ID: 933833420

View in Genome Browser
Species Human (GRCh38)
Location 2:86228049-86228071
Sequence TTTGCTTAAAGGGTCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933833420_933833427 3 Left 933833420 2:86228049-86228071 CCTGCCCTGACCCTTTAAGCAAA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 933833427 2:86228075-86228097 GAAAACTCCAGGCAAGAGAGAGG 0: 1
1: 0
2: 1
3: 27
4: 323
933833420_933833428 4 Left 933833420 2:86228049-86228071 CCTGCCCTGACCCTTTAAGCAAA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 933833428 2:86228076-86228098 AAAACTCCAGGCAAGAGAGAGGG 0: 1
1: 1
2: 4
3: 34
4: 394
933833420_933833426 -8 Left 933833420 2:86228049-86228071 CCTGCCCTGACCCTTTAAGCAAA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 933833426 2:86228064-86228086 TAAGCAAAGAGGAAAACTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 333
933833420_933833429 9 Left 933833420 2:86228049-86228071 CCTGCCCTGACCCTTTAAGCAAA 0: 1
1: 0
2: 0
3: 10
4: 138
Right 933833429 2:86228081-86228103 TCCAGGCAAGAGAGAGGGTCAGG 0: 1
1: 0
2: 3
3: 40
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933833420 Original CRISPR TTTGCTTAAAGGGTCAGGGC AGG (reversed) Intronic
905483633 1:38279872-38279894 TTAGCTCAGAGGGTCAGGGAAGG - Intergenic
905511229 1:38522081-38522103 TTGGCTTATAGGGTCAGAGAAGG - Intergenic
906475778 1:46168512-46168534 CTGGCTCATAGGGTCAGGGCTGG - Intronic
909563065 1:77026262-77026284 AGTGCTTACAGGGTCTGGGCAGG - Intronic
913985865 1:143565503-143565525 TTTGTTTCCAGGGTCAGTGCTGG - Intergenic
915868428 1:159530806-159530828 TTTATTTACAGGGTCAGGGAAGG + Intergenic
916306903 1:163346556-163346578 TTCACTTCCAGGGTCAGGGCTGG + Intronic
918778801 1:188670058-188670080 TTTGCATAAAGGCTCTGAGCTGG + Intergenic
919613606 1:199777454-199777476 TTTGAATAAAGGGTCTAGGCAGG + Intergenic
920370292 1:205474600-205474622 TTAGCTTAGGTGGTCAGGGCAGG - Intergenic
922145968 1:222944868-222944890 TCTGATTAAAGAGTCAGGGCTGG + Intronic
922427351 1:225511205-225511227 TTTGATTAAAGACTAAGGGCTGG - Intronic
923069839 1:230552612-230552634 TTTACTTGAACGGTCATGGCAGG + Intergenic
923195024 1:231657652-231657674 TTTGCTTAAGGTGTAAGGGATGG + Intronic
1065396185 10:25240510-25240532 TTTGACTAAATGGTCAGGACAGG + Intronic
1069809616 10:71148738-71148760 ATTCCTTAAAGGGGGAGGGCAGG - Intergenic
1070940069 10:80336783-80336805 TTGGCTTACAGGATCAGTGCGGG - Intronic
1072105153 10:92266735-92266757 TTAGCTTAGATGGTCATGGCTGG + Intronic
1074748795 10:116563136-116563158 TTTGCTTAAAAGGTCAGTAAAGG + Intronic
1075018427 10:118928424-118928446 GTTGCTTCAAGGGCCAGGGAAGG - Intergenic
1075927440 10:126264213-126264235 TTTGCTTAATGGGTGCTGGCCGG + Intronic
1076278484 10:129225319-129225341 TTTGCTTTAGGGGCCAGAGCTGG + Intergenic
1079130579 11:17744734-17744756 TGTGCTGGAAGGGCCAGGGCTGG + Intronic
1079259852 11:18867996-18868018 TAAGCTTAAAGGGACAGGGAAGG - Intergenic
1088069878 11:105769308-105769330 TTTGCTTAGAGAGTAAGGGGAGG + Intronic
1091921314 12:4307230-4307252 TTTCCTTAAAGGCTCAGTACAGG - Intergenic
1093829513 12:23738306-23738328 TATTATTTAAGGGTCAGGGCAGG - Intronic
1096795011 12:54071325-54071347 TTTGCTTAGAGTCTCAGAGCTGG - Intergenic
1098051783 12:66461934-66461956 TTTGCTTTAAGGAATAGGGCAGG + Intronic
1100052602 12:90467826-90467848 TTTGGTTAGAGGGCCAGGGGTGG - Intergenic
1100640222 12:96475453-96475475 TTTGCTTATAAGGCCAAGGCGGG + Intergenic
1102188985 12:110971657-110971679 TCTGCTTACAGGGACAGGACAGG - Intergenic
1105766603 13:23566341-23566363 TTTTCTTAAAGGGCCAGTTCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107730808 13:43346418-43346440 TCTGGTTAAAGTGTGAGGGCAGG - Intronic
1107899550 13:44998272-44998294 TTTGGTTAAATGCTAAGGGCAGG - Intronic
1109038043 13:57291950-57291972 TTTGCTTCCAGGGTAAGGGGAGG + Intergenic
1109843543 13:67952798-67952820 TTTGCTTAAAAGGTCTGGACTGG - Intergenic
1112698508 13:101977420-101977442 TTGGTTTAAAGGCTCAAGGCTGG + Intronic
1121799420 14:96761293-96761315 TTTTCGAAAAGGGTCAGGGAAGG + Intergenic
1121994657 14:98592939-98592961 TCTGCTTGAAGTGGCAGGGCTGG - Intergenic
1130028909 15:80294536-80294558 CTTGTTTAAAGCATCAGGGCTGG + Intergenic
1130559363 15:84946505-84946527 TGTGCCTAAAGGGACAGAGCTGG + Intergenic
1139774338 16:69305908-69305930 TTAGCTTAAAGGGTGGAGGCGGG - Exonic
1140477532 16:75246459-75246481 TTTGCATACAGGGTCAGAGACGG + Intronic
1143402192 17:6653495-6653517 TTTGATAAAATGGTCAGGGAAGG + Intergenic
1145831316 17:27918837-27918859 TTTCCTTAAAGTGATAGGGCAGG - Intergenic
1147318141 17:39630620-39630642 TTGCCTCAAAGGGTCAGGGAGGG + Intronic
1147794039 17:43030104-43030126 TTTCCTTTAAGGGACAGGGTAGG - Intergenic
1147889707 17:43708682-43708704 TTTTTTTAAAGGATCAGGGTAGG + Intergenic
1148384297 17:47223143-47223165 TCCTCTTAAGGGGTCAGGGCTGG - Intronic
1149010430 17:51850989-51851011 TCTGCAGAAATGGTCAGGGCAGG - Intronic
1149854201 17:60065361-60065383 ATTCCTTAAGGGGTCAGGGGTGG - Intronic
1150996919 17:70329290-70329312 TTTGCTTAAGGGGAATGGGCAGG - Intergenic
1152740460 17:82016296-82016318 CTTGCTTACAGGGGTAGGGCTGG + Intronic
1158309194 18:56140436-56140458 TTTGCATAATGGGTCAGTCCCGG + Intergenic
1160374562 18:78401649-78401671 TTTACTTTAAGGGCCTGGGCGGG - Intergenic
1161222446 19:3123899-3123921 TCTGGATTAAGGGTCAGGGCCGG - Exonic
1161857287 19:6773125-6773147 TATGCTTACAGGTCCAGGGCTGG + Intronic
1167720644 19:51177951-51177973 TTTGCTTAGAGGGTTGGAGCAGG - Intergenic
925727242 2:6884969-6884991 CTGGCTTAATGGGTCAGGGATGG + Intronic
926365473 2:12129300-12129322 ATTGCTTAAGGTGACAGGGCTGG + Intergenic
927286168 2:21359152-21359174 TGTGCTTAGAAGGTCAGTGCAGG - Intergenic
927508429 2:23629268-23629290 TCTGCTGAAAGGTGCAGGGCAGG - Intronic
929560637 2:42954328-42954350 TTTGCTTAAAGTGACTGGCCTGG - Intergenic
929593601 2:43162224-43162246 TTTGCTATGCGGGTCAGGGCTGG - Intergenic
930804774 2:55479439-55479461 TTTGCCTAAAGGGTGGGGGGAGG - Intergenic
933833420 2:86228049-86228071 TTTGCTTAAAGGGTCAGGGCAGG - Intronic
935710754 2:105896219-105896241 TTTGCTTGAAGTCCCAGGGCCGG - Intergenic
935796319 2:106644750-106644772 TTAGCTGTAGGGGTCAGGGCTGG + Intergenic
936977279 2:118232578-118232600 TTTGCTGAGTGTGTCAGGGCAGG - Intergenic
944690162 2:202151532-202151554 TTGGCTTAAATGGTCAGAGGAGG - Intronic
946459620 2:219857372-219857394 TTTGCCCAAGGGGTCAAGGCTGG - Intergenic
946492895 2:220167163-220167185 TTTGATTGAAGGATCAAGGCTGG + Intergenic
948185648 2:236019399-236019421 TTTGATTTAGGGGTCAGGACAGG + Intronic
1169936098 20:10884976-10884998 TTTGGTTAAATGGTCAGGGATGG + Intergenic
1170576587 20:17667247-17667269 TTTTCTTAAAGGGGGAAGGCTGG + Intronic
1171238265 20:23545393-23545415 TTTTCTCAGGGGGTCAGGGCTGG - Intergenic
1172441826 20:34971492-34971514 TTTGCTTCAAGCCTCAGAGCTGG + Intergenic
1172952224 20:38729480-38729502 TGTGGTTAAAGGGTCCGGGGAGG + Intergenic
1173969096 20:47137319-47137341 TTTGCTTAAAGGCTCAAGGAAGG + Intronic
1176522422 21:7834371-7834393 TATGCTTAGAGGCTCAGAGCTGG - Intergenic
1178656442 21:34464383-34464405 TATGCTTAGAGGCTCAGAGCTGG - Intergenic
1182083847 22:27548023-27548045 TTAGATTGATGGGTCAGGGCTGG - Intergenic
1184214303 22:43056480-43056502 TTTTTTTAAAGAGACAGGGCTGG + Intronic
1184408175 22:44311971-44311993 ATCACTTAAAGTGTCAGGGCAGG + Intronic
1185328366 22:50239060-50239082 TTGGGTGAAAGGGTCAGGGCTGG - Intronic
950466537 3:13158676-13158698 TATGCTTCTAAGGTCAGGGCTGG + Intergenic
950565132 3:13764874-13764896 TTGGCAGAAAGTGTCAGGGCTGG - Intergenic
951610924 3:24492422-24492444 TTTGCTCAAGTGGTCAGGGAAGG + Intronic
956067621 3:65413734-65413756 TTTGCTTAAAGGCTGAGTACAGG + Intronic
956133420 3:66075570-66075592 TTTGCTGAAAGAGTCAGGAGAGG + Intergenic
956522351 3:70119594-70119616 TTTGCTTAAATGGTCTGTCCAGG - Intergenic
957459748 3:80501238-80501260 TGTGATGAAAGGGGCAGGGCAGG + Intergenic
961589334 3:127964305-127964327 TGTGCTTAAAGAGTGAAGGCAGG - Intronic
962510848 3:136099089-136099111 CTTGCTTGGAGGTTCAGGGCAGG - Intronic
963886243 3:150586078-150586100 TTTGTTTAAAAGGACAGGCCGGG + Intronic
965532475 3:169787042-169787064 TTTGCTTAAATTATGAGGGCAGG - Exonic
965879228 3:173368674-173368696 ATGGCTTAAAGAGTCAGTGCTGG + Intergenic
966262140 3:177991927-177991949 ATTGCTTAAAGGGTAAGGGATGG + Intergenic
966803453 3:183786263-183786285 TTTGCTGAGAGGGCCACGGCAGG - Exonic
970562013 4:17291356-17291378 TCTGCTAAAAGGACCAGGGCAGG - Intergenic
970582229 4:17483948-17483970 TTTGATTAAAGAGACAGGCCAGG + Intronic
973703359 4:53558025-53558047 TTTGCTTAAAGGAGCTTGGCTGG - Intronic
974584909 4:63861231-63861253 TTTGTATAAAGGATCAGGACTGG - Intergenic
974735028 4:65919180-65919202 TTTGCTTAAATGGTCTGGTGTGG + Intergenic
978403099 4:108351064-108351086 TTTTCTTAAACAGTCAGGGTAGG - Intergenic
980738272 4:136918200-136918222 TGGGCTTAAAGGCTGAGGGCCGG + Intergenic
985798468 5:1984059-1984081 TTTGGTCAAAGGCTCAGGACTGG - Intergenic
987422207 5:17734061-17734083 TTTGATTAAACTGTCAGGCCAGG + Intergenic
991412302 5:66357424-66357446 TTAGTTAAAAGGGTGAGGGCTGG + Intergenic
993514523 5:88814078-88814100 TGTGTTTAAAGGGTTAGGGCTGG + Intronic
994654373 5:102571763-102571785 TTTGCTTAATTGTTCAGGCCAGG - Intergenic
996754039 5:126917424-126917446 TGTGCGTGAAGGGTCAGGGATGG + Intronic
996808098 5:127480849-127480871 TTTGGTTCAAGGTTTAGGGCAGG + Intergenic
997758254 5:136420647-136420669 TTTTCTGAAGGGGTCAGGGGTGG - Intergenic
1000042031 5:157491889-157491911 TTTGCTTTGAGGGGCAGTGCAGG - Exonic
1001504786 5:172269775-172269797 TTTTCTTTAAGAGTCAGGGTAGG + Intronic
1004358260 6:14948737-14948759 GTTGATTAAAGTGTCAGGTCGGG - Intergenic
1005437640 6:25832166-25832188 TTTCCTTAAAGCTTCAGGGAAGG + Intergenic
1006282932 6:33069717-33069739 TTTCCTTTGAGGCTCAGGGCGGG - Exonic
1006440707 6:34052013-34052035 TGTGCTGAAGGGGTCAGGGTTGG - Intronic
1007164959 6:39822685-39822707 TTTCCTTAAAGATGCAGGGCTGG + Intronic
1009739105 6:67722163-67722185 TTTGCTTATAGGGTTAGGAATGG + Intergenic
1012500316 6:99881160-99881182 TTAGCCTGAAGGATCAGGGCTGG + Intergenic
1016438235 6:144059318-144059340 ATGGCTTAAAGGGCCAGGCCTGG - Intronic
1020331492 7:7021855-7021877 TTTACTTGAAGGGGCAGGGTGGG - Intergenic
1028955144 7:96680976-96680998 TTAGCTTAAATGATCAGGGAAGG + Intronic
1029388169 7:100257310-100257332 TTTGCAGAGGGGGTCAGGGCAGG + Intronic
1032491460 7:132327393-132327415 TTTACTTGAAGGTTCAGGGAAGG + Intronic
1034469133 7:151246398-151246420 TTTGCTCCCAGGGTGAGGGCTGG + Intronic
1034700028 7:153087824-153087846 TGCGCTTAGAGGGTCAGTGCAGG + Intergenic
1037839009 8:22231085-22231107 TTGGCATGAAGGCTCAGGGCTGG - Intronic
1044426938 8:92062801-92062823 TCTGCCTAAAGAGACAGGGCTGG - Intronic
1045311483 8:101007250-101007272 CATGCTTGATGGGTCAGGGCAGG - Intergenic
1046811516 8:118538393-118538415 TTAGCTTACAGTGGCAGGGCTGG + Intronic
1047047643 8:121072864-121072886 CTTCCTTAAAAGGTCAGGGGTGG - Intergenic
1049126444 8:140793485-140793507 TTTCTTTAAAGGGTCATTGCTGG - Intronic
1049259331 8:141630349-141630371 TTTGCCTGATGGGGCAGGGCAGG - Intergenic
1055996571 9:82166718-82166740 TTAGATTAAGGGGTCAGGGAAGG + Intergenic
1059031382 9:110701092-110701114 TTTTGTTAAAGGGTCAGGGAAGG + Intronic
1060518971 9:124283164-124283186 CTTCCTGAGAGGGTCAGGGCTGG - Intronic
1062144782 9:134983010-134983032 TTTGCTGAGAGGGACAGGCCAGG + Intergenic
1187663696 X:21579128-21579150 TTTGCTCCGAAGGTCAGGGCAGG - Intronic
1189367442 X:40399793-40399815 TGTCCTTAAAGGGAAAGGGCAGG - Intergenic
1189999815 X:46675168-46675190 TTTGCTTAGAGGGCCTTGGCAGG - Intronic
1193625213 X:83811659-83811681 TTTGTTTACAGGGTCAGTGCTGG + Intergenic
1198713719 X:139533689-139533711 TTTGTTGACAGGGTCAGGGCCGG + Intronic
1200391417 X:155950322-155950344 TTTGGGTAAAGGATCAGGTCAGG + Intergenic