ID: 933822041

View in Genome Browser
Species Human (GRCh38)
Location 2:86121992-86122014
Sequence CTCAACTTACAGGCGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933822041_933822046 22 Left 933822041 2:86121992-86122014 CCGGGGCCCGCCTGTAAGTTGAG 0: 1
1: 0
2: 0
3: 7
4: 54
Right 933822046 2:86122037-86122059 CGAATTTTACTTCTAGAACTAGG 0: 1
1: 0
2: 1
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933822041 Original CRISPR CTCAACTTACAGGCGGGCCC CGG (reversed) Intronic
902770718 1:18643971-18643993 CTAAATTAACAGGCCGGCCCGGG + Intronic
906524442 1:46486045-46486067 CTCAACCTCCAGGCGGGCAGGGG - Intergenic
916185843 1:162132088-162132110 CTCACCTTCCAGGCAGGCCTAGG - Intronic
1064078222 10:12287215-12287237 CCCAACCTACAGGTGGGGCCTGG + Intergenic
1069628086 10:69880541-69880563 AACAACTTACAGGGGGGCCGCGG - Exonic
1075526715 10:123193307-123193329 CTCAACTTCCAGGCATGTCCAGG + Intergenic
1077920039 11:6635035-6635057 CTCAAATTCCAGGTGGGTCCAGG + Intronic
1083773830 11:64883488-64883510 CTAAACTTATTGGAGGGCCCAGG + Intronic
1089279487 11:117363318-117363340 CTGAGCTGACAGGCGGGCCCAGG - Intronic
1091833328 12:3566292-3566314 CTCAACTGAGAGCAGGGCCCAGG - Intronic
1092005923 12:5070389-5070411 TTCAGCTTAGAGGAGGGCCCTGG + Intergenic
1097046113 12:56189088-56189110 CTCTACTGCCCGGCGGGCCCCGG - Intronic
1105539794 13:21306540-21306562 CTCACCTTGCAGGCAGGCACTGG + Intergenic
1115910867 14:38255451-38255473 CTCAAGTTAGAGGCGGCCCCGGG + Exonic
1118035032 14:61857400-61857422 CTGAAATTAGAGGTGGGCCCAGG + Intergenic
1120571077 14:86117058-86117080 GTCAAATTAGAGGTGGGCCCTGG + Intergenic
1131858668 15:96627473-96627495 CTGAACTGACAGGCTGGGCCTGG + Intergenic
1132976173 16:2712183-2712205 CTCACCTTAAAGGCCGCCCCAGG - Intergenic
1137780304 16:51092544-51092566 CTTAACTGACAGGAGGGGCCGGG + Intergenic
1146904374 17:36608676-36608698 CTCAACTTCCAGGCAGGGCCTGG - Exonic
1157813150 18:50711961-50711983 CTCAGCTGACAGCAGGGCCCTGG + Intronic
1168485785 19:56760880-56760902 CTCAACTGACAGCAGGCCCCAGG + Intergenic
933822041 2:86121992-86122014 CTCAACTTACAGGCGGGCCCCGG - Intronic
942798000 2:179843782-179843804 TTCAACATACAGGCAGGGCCTGG + Intronic
943528810 2:189052739-189052761 ATAAACTTACAGGCGGACCTTGG + Exonic
1169984635 20:11430291-11430313 CTCAAATACCAGGCAGGCCCAGG + Intergenic
1175505553 20:59481861-59481883 CTCAGCTTACAGAGGGTCCCTGG + Intergenic
1178254956 21:31044005-31044027 CTGAGCATACAGGCGGGGCCCGG - Intergenic
1182284020 22:29233456-29233478 CTCAACTTACCCATGGGCCCTGG - Exonic
1183094280 22:35542766-35542788 TTCATCTTTCAGGCAGGCCCTGG + Intronic
1183341632 22:37284821-37284843 CTCACCTTCCCGGCAGGCCCTGG - Intronic
1185266214 22:49905651-49905673 CTCAGCTTCCAGGCTGGCCTGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953720395 3:45349950-45349972 CTCTACCTCCAGGCTGGCCCTGG - Intergenic
957652224 3:83022678-83022700 CTCAACTTAAAGGGAGGCCGAGG + Intergenic
959128248 3:102317621-102317643 CTCCACTTTCAAGCAGGCCCTGG + Intronic
969461071 4:7329213-7329235 CCTGGCTTACAGGCGGGCCCGGG + Intronic
971335877 4:25723752-25723774 CTGAACTTAGAGTGGGGCCCTGG - Intergenic
971939091 4:33190607-33190629 CTGAACTTACAGGAGTGTCCAGG + Intergenic
973190610 4:47381224-47381246 CTGAAGTTAGAGGCTGGCCCAGG - Intronic
985360710 4:189172535-189172557 TTTAACTCACAGGGGGGCCCAGG + Intergenic
992088413 5:73298158-73298180 CACAGCTTCCAGGTGGGCCCGGG + Intergenic
997677444 5:135723653-135723675 GTCTGCTTACAGGCAGGCCCTGG - Intergenic
999481425 5:151951626-151951648 CTCACTTTACAGGTGGGCCCAGG + Intergenic
1001744673 5:174083107-174083129 CTCTCCTTCCAGGCTGGCCCAGG + Intronic
1004363603 6:14993244-14993266 CTCCACTTACATGAGGTCCCTGG + Intergenic
1006184941 6:32176121-32176143 CTCCACTTCCTGGCCGGCCCCGG - Intronic
1009940087 6:70280994-70281016 ATCAACTTACCGGGGGGCCCGGG + Exonic
1016451502 6:144187483-144187505 CTCAAGTAGCAGGCCGGCCCGGG + Exonic
1018818483 6:167354254-167354276 CTCACCTTACAGGCAGGCCTTGG - Intronic
1019134486 6:169899673-169899695 CTCAACTTGCAGATGGACCCTGG + Intergenic
1019325305 7:435349-435371 CTTGACTGACAGGCGGGCGCGGG + Intergenic
1023835360 7:44064485-44064507 CCCAACTTACTGTGGGGCCCTGG - Intronic
1026633571 7:72060497-72060519 AACAACTTACAGGTGAGCCCAGG - Intronic
1036765543 8:11547475-11547497 CCCACCTTGCTGGCGGGCCCTGG - Intronic
1038492604 8:27981524-27981546 CTCAACTCACGGGGGAGCCCCGG - Intronic
1044816009 8:96113744-96113766 CTCATCTTTCAGGTGGGACCTGG - Intergenic
1048935766 8:139355419-139355441 CTCAGGTGACAGCCGGGCCCAGG + Intergenic
1049989634 9:978489-978511 TTCTACTTACAGGAGGGCTCTGG - Intronic
1062138412 9:134942105-134942127 CTCAACTCTCTGGAGGGCCCTGG + Intergenic
1187146776 X:16644426-16644448 CTCAATTTACAGGCTGGGCATGG - Intronic
1189324570 X:40105007-40105029 CTCAGCTTACCCGCGGGCCCAGG - Intronic