ID: 933824466

View in Genome Browser
Species Human (GRCh38)
Location 2:86146272-86146294
Sequence AACTACTTGCTGAAGCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933824464_933824466 29 Left 933824464 2:86146220-86146242 CCAGAAAAAAGTGATACTCAATG 0: 1
1: 0
2: 0
3: 22
4: 210
Right 933824466 2:86146272-86146294 AACTACTTGCTGAAGCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933824466 Original CRISPR AACTACTTGCTGAAGCAAAG AGG Intronic
906008930 1:42504409-42504431 CACTACTTTCTGCAGAAAAGGGG + Intronic
906370006 1:45245715-45245737 CAGTAATTGCTGAATCAAAGGGG - Intronic
908900022 1:68945935-68945957 CTCTGCTTGCTGAAGAAAAGAGG - Intergenic
911767769 1:101699954-101699976 CACTAATTGCTGAAACAAGGAGG - Intergenic
913168544 1:116211483-116211505 ATCTACTTGCGGAAGCACATGGG + Intergenic
916964683 1:169925006-169925028 AACTATTATCTGAAGCAAAATGG - Intronic
918485732 1:185026725-185026747 AAAAACTGGCTAAAGCAAAGGGG + Intergenic
919106394 1:193156821-193156843 AAATATTTGCTAAAGGAAAGAGG - Intronic
920879949 1:209870547-209870569 AACAACTTGCTGAAGGGAATAGG + Intergenic
920899983 1:210099139-210099161 AAATACTTGAAGAGGCAAAGTGG + Intronic
921132907 1:212235044-212235066 TACTAAATGCTGAAGCAAAGAGG - Intergenic
1062824386 10:557556-557578 AACGACTTTGTGAAGAAAAGGGG - Intronic
1063345641 10:5310114-5310136 AAATACTTGAAGAAGCCAAGTGG - Intergenic
1069735356 10:70650381-70650403 GACTACTTGCTGCAGCCAGGTGG + Intergenic
1072990725 10:100190557-100190579 AATTGATTGCTGAAGCAAAAAGG + Intronic
1078274312 11:9828172-9828194 CACTACCTGCTTAAGCACAGTGG + Intronic
1078437905 11:11340657-11340679 TATTATTTGCTGAAGAAAAGGGG - Intronic
1078585825 11:12587810-12587832 AAATACTTGCTGAAGATCAGAGG + Intergenic
1080174460 11:29344966-29344988 AAATAATTTCTGAAGAAAAGAGG - Intergenic
1080786578 11:35480300-35480322 AAAGACTTTCTGCAGCAAAGTGG - Intronic
1080935082 11:36854565-36854587 AAATCCTTGCTGAAACAAAAGGG - Intergenic
1081360801 11:42175372-42175394 AAATATTTGCTGAATCATAGTGG + Intergenic
1081954195 11:47075546-47075568 AACTACTTGCAAAAGGAAAAAGG + Intronic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1089328390 11:117673193-117673215 TATTACTTGCTTAAGCCAAGTGG + Intronic
1093163397 12:15776478-15776500 AAATGCTTGCTGATGCATAGAGG - Intronic
1093861324 12:24171047-24171069 AACTAGGTGCTGTAGCAATGGGG + Intergenic
1098417327 12:70250023-70250045 AACTATTTGCTACAGCAAACCGG + Intronic
1106153614 13:27130908-27130930 CACGGCTTGCTGAAGCAAAGTGG - Intronic
1106342754 13:28846987-28847009 AAATACTTGGTGAATCAATGAGG + Intronic
1109219146 13:59623825-59623847 AACTTTCTGCTGAAGAAAAGAGG - Intergenic
1109988220 13:70017465-70017487 CACTAGTTGCTGCAGCAGAGTGG - Intronic
1110254562 13:73418286-73418308 AACAATTGGCTGAAGCTAAGGGG - Intergenic
1111432018 13:88157858-88157880 AGATGCTTGCTGAAGAAAAGGGG - Intergenic
1111593485 13:90379988-90380010 AACTACCTTCAAAAGCAAAGAGG + Intergenic
1114876164 14:26721031-26721053 AGCTACTTGATGAAGCAATGAGG - Intergenic
