ID: 933821335

View in Genome Browser
Species Human (GRCh38)
Location 2:86114997-86115019
Sequence TGGCCATGTAGACCACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933821329_933821335 4 Left 933821329 2:86114970-86114992 CCAGTGCCCAGAGTTTTTAGGGG 0: 1
1: 2
2: 1
3: 9
4: 131
Right 933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 80
933821325_933821335 22 Left 933821325 2:86114952-86114974 CCAAAGCTCATTAGAGACCCAGT 0: 1
1: 0
2: 1
3: 9
4: 83
Right 933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 80
933821333_933821335 -3 Left 933821333 2:86114977-86114999 CCAGAGTTTTTAGGGGAGGCTGG 0: 1
1: 0
2: 2
3: 18
4: 203
Right 933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 80
933821327_933821335 5 Left 933821327 2:86114969-86114991 CCCAGTGCCCAGAGTTTTTAGGG 0: 1
1: 1
2: 1
3: 11
4: 152
Right 933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 80
933821332_933821335 -2 Left 933821332 2:86114976-86114998 CCCAGAGTTTTTAGGGGAGGCTG 0: 1
1: 0
2: 3
3: 17
4: 175
Right 933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933821335 Original CRISPR TGGCCATGTAGACCACCCAC TGG Intronic
902295920 1:15466964-15466986 TGCCCACATAGACCACCCGCGGG + Intronic
903326073 1:22569298-22569320 TGGACACGTCGACCATCCACGGG + Exonic
905226801 1:36484183-36484205 GGGCCTTGTAGACCATCCAAAGG - Intergenic
905825507 1:41023431-41023453 TGGCCATGTGGGCCACCCAGTGG - Intergenic
906817621 1:48895299-48895321 TGGCCATGTTGACCACTGGCTGG - Intronic
911401203 1:97377843-97377865 TGGCCATGTAGACATCCTTCTGG - Intronic
915898672 1:159830506-159830528 TTACCATGTAGAGTACCCACAGG + Intronic
918253624 1:182726963-182726985 GGGCCATGTACACCCGCCACAGG + Intergenic
1067183978 10:44011718-44011740 TTGCCATGGAGACCACACTCTGG + Intergenic
1071545943 10:86529494-86529516 TGACAATGTAGAACACACACTGG + Intergenic
1075232932 10:120699536-120699558 TGACCAGTGAGACCACCCACTGG + Intergenic
1075961577 10:126571684-126571706 GGGGAAGGTAGACCACCCACTGG + Intronic
1077454956 11:2672917-2672939 TGGCCATGCAGGCCCACCACAGG + Intronic
1078470226 11:11580529-11580551 TGGCCAGGTAGCTCAGCCACTGG + Intronic
1078923819 11:15856800-15856822 TGGCCATGCTGACCACCCATAGG + Intergenic
1079867662 11:25756438-25756460 TGGTCCTGTCGACCACCCAAGGG + Intergenic
1081661827 11:44893132-44893154 GTCCCATGTAGAACACCCACAGG - Intronic
1081793840 11:45806158-45806180 TGCCGATGAAGACCACCGACAGG - Exonic
1084019790 11:66410597-66410619 TGGCCATGTGGGCCTCCCACAGG - Intergenic
1084514450 11:69628710-69628732 TGGCCATGTGGACAACCCAGAGG + Intergenic
1084606860 11:70177318-70177340 TGGCCATGAAGAACACTCCCAGG - Intronic
1089884545 11:121806963-121806985 TGGGCATGTAGACCAAGGACAGG + Intergenic
1092909567 12:13134728-13134750 TGTCCATGTTGGCCACCCAAAGG - Intronic
1098880452 12:75912004-75912026 TGCCCATGAAGACCTCCCAGTGG + Intergenic
1104429616 12:128705758-128705780 TGGCCAGGCAGAACACCCCCAGG - Exonic
1104878649 12:132054101-132054123 TGGCCATGCACACCACGCTCTGG + Intronic
1117516489 14:56507184-56507206 TTGCCATGTGGCCCCCCCACAGG + Intronic
1117733143 14:58744064-58744086 TGGACAGGGAGACCAACCACAGG - Intergenic
1118083818 14:62393432-62393454 TGCCCATGTATGCCACCCAGGGG - Intergenic
1121871974 14:97416443-97416465 TGTCCTTGTAAACCACCCAGAGG - Intergenic
1122956457 14:105073724-105073746 TGGCCGTGGACACCACCCTCAGG - Intergenic
1123150889 14:106180775-106180797 TCTCCAGATAGACCACCCACAGG - Intergenic
1123399306 15:19968632-19968654 TCTCCAGATAGACCACCCACGGG - Intergenic
1124634667 15:31357465-31357487 TGGCCCAGTAGACCACCCACAGG - Intronic
1127830928 15:62750575-62750597 TAGCCCTGCAGACCAGCCACAGG - Intronic
1128497569 15:68207105-68207127 TGACTCTGTAGACCCCCCACAGG + Exonic
