ID: 933833787

View in Genome Browser
Species Human (GRCh38)
Location 2:86230316-86230338
Sequence CCTCCCCTGGTGAATTATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 106}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933833787_933833793 -5 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833793 2:86230334-86230356 GGAGGTCTAGGCAGGAGGCCTGG 0: 1
1: 0
2: 20
3: 140
4: 2088
933833787_933833799 11 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833799 2:86230350-86230372 GGCCTGGATTCTGGGCCTGGGGG 0: 1
1: 0
2: 4
3: 56
4: 454
933833787_933833792 -10 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833792 2:86230329-86230351 CCAGGGGAGGTCTAGGCAGGAGG 0: 1
1: 0
2: 11
3: 179
4: 4994
933833787_933833794 2 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833794 2:86230341-86230363 TAGGCAGGAGGCCTGGATTCTGG 0: 1
1: 0
2: 2
3: 47
4: 358
933833787_933833798 10 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833798 2:86230349-86230371 AGGCCTGGATTCTGGGCCTGGGG 0: 1
1: 0
2: 7
3: 62
4: 400
933833787_933833797 9 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833797 2:86230348-86230370 GAGGCCTGGATTCTGGGCCTGGG 0: 1
1: 0
2: 4
3: 53
4: 382
933833787_933833796 8 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833796 2:86230347-86230369 GGAGGCCTGGATTCTGGGCCTGG 0: 1
1: 1
2: 10
3: 65
4: 547
933833787_933833795 3 Left 933833787 2:86230316-86230338 CCTGAATAATTCACCAGGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 933833795 2:86230342-86230364 AGGCAGGAGGCCTGGATTCTGGG 0: 1
1: 0
2: 11
3: 82
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933833787 Original CRISPR CCTCCCCTGGTGAATTATTC AGG (reversed) Intronic
902687975 1:18091262-18091284 TCTCCCCAGGGGGATTATTCTGG - Intergenic
902737961 1:18413692-18413714 GCCCTCCTGGTGAATTATGCAGG + Intergenic
905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG + Intergenic
908266020 1:62380381-62380403 TCTCCCCCGGTGAATTATTTTGG - Intergenic
915620034 1:157076074-157076096 CCTTCCCTGCTTATTTATTCAGG + Intergenic
916235491 1:162583781-162583803 CCACACCTGGTTAATTTTTCTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063243238 10:4192562-4192584 CCACACCTGCTGCATTATTCGGG + Intergenic
1063610961 10:7561670-7561692 CCTTCCCTGGGGAAACATTCAGG - Exonic
1069108990 10:64420879-64420901 CCTCCCCCATAGAATTATTCAGG - Intergenic
1070483645 10:76909686-76909708 ACTCCCTTGGGGAATTTTTCTGG + Intronic
1075167216 10:120079492-120079514 CTTCCCCTTGTGACTTAGTCTGG - Intergenic
1080690981 11:34557694-34557716 CCTTCCCTGGTATATTAGTCAGG + Intergenic
1086158305 11:83693005-83693027 TCTCCCCTGGTCAGTGATTCAGG - Intronic
1088361190 11:108991911-108991933 CCTCCCCTCCTGACTAATTCAGG - Intergenic
1091588446 12:1829019-1829041 TCTCACATGGTGAATAATTCAGG - Intronic
1092820446 12:12349221-12349243 ACTCCCCAGGTTAATAATTCTGG + Intronic
1092972888 12:13715175-13715197 CCTGACAGGGTGAATTATTCTGG + Intronic
1097421800 12:59390106-59390128 CCTCCCCCGGGGAATTCATCAGG - Intergenic
1100614684 12:96221927-96221949 CCTCCCCAAGGCAATTATTCTGG + Intronic
1104548128 12:129731062-129731084 ACACCCCTGGTGTATTAATCAGG - Intronic
1106143824 13:27034695-27034717 CCTCGCCTGGTGTTCTATTCAGG + Intergenic
1106428746 13:29659042-29659064 CCTCACCTGGAGAATTATTTTGG + Intergenic
1113954969 13:114095192-114095214 CCTCCATTGGTGAATAATTTGGG + Intronic
1114301554 14:21383710-21383732 CCGCCTCCGGTGAATGATTCGGG + Intronic
1116572344 14:46534396-46534418 CCTCCGCTGGTGAGATACTCAGG - Intergenic
1118756946 14:68851832-68851854 CCTACCCTGGAGAATTATCCAGG - Intergenic
1121269607 14:92629262-92629284 CCTCCACTGGTGACATATTTTGG - Intronic
1121744693 14:96278949-96278971 CCTGCCCTGGTGAATGAGGCAGG + Intergenic
1122015918 14:98796482-98796504 CCTCCTCTCCTGAATTATTTGGG - Intergenic
1125373273 15:39000608-39000630 CCTCCACTGGTGATATCTTCAGG + Intergenic
1129536400 15:76316636-76316658 CCTCCCCTGGTGCACCCTTCTGG - Intergenic
1129607776 15:77033169-77033191 CCTCCCCTAGTGAATAATTGGGG - Intronic
1129754539 15:78089427-78089449 CCTTCCATGGTGAATGATGCTGG - Intronic
1132150811 15:99457002-99457024 CCTCTCCTGCTGAATTAGTGTGG + Intergenic
1136863903 16:33725163-33725185 CCGCCCCGGCTGATTTATTCGGG + Intergenic
1139408773 16:66741598-66741620 CCCCCTCTGGTGAATTAATGAGG - Intronic
1203125390 16_KI270728v1_random:1573301-1573323 CCGCCCCGGCTGATTTATTCGGG + Intergenic
1143938305 17:10510545-10510567 CCTGCCCTGCTTTATTATTCGGG + Intronic
1144619608 17:16809014-16809036 CCTCTCCACGTGCATTATTCTGG - Intergenic
1144893077 17:18506690-18506712 CCTCTCCACGTGCATTATTCTGG + Intergenic
1145139139 17:20437602-20437624 CCTCTCCACGTGCATTATTCTGG - Intergenic
1158031606 18:52972123-52972145 CCTCCACTGGTCAAATATCCTGG + Intronic
1159306944 18:66655113-66655135 ACTCTCCTGGTGAAGCATTCAGG - Intergenic
1159428408 18:68319674-68319696 TCTCACCTGGTGAATTCTTAAGG - Intergenic
1161368421 19:3894656-3894678 CCACACCTGGTTAATTTTTCAGG - Intronic
1162351314 19:10151449-10151471 CTTCCCCTGGTGCATTTTTTTGG + Exonic
1164552183 19:29221045-29221067 CCTCCTCTGGTGACATCTTCTGG + Intergenic
1164734155 19:30528457-30528479 CCTCTACTGGTGAAGTCTTCTGG - Intronic
1165158376 19:33801791-33801813 CCTCCCCTTGTGAATTTCCCAGG - Intronic
931436834 2:62254881-62254903 CTTCCTCTAATGAATTATTCTGG - Intergenic
932863661 2:75319566-75319588 CCTCCCTTGCTGAATTGTTTGGG - Intergenic
933652753 2:84862422-84862444 CCTGCCCTGGTGAACTAGGCTGG - Intronic
933702011 2:85262437-85262459 CCTCCCCTGAGGAATTCTTTTGG + Intronic
933833787 2:86230316-86230338 CCTCCCCTGGTGAATTATTCAGG - Intronic
934802688 2:97181854-97181876 AATCCCCTGCTGATTTATTCGGG - Intronic
938579677 2:132634760-132634782 CCCCCTCAGGTGAATTATTTTGG + Intronic
938942124 2:136178590-136178612 CCTCCCCTGGGGTATAAGTCAGG + Intergenic
939637062 2:144595071-144595093 CCTCCCCTTCTCAATCATTCTGG - Intergenic
945642530 2:212446666-212446688 CATACCCTGGTGTATTAGTCAGG - Intronic
1169746475 20:8948027-8948049 GCTCCCCAGATGAATTATTTTGG - Intronic
1170086287 20:12535737-12535759 GGTCCCCTGGTTAAGTATTCAGG - Intergenic
1174296046 20:49545910-49545932 CCTGCCCTGGTGGATTACCCAGG - Intronic
