ID: 933824444

View in Genome Browser
Species Human (GRCh38)
Location 2:86145821-86145843
Sequence CGACATAGCCAAAGGATACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933824438_933824444 -3 Left 933824438 2:86145801-86145823 CCTTACCACCCAGGCACATGCGA 0: 1
1: 0
2: 1
3: 14
4: 188
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824435_933824444 4 Left 933824435 2:86145794-86145816 CCCTAGCCCTTACCACCCAGGCA 0: 1
1: 0
2: 2
3: 29
4: 223
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824437_933824444 -2 Left 933824437 2:86145800-86145822 CCCTTACCACCCAGGCACATGCG 0: 1
1: 0
2: 1
3: 34
4: 795
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824434_933824444 5 Left 933824434 2:86145793-86145815 CCCCTAGCCCTTACCACCCAGGC 0: 1
1: 0
2: 5
3: 16
4: 216
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824436_933824444 3 Left 933824436 2:86145795-86145817 CCTAGCCCTTACCACCCAGGCAC 0: 1
1: 0
2: 2
3: 36
4: 303
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824432_933824444 14 Left 933824432 2:86145784-86145806 CCACACTGACCCCTAGCCCTTAC 0: 1
1: 0
2: 1
3: 17
4: 151
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77
933824439_933824444 -8 Left 933824439 2:86145806-86145828 CCACCCAGGCACATGCGACATAG 0: 1
1: 0
2: 0
3: 2
4: 66
Right 933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG 0: 1
1: 0
2: 0
3: 3
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933824444 Original CRISPR CGACATAGCCAAAGGATACT GGG Intronic
901518400 1:9764769-9764791 CAAGATTGGCAAAGGATACTAGG - Intronic
903054106 1:20623233-20623255 CCACATAGTATAAGGATACTAGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906734374 1:48110396-48110418 AGACATAGTCATAAGATACTGGG - Intergenic
910329058 1:86048402-86048424 TGACATAGCCAAATAATATTAGG + Intronic
917243999 1:172980761-172980783 GGACATTGCCAAATGATAATGGG - Intergenic
917613111 1:176710068-176710090 CTACACTCCCAAAGGATACTTGG + Exonic
918727631 1:187946500-187946522 GGACATAGCCAAACCATACCAGG - Intergenic
919494463 1:198247023-198247045 AGATATAGCCAATGGATATTTGG - Intronic
920051955 1:203169641-203169663 CGACAAACCCAAAGGAAACGTGG - Intronic
922479366 1:225928334-225928356 CGAGACAGCAAAAGGATAGTGGG - Intergenic
1065858602 10:29851169-29851191 TGACATAGTCAAAGGTTTCTGGG - Intergenic
1067838095 10:49653957-49653979 GGACATAGCCAGAGGCTCCTGGG + Intronic
1070315226 10:75303791-75303813 CAGCATAGCGAAAGGATCCTTGG - Intergenic
1072392799 10:95005689-95005711 CCAGATAGCCAAAGCAGACTAGG - Intergenic
1074519632 10:114207364-114207386 AGACATATACAAGGGATACTTGG - Intronic
1077978060 11:7270696-7270718 CCAAATAGCCAAAGGCCACTTGG - Intronic
1102659252 12:114511595-114511617 AGAAATAGCTAATGGATACTGGG + Intergenic
1104451383 12:128871340-128871362 CAGCATTTCCAAAGGATACTAGG + Intronic
1108025643 13:46174507-46174529 CGACCTAACAAAAGGAGACTTGG + Intronic
1108027809 13:46196886-46196908 GTACATAGCCAAAGGACAATAGG - Intronic
1109740885 13:66553127-66553149 CGACATAGCCAAACTATATCAGG + Intronic
1110541497 13:76711478-76711500 GGACTTAGCCAAAGAATGCTTGG - Intergenic
1112371970 13:98802159-98802181 AGACAAAGCAAAAGGAGACTGGG - Intronic
1114048990 14:18903953-18903975 AGAGATAGCTAAAGGATACAGGG + Intergenic
1114113573 14:19497980-19498002 AGAGATAGCTAAAGGATACAGGG - Intergenic
1114115273 14:19615730-19615752 AGAGATAGCTAAAGGATACCGGG - Intergenic
1115256766 14:31411338-31411360 TGACATATTCAAAGAATACTAGG + Intronic
1117972836 14:61269472-61269494 AAAAATAGCCAATGGATACTAGG - Intronic
1120453518 14:84701936-84701958 AAAAATAGCCAAAGGATGCTGGG + Intergenic
1123505048 15:20933558-20933580 AGAAATAGCTAAAGGATACAGGG + Intergenic
1123562293 15:21507252-21507274 AGAAATAGCTAAAGGATACAGGG + Intergenic
1123598538 15:21944539-21944561 AGAAATAGCTAAAGGATACAGGG + Intergenic
1130929658 15:88414524-88414546 TAACATAACCAAAGGATATTCGG + Intergenic
1202970638 15_KI270727v1_random:234394-234416 AGAAATAGCTAAAGGATACAGGG + Intergenic
1134183208 16:12063878-12063900 CCAAATAGCCAAAGGTTACGGGG + Intronic
1138710253 16:58963033-58963055 TGACATAGACAAAGCAGACTGGG - Intergenic
1138975639 16:62204045-62204067 TGACACAGCCAAAAGATACGGGG - Intergenic
1139684483 16:68592215-68592237 GGACACAGCCAAACCATACTGGG - Intergenic
1142951352 17:3483578-3483600 TGACTTACCCACAGGATACTTGG - Exonic
1150996590 17:70324983-70325005 CAACATAGTCACAGGTTACTAGG + Intergenic
1155337887 18:24783973-24783995 CAACAGAGCCAAAGGGCACTAGG - Intergenic
1158454545 18:57594549-57594571 AGACATAGCCAGAGAATAATAGG + Intergenic
1158515372 18:58126267-58126289 AGTCATAGCTAAAGGATACAAGG - Intronic
1164674399 19:30091920-30091942 CGACATTGTCACAGGACACTTGG - Intergenic
1164702961 19:30298738-30298760 TGGCATTGCCAAAGGAGACTGGG - Intronic
1165708666 19:37994230-37994252 AGAAATAGCCATGGGATACTAGG - Intronic
925439959 2:3876930-3876952 GGACTTAGCCATATGATACTTGG - Intergenic
926684536 2:15688883-15688905 AGACAAAGCCAAATGATACTGGG - Intergenic
931808884 2:65834801-65834823 CAACAAAGCAACAGGATACTGGG - Intergenic
933347762 2:81111011-81111033 AGTCATAGCCAAAGGAGACAGGG + Intergenic
933824444 2:86145821-86145843 CGACATAGCCAAAGGATACTGGG + Intronic
933863237 2:86491294-86491316 AGCCATAGCCAAAGAATGCTAGG - Intronic
943279117 2:185908875-185908897 AGACATTGGCAAAGGATACATGG - Intergenic
948747991 2:240109747-240109769 TGACACAGCCAAAGGAGACGAGG - Intergenic
1172909431 20:38395751-38395773 GGACATAGCCAAAGGATGTAGGG - Intergenic
1173343357 20:42175187-42175209 GAACATAGCCAAAGGACAGTGGG - Intronic
1174719448 20:52796360-52796382 AGACATAGCCAAAGCTTCCTGGG - Intergenic
959563848 3:107814515-107814537 TGACATAGCCTAAGAATATTTGG + Intergenic
963289597 3:143474264-143474286 TGACATAGCCAAATCATACTGGG + Intronic
963627224 3:147688894-147688916 GGACACAGCCAAACCATACTAGG + Intergenic
966964986 3:184982107-184982129 TGACATAGCTAAAGGAAATTGGG + Intronic
976512440 4:85927354-85927376 AGAGATAGCCAAAAGATACAGGG + Intronic
983023213 4:162705491-162705513 AGACATATCCACAGGAGACTTGG + Intergenic
989343925 5:40408085-40408107 GGGAATAGCCAAAGGACACTGGG - Intergenic
993216026 5:85023076-85023098 AGACACAGCCAAACCATACTGGG + Intergenic
1007524984 6:42483940-42483962 CTACAAAGCCATTGGATACTGGG - Intergenic
1016627643 6:146191095-146191117 TGACCTAGGCAAAGGAGACTTGG - Intronic
1023238378 7:38115111-38115133 CGATATAGCCAGTTGATACTGGG - Intergenic
1026500741 7:70941441-70941463 AAACATAGCTAATGGATACTAGG + Intergenic
1027440109 7:78210324-78210346 AGACATAGTCAAAAGATACTCGG + Intronic
1028123890 7:87089042-87089064 CAACATATCAAAAAGATACTTGG + Intergenic
1034112257 7:148548365-148548387 CAGCATAGCCAAAGGATTGTGGG - Intergenic
1037617774 8:20534941-20534963 GGAAATAGCCAAAGGCTCCTAGG + Intergenic
1044939043 8:97321865-97321887 CCACAAAGCCAAACAATACTGGG + Intergenic
1048735472 8:137495232-137495254 TGAAATATCCAGAGGATACTAGG + Intergenic
1057092043 9:92267111-92267133 AGACAAAGCCACAGGATGCTAGG + Intronic
1187279461 X:17846809-17846831 GGACATAGCCAAATCATATTAGG - Intronic
1192557622 X:72103041-72103063 GGACAGAGCCAAAGGGTCCTAGG + Intergenic
1198415489 X:136415607-136415629 AGACATATCCACAGGTTACTTGG - Intronic
1199363047 X:146944622-146944644 GGACATAGCCAAACCATATTGGG + Intergenic