1118167802 14:63355337-63355359 AACAACTTACTAAAGCAGAGGGG - Intergenic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1121118421 14:91359706-91359728 AACTTCCTGCAGAAACAAAGGGG + Exonic
1122746828 14:103902402-103902424 AACTATTTGCTCAAATAAAGGGG + Intergenic
1125179738 15:36869148-36869170 AACTACTTGTTGAAGTGAATTGG + Intergenic
1125401097 15:39304079-39304101 AATAACTTGCAAAAGCAAAGTGG + Intergenic
1126437556 15:48651342-48651364 AACTAGAAGCTGAAGCAGAGAGG - Intergenic
1126853254 15:52812143-52812165 AAATACCTAATGAAGCAAAGAGG - Intergenic
1130909325 15:88260348-88260370 GACCACTTGCTGGAGCACAGTGG + Intergenic
1131813298 15:96196578-96196600 AACTTCTTACTGAAGCCTAGGGG - Intergenic
1134870201 16:17645938-17645960 AACCACTGGCTTAAGCAAATGGG + Intergenic
1137390304 16:48075753-48075775 TACCAATTGCAGAAGCAAAGAGG + Intergenic
1137932787 16:52604474-52604496 CACTGCTGGCTGAAGCACAGTGG - Intergenic
1138569372 16:57859141-57859163 AAATACTTTCTGAAATAAAGAGG - Intronic
1141800049 16:86301314-86301336 AGCTACTTGCAGAAGTAAACAGG - Intergenic
1143245548 17:5482371-5482393 AACTACTGGCTGAAAGACAGTGG - Intronic
1145009227 17:19358012-19358034 AACTGCCTGCTGAAGGTAAGGGG - Intronic
1153084595 18:1269782-1269804 AATTACCTGCTGAAGACAAGAGG - Intergenic
1153557179 18:6327191-6327213 AACTACTTGATGAAGCACTTGGG + Intronic
1153847377 18:9062201-9062223 TACTAGTTGCTGAAGGAAAACGG + Intergenic
1155250662 18:23950296-23950318 AATTACTTGCTAAAGGAAAATGG - Intronic
1156511243 18:37638499-37638521 AGTTACTTGATGAAGGAAAGAGG - Intergenic
1156874450 18:41991101-41991123 AACTACTTTCTGTAGCATAATGG - Intronic
1159429064 18:68327353-68327375 AAGATATTGCTGAAGCAAAGGGG + Intergenic
927335633 2:21920560-21920582 AAATATTTGCTGAATCAAATTGG + Intergenic
927607676 2:24502417-24502439 AATTAATTGGTCAAGCAAAGTGG + Intronic
927909452 2:26886113-26886135 CTCTACTTTCTGAAGCAAACAGG - Intronic
928896010 2:36264249-36264271 AACAACTCTTTGAAGCAAAGGGG - Intergenic
930420645 2:51149826-51149848 AACTATCTGATGAAGCAATGAGG - Intergenic
930614147 2:53576019-53576041 AATTACTTGATGAAGCTAATGGG + Intronic
930780541 2:55221202-55221224 AAGTACTTCCTGTGGCAAAGAGG + Intronic
930819422 2:55630573-55630595 AGATTCTTGCTAAAGCAAAGAGG - Intergenic
932369603 2:71176276-71176298 AACTAGTGGATGAAGCAAAGAGG - Intergenic
932422596 2:71610492-71610514 AACTACATGAGGAAGCAAGGTGG - Intronic
933640241 2:84751143-84751165 AACAACTTGCTGAAGAAATTGGG + Intronic
933824466 2:86146272-86146294 AACTACTTGCTGAAGCAAAGAGG + Intronic
935055686 2:99564593-99564615 AACTATTTACTGAGGGAAAGTGG + Intronic
935174924 2:100641397-100641419 AAAATCTTGCTGAAGAAAAGTGG - Intergenic
936259448 2:110946597-110946619 TACTATTTTCTGAAGCAGAGAGG - Intronic
937687818 2:124718249-124718271 AACAGCTTTCTTAAGCAAAGAGG - Intronic
937784939 2:125885785-125885807 AAGTACTTGCTGAAGGCAAAGGG - Intergenic
939933318 2:148258579-148258601 GACTACTTGCTGTAGCCAGGAGG - Intronic
942676969 2:178437037-178437059 AACTACTTTCTGAAGTAAGTAGG + Intronic
942769074 2:179494680-179494702 AACTGGTTGCTGAATCTAAGAGG - Intronic
945676148 2:212857848-212857870 AACTAGAAGCTGAAGCTAAGAGG - Intergenic
