ID: 933827369

View in Genome Browser
Species Human (GRCh38)
Location 2:86174942-86174964
Sequence ATCCCATAGATATTACACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933827369_933827371 1 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827371 2:86174966-86174988 GTTTTCAGAAGAGGAATTGTTGG 0: 1
1: 0
2: 7
3: 67
4: 588
933827369_933827370 -8 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827370 2:86174957-86174979 TATGGGATAGTTTTCAGAAGAGG 0: 1
1: 0
2: 1
3: 22
4: 267
933827369_933827374 10 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827374 2:86174975-86174997 AGAGGAATTGTTGGGTCAAAGGG 0: 1
1: 12
2: 185
3: 2123
4: 12853
933827369_933827372 2 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827372 2:86174967-86174989 TTTTCAGAAGAGGAATTGTTGGG 0: 1
1: 1
2: 17
3: 89
4: 687
933827369_933827375 11 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827375 2:86174976-86174998 GAGGAATTGTTGGGTCAAAGGGG 0: 1
1: 1
2: 9
3: 33
4: 280
933827369_933827373 9 Left 933827369 2:86174942-86174964 CCGTAGTGTAATATCTATGGGAT 0: 1
1: 0
2: 0
3: 6
4: 108
Right 933827373 2:86174974-86174996 AAGAGGAATTGTTGGGTCAAAGG 0: 1
1: 4
2: 56
3: 272
4: 1060

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933827369 Original CRISPR ATCCCATAGATATTACACTA CGG (reversed) Intronic
907529782 1:55083230-55083252 AAACCATAGCTATTCCACTAGGG + Intronic
908889540 1:68828625-68828647 ATACTATAGTTATCACACTATGG - Intergenic
909607468 1:77521643-77521665 ATTTCATAGATATTAAAATATGG + Intronic
912031091 1:105244999-105245021 AACCCATTGATACTACAATATGG - Intergenic
913130759 1:115837292-115837314 ATCCCCAAGATATGACACCAAGG - Exonic
913359253 1:117961548-117961570 ATCCCAAAGATTTAAAACTATGG + Exonic
917491584 1:175502952-175502974 ATCCCATAAATATTAGAGCAGGG + Intronic
920764230 1:208816344-208816366 ATCCAATAAATATTACGCAAAGG + Intergenic
922709253 1:227814896-227814918 ATCCCATTGATTCTACATTATGG - Intergenic
1063643787 10:7858125-7858147 ATCCCATAGTTCTTTTACTATGG - Intronic
1063734780 10:8740461-8740483 AGCCCAGAGATATTATACCAAGG - Intergenic
1064477790 10:15709577-15709599 ATCCCATAGACCTTAAAATATGG - Intronic
1065613613 10:27498099-27498121 ATCCCAAATATATTACATTCTGG - Intergenic
1070438634 10:76419309-76419331 ATTCCATTTATATTACATTATGG - Intronic
1073678766 10:105679426-105679448 GTCCCACAGATAATAGACTAGGG + Intergenic
1075226262 10:120632232-120632254 AACCCATAGGTATTAATCTAAGG - Intergenic
1078890489 11:15552415-15552437 AATCCATTGTTATTACACTAGGG + Intergenic
1079766377 11:24398446-24398468 CTCTCATACCTATTACACTATGG + Intergenic
1081481761 11:43496164-43496186 ATTCCATTTATATGACACTATGG - Intergenic
1085586506 11:77712790-77712812 AACTCATAGATATTATTCTATGG + Intronic
1085684516 11:78609661-78609683 ATCCCCTAGAAATTTCACCAAGG - Intergenic
1086071023 11:82799421-82799443 ATCAAAAAGATAATACACTATGG - Intergenic
1086267260 11:85015871-85015893 ATCTCATAGAAATTACAGAATGG + Intronic
1086594448 11:88554291-88554313 ATCACAAAGATATTACAAGAGGG - Intronic
1086998619 11:93389773-93389795 ATCTCATAGATTTTACCTTAGGG - Intronic
1087370253 11:97274470-97274492 ATCCTATGGAGACTACACTAAGG + Intergenic