1130026535 15:80275625-80275647 TGGATATTCAGACCACCCACTGG + Intergenic
1131784248 15:95894389-95894411 TGGCCAGGGAGACCAGCCAAAGG - Intergenic
1133867398 16:9657080-9657102 TGGGCATGCAGACCTCCCAATGG - Intergenic
1141885175 16:86886823-86886845 TGGCTTTGCAGACCACACACAGG - Intergenic
1142222242 16:88861294-88861316 TGACCATGTGGGTCACCCACTGG + Exonic
1151656823 17:75500091-75500113 TGGCCTTACAGACCAGCCACAGG - Intergenic
1157052356 18:44181286-44181308 TGCCCCTGAAGACCTCCCACTGG - Intergenic
1167144979 19:47676102-47676124 TGTCCATGTTGGCCCCCCACAGG - Intronic
1168713548 19:58514701-58514723 TGGCCATCTGGACTGCCCACTGG + Intronic
927673727 2:25089785-25089807 TGGGCATGCAGCCCGCCCACTGG + Intronic
933821335 2:86114997-86115019 TGGCCATGTAGACCACCCACTGG + Intronic
937100001 2:119261312-119261334 AGTCCATGCAGACCACCCAGAGG + Intronic
944329564 2:198449569-198449591 TGGCCCTGTAGACCTTCCAGTGG + Intronic
944532016 2:200676649-200676671 TTGCCATGGGGACAACCCACTGG - Intronic
945143723 2:206714712-206714734 TAGCCAGGGAGACCAGCCACAGG + Intronic
947179813 2:227401898-227401920 TGGAAATGTAAACCACCCACAGG + Intergenic
948789724 2:240371070-240371092 GGGCCACGTGGACCATCCACAGG + Intergenic
948830593 2:240596695-240596717 TGGCCAAGAACACCACCCCCGGG + Exonic
1172619235 20:36308224-36308246 TCGCCATGGACACCACACACGGG - Intronic
1178361430 21:31951683-31951705 TGGCCGAGTTGTCCACCCACAGG - Intronic
1181104888 22:20568309-20568331 TGGCAATGTGGCCCTCCCACTGG - Intronic
950455483 3:13090512-13090534 TGTCCATGTGTGCCACCCACTGG + Intergenic
952932450 3:38370821-38370843 TGGCCAAGTAGAACACCCCAGGG - Intronic
954481785 3:50806447-50806469 TGGCCATGTAGCCAGGCCACTGG + Intronic
961393510 3:126570486-126570508 AGCCCATGTAGGCCACACACAGG - Intergenic
968876068 4:3268650-3268672 TGGGCCAGCAGACCACCCACAGG + Intronic
971175984 4:24283246-24283268 TATCCATGTCGACCTCCCACTGG + Intergenic
974041857 4:56864367-56864389 AGGCCATGTAGCCCATACACAGG + Intergenic
981288826 4:143050384-143050406 TGGTCATATAGACCACCAAAAGG + Intergenic
987133822 5:14882742-14882764 TGGCCATGTGGACCACATCCTGG - Intergenic
988501071 5:31784204-31784226 TGGCCATGTGGGGCACTCACAGG - Intronic
1003051515 6:2785018-2785040 TGGCAAAGTAGACCACACACTGG - Exonic
1014783165 6:125587852-125587874 TGGCCATCTCCCCCACCCACCGG - Intergenic
1014946603 6:127505817-127505839 TGGCCATGTAGATAACACAGAGG - Intronic
1015675290 6:135739492-135739514 ACGCCATGTACACCACACACCGG - Intergenic
1016737057 6:147490536-147490558 TGGCCTTGGTGACCATCCACAGG - Intergenic
1021696547 7:23281856-23281878 TGCCCCTGAAGACCACCCACTGG + Intergenic
1022903317 7:34831977-34831999 TGGCCATGTATTCTATCCACAGG - Intronic
1023536563 7:41219135-41219157 GGCCAATGTAGACCACCCAAGGG - Intergenic
1036630284 8:10508683-10508705 TGGCCCTGAAGACCTCCCAGTGG - Intergenic
1039855367 8:41407454-41407476 TAGCCTTGTAAACCAACCACTGG - Intergenic
1039996144 8:42535152-42535174 TGGCCAGGCAGTCCACTCACAGG + Intronic
1042065280 8:64868094-64868116 TGGCCATAGAGACTACCCTCTGG - Intergenic
1046284232 8:112074128-112074150 TAGCCAAGTACACCATCCACAGG + Intergenic
1047179495 8:122573578-122573600 TGACCATCTGGACCACCCAGGGG - Intergenic
1051088289 9:13377572-13377594 TAGCCATGTATCCCACCAACTGG + Intergenic
1060899188 9:127242698-127242720 TGGCCATGAAGTCCTACCACCGG + Intronic
1061168798 9:128940265-128940287 TGGCCCTGGAGAGCACCCAGAGG + Intronic
1062570597 9:137183329-137183351 GGGACCTGTAGACCACCTACCGG - Intronic
1189153741 X:38733872-38733894 TGGCCATGAAGACCTCCATCTGG - Intergenic
1195013480 X:100755641-100755663 TGACCATGTAGCCAATCCACTGG + Intergenic
1200062270 X:153488890-153488912 GGGCCAGGCAGGCCACCCACAGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic