 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1046009364 8:108527855-108527877 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1046259472 8:111747734-111747756 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1046787750 8:118286167-118286189 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1046835907 8:118800933-118800955 TGGGGTAGGGGGAGGGGGGAAGG + Intergenic
1047200207 8:122758940-122758962 GGGGGTAAGGGGAGCGGGGAGGG - Intergenic
1047317340 8:123746537-123746559 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1047474663 8:125215182-125215204 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1047530425 8:125669308-125669330 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1047722360 8:127653025-127653047 AGGTGTTGGGGAATGGTGGAAGG - Intergenic
1048227417 8:132601772-132601794 TGGGGTGCGGGGAGGGTGGAGGG + Intronic
1048311347 8:133324694-133324716 AGCTGTCGGGGGAGGTTGGAGGG - Intergenic
1048400750 8:134066997-134067019 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1048435926 8:134417423-134417445 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1048581383 8:135732145-135732167 AGGTGGAGGCGGAGGCTGGACGG - Intergenic
1048596789 8:135875106-135875128 AGATGTAGGGAGAGGTTGGATGG + Intergenic
1048699462 8:137071677-137071699 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1048986101 8:139735912-139735934 AGGTGTGAGGCCAGGGTGGTAGG + Intronic
1049153822 8:141055137-141055159 TGGTGGAAGGGGAGTGTGGAAGG - Intergenic
1049575281 8:143386972-143386994 TGGTGGAAGGGGACGGTGGTTGG - Intergenic
1049712403 8:144071244-144071266 AGGGGAGAGGGGAGGGGGGAGGG - Intergenic
1049844545 8:144793485-144793507 AGGAGACAGGAGAGGGTGGAAGG + Intergenic
1049882634 8:145077054-145077076 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1050174404 9:2854847-2854869 AGGTGGAAGTGGGGGGTGGGAGG + Intergenic
1050218196 9:3353197-3353219 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1050253704 9:3772268-3772290 AGGTGGAAGAGGAGGTGGGAAGG + Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1050573185 9:6964230-6964252 GGGGGTCAGGGGAGGGGGGAGGG - Intronic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1050805751 9:9676267-9676289 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1051002957 9:12307401-12307423 CGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1051111580 9:13644041-13644063 AGGGGTAAGAGCAGGATGGAAGG + Intergenic
1051329247 9:16006572-16006594 TGGGGTGAGGGGAGGGGGGAGGG - Intronic
1051489706 9:17647912-17647934 AGGTGGAAGAGGAAGGTGGGGGG - Intronic
1051538094 9:18182138-18182160 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1051567528 9:18517559-18517581 TGGTGTGGGGGGAGGGGGGAGGG - Intronic
1051939057 9:22482440-22482462 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1052123685 9:24750563-24750585 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1052219009 9:25997537-25997559 AGATGAAAGGGGAGGTTGCAAGG - Intergenic
1052475722 9:28956706-28956728 AGGAGGCAGGGGAGGGAGGAGGG - Intergenic
1052536595 9:29755698-29755720 AGGTGCAAGGGGCAGGTGGGTGG + Intergenic
1052951936 9:34219993-34220015 AGGGGTAGGGGGAGGTGGGAGGG - Intronic
1053103712 9:35392642-35392664 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1053140345 9:35678926-35678948 AGGTGGGAGGGAAGGGAGGAAGG - Intronic
1053337276 9:37286908-37286930 AGGTGGGAGGGGAGGGAGGGAGG - Intronic
1053750909 9:41253903-41253925 AGGGGTAGGGGGATGGGGGAGGG - Intergenic
1055193129 9:73552349-73552371 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1055378888 9:75684647-75684669 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1055408997 9:76007557-76007579 GGGTGTGAGAGGAGGGTAGATGG + Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1055642775 9:78333432-78333454 AGCTCTAAGAGGAGGGAGGAGGG - Intergenic
1055849569 9:80610108-80610130 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1056048899 9:82747336-82747358 AGGTAGAAGGGGAGGGTGAAAGG + Intergenic
1056247958 9:84717020-84717042 AGGTGGAAGGGTAGAGGGGAAGG + Intronic
1056685030 9:88752306-88752328 AGGTGGAAGTGGAGGCTCGAGGG - Intergenic
1057023674 9:91719742-91719764 ACTTGTAGGGGGAGGGTGGAGGG + Intronic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057182576 9:93037993-93038015 GGGAGAAAGGGGAGGGAGGATGG - Intergenic
1057500983 9:95596532-95596554 AGGTTCAAGGGGAGGGGGTATGG + Intergenic
1057523417 9:95778671-95778693 AGGAGGAAAGGGAGGGAGGAAGG - Intergenic
1057819566 9:98320828-98320850 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1057833167 9:98422752-98422774 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1057937661 9:99254230-99254252 AGGAGAATGGGGAGGGTGGGTGG - Intergenic
1058008929 9:99952878-99952900 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1058088831 9:100781141-100781163 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1058115315 9:101078203-101078225 AGGGGGAGGGGGAGGGGGGAGGG + Intronic
1058170778 9:101678620-101678642 AGGTGAAACTGTAGGGTGGAAGG + Intronic
1058330145 9:103750470-103750492 AGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1058509706 9:105704082-105704104 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1058944305 9:109841903-109841925 AGGATAGAGGGGAGGGTGGAAGG + Intronic
1058944313 9:109841923-109841945 AGGGTAGAGGGGAGGGTGGAAGG + Intronic
1059027125 9:110646748-110646770 TGGGGTGAGGGGAGGGTGGAGGG + Intergenic
1059039552 9:110796966-110796988 TGGGGTCAGGGGAGGGGGGAGGG + Intronic
1059446852 9:114343402-114343424 AGGGGTGAAGGGAGGATGGAGGG + Intronic
1059600124 9:115768226-115768248 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1059752272 9:117259082-117259104 AGAGGTACTGGGAGGGTGGAAGG - Intronic
1060249487 9:121973593-121973615 TGGGGTCAGGGGAGGGGGGAAGG + Intronic
1060470589 9:123944825-123944847 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1060670616 9:125466268-125466290 AGGGGTACGGGGTGGGTGGTGGG - Intronic
1060824360 9:126679490-126679512 TGGTTGAAGGGGTGGGTGGATGG + Intronic
1060828749 9:126700926-126700948 AGGTGGAAGGTGAGAGTGGAGGG - Exonic
1061841269 9:133359768-133359790 AGGTGTGCAGGGAGGGTGGTGGG - Intronic
1062248844 9:135584197-135584219 TGGGGTAAGGGGGGGGTGGTGGG - Intergenic
1203732665 Un_GL000216v2:104790-104812 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1203358693 Un_KI270442v1:191237-191259 TGGGGTGAGGGGAGGGAGGAGGG + Intergenic
1203711389 Un_KI270742v1:101130-101152 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1185581270 X:1213039-1213061 AGGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185581280 X:1213058-1213080 AGGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185611438 X:1395700-1395722 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185611529 X:1396204-1396226 ATGGGTAATGGGTGGGTGGATGG + Intergenic
1185640649 X:1588142-1588164 AGAGGAAAGGGGAGGGGGGAGGG - Intergenic
1185662049 X:1735643-1735665 AGGAGGAGGGGGAGGGGGGAAGG - Intergenic
1185671730 X:1815397-1815419 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1185756923 X:2659753-2659775 AGGGGGAAGGGGAGGGGGGAGGG - Intergenic
1185756931 X:2659765-2659787 AGGGGGAAGGGGAGGGGGAAGGG - Intergenic
1185798418 X:2986828-2986850 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1185996614 X:4957897-4957919 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1186065867 X:5764150-5764172 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1186070746 X:5816835-5816857 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1186077662 X:5898248-5898270 AGGAGTAAAGGAAGGGAGGAAGG - Intronic
1186124708 X:6400905-6400927 AGGAGGAAGGGGAGGGGGCAGGG - Intergenic
1186137016 X:6532760-6532782 AGGTGTGTGGGGAGGGAGAAAGG - Intergenic
1186137026 X:6532793-6532815 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137047 X:6532852-6532874 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137070 X:6532915-6532937 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137089 X:6532974-6532996 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137120 X:6533066-6533088 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137143 X:6533129-6533151 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137154 X:6533159-6533181 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137178 X:6533225-6533247 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137189 X:6533255-6533277 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137230 X:6533376-6533398 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137254 X:6533442-6533464 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186267175 X:7844263-7844285 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267220 X:7844388-7844410 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267243 X:7844451-7844473 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267256 X:7844484-7844506 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297728 X:8169142-8169164 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297740 X:8169175-8169197 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324870 X:8466597-8466619 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324880 X:8466626-8466648 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324913 X:8466718-8466740 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324923 X:8466747-8466769 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324933 X:8466776-8466798 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324943 X:8466805-8466827 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324965 X:8466867-8466889 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324976 X:8466897-8466919 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324987 X:8466927-8466949 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325034 X:8467055-8467077 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325046 X:8467088-8467110 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325085 X:8467205-8467227 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325115 X:8467292-8467314 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325131 X:8467329-8467351 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186514489 X:10156444-10156466 ATTTGAAAGGCGAGGGTGGAGGG + Intergenic
1186580248 X:10809772-10809794 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1186743690 X:12544086-12544108 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1186791828 X:13007218-13007240 AGAAGAAATGGGAGGGTGGAGGG + Intergenic
1186818373 X:13260586-13260608 AGGTGGGAAGGGAGGTTGGAGGG - Intergenic
1186887967 X:13933725-13933747 AGGTTTAAGGGGAGTGGGGTAGG + Intronic
1187265967 X:17733819-17733841 TGGCAAAAGGGGAGGGTGGAGGG + Exonic
1187624517 X:21095302-21095324 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1187657188 X:21489805-21489827 AGGTGGTAGGTGGGGGTGGAGGG + Intronic
1187763689 X:22615167-22615189 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1187795796 X:23002903-23002925 AGCTGATGGGGGAGGGTGGAAGG - Exonic
1187834979 X:23423439-23423461 TGGTGTGGGGGGAGGGAGGAGGG - Intergenic
1187882887 X:23862878-23862900 GGATGGAAGGGGAGGGAGGAGGG + Intronic
1188034621 X:25303355-25303377 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1188102717 X:26109927-26109949 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1188109123 X:26176684-26176706 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1188110053 X:26186194-26186216 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188303206 X:28530648-28530670 AGGTGTAGGGTGGGGGTGGCTGG - Intergenic
1188360912 X:29252115-29252137 TGGGGTAAGGGGAGGGGGGAGGG + Intronic
1188390755 X:29616470-29616492 TGGGGTAGGGGGAGGGGGGAGGG - Intronic
1188553514 X:31386226-31386248 TGGGGTGAGGGGAGGGAGGAGGG + Intronic
1188607784 X:32054334-32054356 TGGGGTGGGGGGAGGGTGGAGGG - Intronic
1188797900 X:34488504-34488526 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1188798471 X:34496148-34496170 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1188807983 X:34614871-34614893 AGGTGTTGAGGGAGGGTGGGAGG - Intergenic
1188839018 X:34991966-34991988 TGGGGTAAGGGGAGGGGGGAGGG + Intergenic
1189071725 X:37870675-37870697 TGGTGTGGGGGGAGGGGGGAGGG + Intronic
1189194771 X:39143700-39143722 AGGTGCAAGGGAAGGAGGGAAGG - Intergenic
1189208271 X:39260668-39260690 AGGTGTAAGGGGAAGGGGCATGG - Intergenic
1189214361 X:39310548-39310570 AGGTCTGATGGGAGGGTGAAAGG + Intergenic
1189542860 X:42010661-42010683 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1190037247 X:47036959-47036981 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1190198927 X:48343778-48343800 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1190378418 X:49814105-49814127 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1190424721 X:50323417-50323439 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1190518408 X:51249127-51249149 TGGTGTGGGGGGAGGGGGGAGGG + Intergenic
1190592595 X:52020165-52020187 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190609182 X:52176767-52176789 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1190712008 X:53078214-53078236 ACTTGGAAGGGGAGGGTGCATGG - Exonic
1190732143 X:53233404-53233426 AGGTGTAAGGGAATGGCGGGGGG + Exonic
1190732364 X:53234344-53234366 GGGTGTGAGGGGAGGGTGGGGGG + Exonic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1190806330 X:53840945-53840967 AGGTGAAGGGGGAGTGGGGAGGG + Intergenic
1190923940 X:54884617-54884639 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190926436 X:54909757-54909779 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1191098714 X:56701753-56701775 AGGGGTCGGGGGAGGGGGGAGGG + Intergenic
1191131065 X:57011440-57011462 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1191145957 X:57165540-57165562 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1191216722 X:57940179-57940201 TGGGGTAGGGGGAGGGGGGATGG - Intergenic
1191271003 X:58469006-58469028 AGGGGTCGGGGGAGGGGGGAGGG + Intergenic
1191585835 X:62825585-62825607 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1191704377 X:64079001-64079023 TGCCGTAGGGGGAGGGTGGAGGG - Intergenic
1191713343 X:64176017-64176039 AGTGGTGAGGGTAGGGTGGAGGG + Intergenic
1191851216 X:65587761-65587783 AGGAGTCGGGGAAGGGTGGAAGG + Intergenic
1191924163 X:66291402-66291424 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1191928326 X:66340248-66340270 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1192004908 X:67200067-67200089 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192133643 X:68576412-68576434 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1192531318 X:71889159-71889181 TGGTGTTGGGGGAGGGTGGAGGG + Intergenic
1192541717 X:71978902-71978924 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1192684284 X:73287344-73287366 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1192715823 X:73641659-73641681 TGGTGTGGGGGGAGGGGGGAAGG - Intronic
1192919375 X:75690306-75690328 TGGGGTGAGGGGAGGGTGCAGGG - Intergenic
1192987919 X:76420236-76420258 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1193009481 X:76660416-76660438 TGGGGTTGGGGGAGGGTGGAGGG - Intergenic
1193010302 X:76668105-76668127 TGGGGTTGGGGGAGGGTGGAGGG + Intergenic
1193165472 X:78275581-78275603 TGGGGTGAGGGGAGGGGGGAGGG + Intronic
1193395271 X:80977007-80977029 TGGGGTGGGGGGAGGGTGGAGGG - Intergenic
1193580411 X:83257572-83257594 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193597502 X:83465291-83465313 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1193614748 X:83673407-83673429 TGGTGTGGGGGGAGGGGGGAGGG - Intergenic
1193738654 X:85190969-85190991 TGGTGTAGGGGGAGGGGGGAGGG + Intergenic
1193776704 X:85650918-85650940 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1193801547 X:85942901-85942923 AGGGGTGAGGGGAGGGGGGAGGG - Intronic
1193877811 X:86883948-86883970 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1193956651 X:87871888-87871910 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194020240 X:88680719-88680741 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1194348513 X:92796029-92796051 AGGGGGAAGGGGAGGGGGGAAGG + Intergenic
1194416356 X:93617275-93617297 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1194429819 X:93788159-93788181 AGTTGCAAGGGGATAGTGGAAGG - Intergenic
1194657462 X:96589939-96589961 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1194984292 X:100473368-100473390 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1195088349 X:101434778-101434800 TGGGGTTAGGGGAGGGGGGAGGG - Intronic
1195103498 X:101580177-101580199 TGGGGTTAGGGGAGGGGGGAGGG - Intergenic
1195117163 X:101711216-101711238 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1195227308 X:102811106-102811128 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1195299032 X:103509349-103509371 AGGGGTTAGGGGAGAGGGGAGGG - Intronic
1195412437 X:104582538-104582560 AGGAGGAAGGGGAGGAAGGAAGG - Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195578857 X:106479296-106479318 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1195595187 X:106680871-106680893 AGCAGGAAGTGGAGGGTGGACGG - Intergenic
1195709551 X:107763204-107763226 AAGTTTAAGGGTGGGGTGGAAGG - Intronic
1195821906 X:108955115-108955137 AGGTTTTATTGGAGGGTGGAAGG + Intergenic
1195931321 X:110079830-110079852 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1195984214 X:110611691-110611713 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1196046221 X:111259026-111259048 AGGGGTGGGGGTAGGGTGGAGGG + Intronic
1196325931 X:114402427-114402449 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1196491222 X:116269781-116269803 TGGGGTAGGGGGAGGGAGGAGGG - Intergenic
1196524598 X:116717425-116717447 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1196637613 X:118021380-118021402 TGGGGTAAGGGTAGGGGGGAGGG - Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1196903920 X:120413242-120413264 AGGCATAAGGGGAGAGTGAAGGG - Intergenic
1197060222 X:122170573-122170595 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1197103390 X:122684135-122684157 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1197245398 X:124161587-124161609 AGGTGTAGGGTAATGGTGGAAGG - Intronic
1197397436 X:125943794-125943816 AGGGGTCGGGGGAGGGGGGAGGG + Intergenic
1197494563 X:127161469-127161491 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1197508033 X:127332613-127332635 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1197636335 X:128918625-128918647 TGGGGTAGGGGGAGGGGGGAGGG + Intergenic
1197640655 X:128964262-128964284 AGGAGTGAGGGGAGGGAAGAGGG + Intergenic
1197814075 X:130478522-130478544 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1197907058 X:131436834-131436856 TGGGGTTGGGGGAGGGTGGAAGG - Intergenic
1198952657 X:142089684-142089706 TGGGGTGAGGGGAGGGGGGAGGG + Intergenic
1199142237 X:144326599-144326621 TGGGGTCAGGGGAGGGGGGAGGG + Intergenic
1199159209 X:144587441-144587463 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1199181810 X:144866295-144866317 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1199469096 X:148173559-148173581 TGGGGTATGGGGAGGGGGGAGGG + Intergenic
1199474485 X:148230913-148230935 AGGGGGATGGGGAGGGGGGAGGG - Intergenic
1199620963 X:149700706-149700728 TGGGGTCAGGGGAGGGGGGAGGG - Intronic
1199669515 X:150131549-150131571 AGGGGTGGGGGGAGGGGGGAGGG - Intergenic
1199808859 X:151329161-151329183 GGGTGTCAGGGGCTGGTGGAGGG + Intergenic
1199887329 X:152033635-152033657 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1199919812 X:152387147-152387169 TGGGGTAGGGGGAGGGGGGAGGG + Intronic
1200253106 X:154564277-154564299 AGAGGGAAGGGGAGGATGGAGGG - Intronic
1200264661 X:154640138-154640160 AGAGGGAAGGGGAGGATGGAGGG + Intergenic
1200328336 X:155265838-155265860 AGGGGTGGGGGGAGGGGGGAGGG + Intergenic
1200368941 X:155700753-155700775 TGGGGTCAGGGGAGGGGGGAGGG - Intergenic
1200573088 Y:4857614-4857636 TGGGGTGAGGGGAGGGGGGAGGG - Intergenic
1201438516 Y:13985245-13985267 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438532 Y:13985300-13985322 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438667 Y:13985696-13985718 AGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445906 Y:14057012-14057034 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446041 Y:14057408-14057430 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446057 Y:14057463-14057485 AGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201679012 Y:16621819-16621841 TGGGGTAGGGGGAGGGGGGAGGG - Intergenic
1201769065 Y:17600069-17600091 AGGGTTGAGGGGAGGGTGCAGGG + Intergenic
1201832489 Y:18305916-18305938 AGGGTTGAGGGGAGGGTGCAGGG - Intergenic
1201887705 Y:18903963-18903985 AGGTAAAAGGGGATGGAGGAAGG + Intergenic
1201897686 Y:19010121-19010143 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1201959906 Y:19668107-19668129 TGGGGTGGGGGGAGGGTGGAGGG + Intergenic
1202109026 Y:21402745-21402767 TGGGGTAGGGGGAGGGAGGAGGG + Intergenic
1202348134 Y:23957013-23957035 TGGTGTCGGGGGAGGGGGGAGGG - Intergenic
1202522640 Y:25713091-25713113 TGGTGTCGGGGGAGGGGGGAGGG + Intergenic