1088002756 11:104902175-104902197 CTCCTATAGATATTTCACTCAGG - Intergenic
1090518537 11:127454102-127454124 ATCCCACTGATATTGCACGAGGG - Intergenic
1104129155 12:125876154-125876176 ATCCCAGAATTATTACACTTAGG + Intergenic
1108913872 13:55584978-55585000 AAGCCATTGATATGACACTATGG + Intergenic
1116922043 14:50589028-50589050 ATACCATAGATTTTGCACTTAGG + Intronic
1118927669 14:70207576-70207598 ATCCCATAGACATTTCATTTAGG + Intergenic
1123889543 15:24762813-24762835 ATTCCATTGATATGACACTTTGG - Intergenic
1124556770 15:30733304-30733326 ATCCCCTATATATCTCACTAAGG - Intronic
1131240857 15:90741873-90741895 ATACCATATATTTTACACTAGGG - Intronic
1144039573 17:11397860-11397882 CTCCCTTGGATATGACACTAAGG - Intronic
1149856686 17:60088861-60088883 ATCCCAGAGAAATTACAGTCTGG + Intergenic
1153049571 18:888945-888967 ATCCCAGAGATAGTACACTCTGG + Intergenic
1153649478 18:7227196-7227218 TTCCCGTAGATATTCCATTAGGG + Intergenic
1156536509 18:37869766-37869788 CTCCCATTGATTTTACATTATGG - Intergenic
1162653348 19:12108604-12108626 ATGCTATAGAAATTACACAATGG - Intronic
926553704 2:14331923-14331945 ATCCCATATATATTTTAATATGG + Intergenic
927346447 2:22048960-22048982 ATCACATAGCTAGTACATTATGG + Intergenic
930320700 2:49851550-49851572 ATTTCATTTATATTACACTAGGG + Intergenic
933827369 2:86174942-86174964 ATCCCATAGATATTACACTACGG - Intronic
935119622 2:100172303-100172325 TTTCCATAGAAATTACACTGTGG - Intergenic
943190756 2:184677303-184677325 ATCCTCTAGATATTACTATATGG - Intronic
943430482 2:187794496-187794518 ATCCTGAAGATATTTCACTAAGG + Intergenic
943640451 2:190352363-190352385 ATCCAATAAATATTACAGTTTGG - Intronic
943991446 2:194698446-194698468 TTCCCATTGATTTTACATTATGG + Intergenic
944249730 2:197569164-197569186 ATGCCATAGATACTACACCAAGG + Exonic
1170041732 20:12045716-12045738 ATTCCAGAGATATTAAACGATGG - Intergenic
1172045608 20:32077963-32077985 ATCCCATAGACCTTGCACAAGGG - Intronic
1174861301 20:54093993-54094015 ATACCATAGATATGAAAATAAGG - Intergenic
1177302360 21:19264652-19264674 ATTCCAAAGATATGACATTATGG - Intergenic
1180624417 22:17184559-17184581 ATCCCACCGATTTTACAATAAGG - Intronic
1182938063 22:34245372-34245394 ATCCAATGGACATTACAATAGGG - Intergenic
1183027096 22:35073435-35073457 ATCCCATTGATTCTACATTATGG - Intronic
953330884 3:42052175-42052197 ATCCCTAAGATATGACACAATGG - Intronic
953860176 3:46537529-46537551 ATCATTTACATATTACACTAAGG - Intronic
956594961 3:70957497-70957519 TTACCAAAGATATTACACAAAGG - Intronic
958630627 3:96678308-96678330 ATCCCCAAGATATCACATTATGG - Intergenic
960438256 3:117653956-117653978 ATCCCAAAGATAATTCACTCTGG + Intergenic
964806917 3:160620250-160620272 ATCACATATATTTTACTCTATGG + Intergenic
966843584 3:184108498-184108520 ATCCCATAGGTTTTAGAATAAGG + Intergenic
974157511 4:58093273-58093295 ATCCCATCGATTCTACATTATGG - Intergenic
976553361 4:86422060-86422082 ATGCCATAGATAATACAGTGGGG - Intronic
979161282 4:117464517-117464539 ATCCCACAGATTCTGCACTATGG + Intergenic
980238538 4:130140733-130140755 ATACCATGGATATAACATTATGG - Intergenic
980718415 4:136659539-136659561 ATCACATAGATGTTTCACTTAGG - Intergenic
982159899 4:152557852-152557874 ATTCCATATATATAACACTTTGG + Intergenic
983655200 4:170075897-170075919 ATCTGATACATATTACAGTATGG - Intronic
986385581 5:7230481-7230503 TTCCCATTGTTATTACACTCTGG - Intergenic
987110073 5:14677579-14677601 AAACCATATATATTAAACTAGGG + Intronic
987906387 5:24083075-24083097 GACCCATAGATATTTCACTCAGG - Intronic
990941736 5:61209084-61209106 AACTCAGAGATATTACACAAGGG - Intergenic
994865341 5:105261780-105261802 ATACCACAGATAGTACTCTAAGG + Intergenic
995478212 5:112569218-112569240 ATCCTCTAGATTTTGCACTAAGG - Intergenic
996259857 5:121453630-121453652 ATAGCATACATTTTACACTAAGG + Intergenic
999096512 5:148983036-148983058 ATCCCATAGATGGGACACTGAGG - Intronic
999631966 5:153580673-153580695 ATCTCATTAATATTACACTCTGG + Intronic
999843502 5:155453843-155453865 ATGCCATAGAAATCACACTGAGG + Intergenic
1000422615 5:161055681-161055703 ATCCCATAGATTAAATACTATGG + Intergenic
1008948589 6:57128843-57128865 ATTCTTTAGAAATTACACTAAGG + Intronic
1011157162 6:84345747-84345769 ATACACTAGATATTAGACTATGG - Intergenic
1011804950 6:91061210-91061232 ATCCCACTGATTCTACACTATGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1012219066 6:96626189-96626211 ATCCCACAGTTATTACAAGAAGG + Intergenic
1012697789 6:102410606-102410628 CTGTCATAGATATTATACTATGG - Intergenic
1014761011 6:125356727-125356749 ATCCTTTGGATATGACACTAAGG + Intergenic
1015263130 6:131261384-131261406 ATCCTAGAGATAATAAACTAAGG + Intronic
1015649019 6:135432872-135432894 ATATGATAGATATGACACTAAGG - Intronic
1018968101 6:168504338-168504360 CTCCCACTGATTTTACACTATGG - Intronic
1021498907 7:21307725-21307747 ATCCCATTGATTCTACATTATGG - Intergenic
1022388942 7:29927089-29927111 ATTCCATAGATTTTTCAGTAAGG - Intronic
1022529687 7:31059247-31059269 ATCTCATAGATGTTACAGTGAGG - Intronic
1023415275 7:39926318-39926340 AGCCCATAGAGATTGCACAAGGG - Intergenic
1023601131 7:41882867-41882889 AGCCCATAGATATGACCCTGGGG + Intergenic
1027299181 7:76812024-76812046 ATCCAATAATTATTACACTAAGG - Intergenic
1030959488 7:115898745-115898767 ATTCCATAGACATTCCACGATGG - Intergenic
1034967885 7:155402736-155402758 ATACCAGCTATATTACACTAGGG + Intergenic
1035326066 7:158066962-158066984 ATCCCACAAAAATTACAGTAGGG + Intronic
1042731620 8:71941458-71941480 ATTCCATTTATATGACACTATGG - Intronic
1044481632 8:92697453-92697475 ATCTCACAGATATAACATTAAGG + Intergenic
1051833379 9:21306933-21306955 ATCACATTTACATTACACTATGG - Intergenic
1057426125 9:94951179-94951201 ATCTCTTAGACATTACACTCTGG - Intronic
1057691471 9:97290499-97290521 GTCCCATAGATAGCACAGTAAGG - Intergenic
1059059244 9:111017505-111017527 ATGCCATTGATATTACAGTCAGG - Intronic
1186960313 X:14729406-14729428 ATCCCATACATTTTTCTCTAAGG + Intronic
1189466661 X:41282724-41282746 GTCCCATAGAAATTACCCTAGGG + Intergenic
1190795972 X:53742718-53742740 ATCTCATAGATAATGCACTGTGG + Intergenic
1193970385 X:88043562-88043584 ATCCAAAAGATAATACACAATGG + Intergenic
1194022817 X:88714864-88714886 ATCCCATACATATCAATCTATGG + Intergenic
1200302490 X:154991664-154991686 ATCCCATAAATAATACACTGTGG + Intronic
1202193165 Y:22265932-22265954 CTCCCATAGATTCTACATTATGG - Intergenic