946516326 2:220415224-220415246 AACTCTTAGATGAAGCAAAGGGG - Intergenic
1172358134 20:34293810-34293832 AACTACATGATGAAGCGGAGGGG - Intronic
1173441036 20:43076622-43076644 ACCTACTAGTTGGAGCAAAGAGG + Intronic
1174950194 20:55034222-55034244 ATCAACTTGCTGTACCAAAGAGG - Intergenic
1175640773 20:60628448-60628470 AACTACTTCAGGAGGCAAAGAGG + Intergenic
1175744016 20:61441311-61441333 AAGTCCTTTCTGAAGCCAAGGGG - Intronic
1178451003 21:32699694-32699716 AGCTACTTGCTGCTGAAAAGGGG + Intronic
1178692390 21:34760691-34760713 AATTAATTGCTGGAGCCAAGTGG + Intergenic
1183574176 22:38676537-38676559 AACACCTCGCTGAAGCAAACAGG - Intergenic
952258642 3:31717263-31717285 AACTACCTCTTGAAGCAAAATGG - Intronic
953845329 3:46422139-46422161 GACTACTTGCTGCAGCCAGGTGG - Intergenic
955608514 3:60732357-60732379 AACTTCATCCTGAAGCATAGAGG - Intronic
956084477 3:65595762-65595784 AACTACATGGGGAAGCAAATGGG + Intronic
959049614 3:101512643-101512665 AGCTACCTGCTGAGGGAAAGAGG + Intronic
961160508 3:124720507-124720529 AACTCCTTATTGAAGCTAAGGGG + Intronic
962720769 3:138172755-138172777 ATTTACTTGCTGAAGAAAACAGG - Intronic
964309178 3:155374161-155374183 AGCTACATCCTGAAGGAAAGAGG + Intergenic
964432486 3:156621637-156621659 GACTACTTGCTGCAGCCAGGTGG + Intergenic
964921883 3:161907175-161907197 AGATACTTGCTGAAACAAAAAGG - Intergenic
966367088 3:179201383-179201405 AAGTAATTGCTGAAGCAATCAGG + Exonic
967648598 3:191957445-191957467 AATTACTTGCTGAGGGAAGGAGG + Intergenic
967669606 3:192217403-192217425 AAATTCAAGCTGAAGCAAAGAGG + Intronic
970393764 4:15644150-15644172 AAATTCTTGCTGAAGGCAAGAGG - Intronic
971924779 4:32994034-32994056 AACTACTTAGTGAAGCAAATGGG + Intergenic
971950314 4:33336418-33336440 AAGTCCTTGCTGCAGCAAATAGG - Intergenic
974294468 4:59979281-59979303 AACTACTTACTGAATCACAGTGG + Intergenic
975742437 4:77442608-77442630 AAATACTTGCTGAAGGCAAGGGG + Intergenic
976216095 4:82716839-82716861 AAATACTTGAGGAAGCAAAATGG + Intronic
977352027 4:95900801-95900823 AACTACTTTGTAAAGCAAAAAGG + Intergenic
979355130 4:119694654-119694676 AACTCCTTACTGAAGGAAAAGGG + Intergenic
980063982 4:128162180-128162202 AACTTCTTGCTGAAGTAGAATGG - Exonic
981531086 4:145754242-145754264 AGCGACTTGGTGAAGCCAAGAGG - Intronic
987856193 5:23423380-23423402 GACTACTTGCTGCAGCCAGGAGG + Intergenic
989727286 5:44601641-44601663 AAATATTTGCAGAAGCAAAAAGG - Intergenic
990810165 5:59714348-59714370 GACTACTTGCTGCAGCCAGGTGG + Intronic
996806348 5:127458995-127459017 ATCTACTTGACCAAGCAAAGGGG + Exonic
998126838 5:139629843-139629865 AATAACTTGTTGAAACAAAGAGG - Intergenic
998769660 5:145527713-145527735 AACAACTTGCTGAAGGTGAGTGG - Intronic
1004358505 6:14950610-14950632 AACTCCATGCTAAAGCAAAGAGG + Intergenic
1005350715 6:24932551-24932573 AAACAATTGCTGAAGCAAACAGG + Intronic
1005780129 6:29182210-29182232 AAATACTTTCTGAAGCCCAGTGG - Intergenic
1006820783 6:36892842-36892864 AACTACTTTCTGCAGGTAAGTGG + Intronic
1007147943 6:39656202-39656224 AACAACTGGCTGAGGCCAAGTGG + Intronic
1007256096 6:40529987-40530009 AACTTCTAGCTGGAGAAAAGTGG - Intronic
1010110855 6:72229108-72229130 AAGTTCTTGCTGAAGCCCAGTGG + Intronic
1010184929 6:73133353-73133375 AATTACTTACCCAAGCAAAGTGG + Intronic
1011079375 6:83472781-83472803 ACCTTCTTGCTGAAGCAGAGTGG + Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1013543716 6:111135524-111135546 AAATACTAGAGGAAGCAAAGTGG + Intronic
1016165903 6:140943106-140943128 AACTTTTATCTGAAGCAAAGAGG - Intergenic
1022807813 7:33840675-33840697 TCCTAGTGGCTGAAGCAAAGAGG + Intergenic
1023122877 7:36926753-36926775 AACTCATTGCTGAAGCTCAGAGG + Intronic
1024195725 7:47057099-47057121 AAATAATTGCTGAAGAAAATGGG - Intergenic
1034567579 7:151927529-151927551 AAATACTTTGTGAAGCAAGGGGG - Intergenic
1034695215 7:153047454-153047476 AACCACATGCTGGAGCAGAGAGG + Intergenic
1034848659 7:154472430-154472452 GAGGACTTGCTGAAGGAAAGAGG - Intronic
1036962897 8:13265444-13265466 AAATACTTTATGCAGCAAAGTGG + Intronic
1037551300 8:19974351-19974373 AACGAGTTGCCGAAGCACAGGGG - Intergenic
1038329367 8:26595936-26595958 AACTCCCAGCTGAAGCAAAAAGG - Intronic
1041495982 8:58485815-58485837 TACTATTTGCTGAAACAAACTGG - Intergenic
1042293045 8:67189722-67189744 AACTTATTGGTGTAGCAAAGAGG + Intronic
1044034303 8:87280001-87280023 ACCTATATGCTGAATCAAAGAGG - Intronic
1044601576 8:94010378-94010400 AACTAGCTGCTGCAGGAAAGAGG - Intergenic
1047486588 8:125336451-125336473 AACTTCTGGCTGAAGCAGTGTGG - Intronic
1047605736 8:126472339-126472361 AAGTACTTACTGAAGAAATGAGG + Intergenic
1048501372 8:134978504-134978526 AACTATTTTCTGAACCAAAATGG - Intergenic
1050919798 9:11186904-11186926 ATCTACTTGCTGTACCATAGAGG - Intergenic
1052144459 9:25030619-25030641 AACTACTTAATGAAAGAAAGTGG + Intergenic
1057688366 9:97258994-97259016 AACTACTTTAAGAAGAAAAGAGG + Intergenic
1057988582 9:99743591-99743613 AATAACTGTCTGAAGCAAAGAGG - Intergenic
1058312526 9:103522071-103522093 ACTTGCTTGCTGAGGCAAAGGGG - Intergenic
1059871936 9:118587330-118587352 AAAAACTGGCTGAAACAAAGGGG - Intergenic
1060431771 9:123556843-123556865 AACTTCTCTCTGAAGCTAAGAGG + Intronic
1186097318 X:6116353-6116375 ACCTACTTGTTGAATGAAAGTGG - Intronic
1188113084 X:26214972-26214994 ATCTACTTGCTACAGCGAAGAGG - Intergenic
1188388337 X:29589808-29589830 AACTAATTTCTAAAGAAAAGAGG + Intronic
1191101771 X:56737007-56737029 AACTACTTCCTGGAGCTCAGAGG - Intergenic
1191871916 X:65753295-65753317 AACTGGTTGCTTAAGAAAAGAGG + Intergenic
1193551190 X:82894698-82894720 AAATATTTGCTGAAGTAAATAGG - Intergenic
1193912980 X:87328013-87328035 ACCTACCTGCTGAAGAACAGGGG - Intergenic
1193984454 X:88222906-88222928 AGGTGCTTGCTGAAGGAAAGGGG + Intergenic
1194002334 X:88445989-88446011 AACAACTTGGTGAAGCAGAGAGG + Intergenic
1194359978 X:92938043-92938065 AAGTAATTTATGAAGCAAAGAGG + Intergenic
1195712895 X:107789013-107789035 AAATAGTTGGTGAAGCAGAGTGG - Intronic
1199764931 X:150934679-150934701 TTCTCCTTGCTGAAGCAAATTGG - Intergenic
1199792163 X:151165585-151165607 AAGTACTAGCTGAAGCAATTTGG + Intergenic
1200668178 Y:6053864-6053886 AAGTAATTTATGAAGCAAAGAGG + Intergenic