1177219188 21:18168323-18168345 CCTCCCCAGATGTATTAGTCAGG - Intronic
950128163 3:10523704-10523726 CCTCCCCCGCTTGATTATTCGGG + Intronic
955071559 3:55576409-55576431 CCTCCCCTGAAGGATTATTTTGG - Intronic
960016410 3:112894381-112894403 GCTACCATCGTGAATTATTCAGG - Intergenic
961122624 3:124385663-124385685 CTCCACTTGGTGAATTATTCAGG - Intronic
962992027 3:140586604-140586626 TCTCCCCAGGTGTATTATTAAGG + Intergenic
965941451 3:174187626-174187648 CCTGGCCTTGTGAATTATTGTGG - Intronic
966448697 3:180033049-180033071 TCGCCCCTGGTGATTTATTTAGG - Intronic
968313187 3:197700922-197700944 CATCACCTGGGGAATCATTCTGG + Exonic
970161318 4:13192339-13192361 CCTCCCATGTTGAATTCCTCAGG - Intergenic
972550910 4:40133624-40133646 CCTCCCCTGGCCAATTTTTAAGG + Intronic
972872778 4:43320781-43320803 GCTCTCCTACTGAATTATTCTGG - Intergenic
972941056 4:44195760-44195782 CCTCCCCTGTTGTAATAGTCAGG - Intronic
973567429 4:52202376-52202398 CCTCCCCTGGTGAGTTACAGAGG - Intergenic
975669486 4:76766609-76766631 CCTCCCCCGGTGAGTTATTCTGG + Intronic
977086949 4:92612223-92612245 TTTCCCCTGTTGAATTATTTTGG + Intronic
980398544 4:132248175-132248197 CATCCCCTTGTGTATGATTCAGG + Intergenic
980720566 4:136688845-136688867 CCTCCCCTGATAAATAATTTGGG - Intergenic
981933930 4:150218801-150218823 CCTCCCCTGTTACTTTATTCTGG + Intronic
982034085 4:151328235-151328257 CCTTCCCTGTTGAATTATGTTGG - Intergenic
983315980 4:166133821-166133843 CCTCCCCTGGTGATATCTTCAGG - Intergenic
985825826 5:2190860-2190882 CCCCTCCTGGTGATTTACTCTGG + Intergenic
990144642 5:52745275-52745297 CCTACCCTAGTGTATTAGTCAGG + Intergenic
990281413 5:54254754-54254776 TCTCCCCTGTTGATTTTTTCTGG - Intronic
997009057 5:129855400-129855422 CCACCTCTGGTGAAGAATTCTGG - Intergenic
998491573 5:142551603-142551625 CCTCCCCCGGTGATTTCCTCGGG - Intergenic
1000169188 5:158684994-158685016 CCTCCGCTGGTGAATGCCTCTGG - Intergenic
1005769167 6:29048373-29048395 CCTGCCCTAGTGAAATATTAGGG - Intergenic
1007893577 6:45321799-45321821 CTTCCACTGCTGAATGATTCTGG - Exonic
1017286767 6:152685319-152685341 CCAGCCGTAGTGAATTATTCAGG + Intergenic
1021250521 7:18319989-18320011 CCACCCCTTGTGAATTGTTAAGG - Intronic
1023392465 7:39723384-39723406 CTTCCCCTTTTGAATTATTTTGG - Intergenic
1025605464 7:63037352-63037374 TCTCCCCTGCTGGATTTTTCTGG + Intergenic
1026910667 7:74089995-74090017 CCTCTCCTGGTGAGTGATTTGGG - Intronic
1031603829 7:123746477-123746499 CCTCCCTTGGCTGATTATTCAGG - Intronic
1032255356 7:130292721-130292743 CCTGCCCTGGTGAAATTCTCTGG + Intergenic
1035495450 7:159321438-159321460 CCTCCCAGGGTGACTTGTTCTGG - Intergenic
1035812937 8:2507607-2507629 CCTCCCGTGGTGACTTCTTCAGG + Intergenic
1036217411 8:6892230-6892252 CCTATCCTGGTGCATTAGTCAGG - Intergenic
1036779510 8:11635700-11635722 TCTCCCCTGCTGGATTTTTCTGG - Intergenic
1048567307 8:135615057-135615079 CCTCCCCTGGGGAATGATGGAGG + Intronic
1050150891 9:2618452-2618474 CTTCCCCTGGTGTATCAGTCAGG + Intergenic
1051605124 9:18910986-18911008 CTTCCCCTGGTGGTTTATGCAGG + Intergenic
1052252058 9:26410098-26410120 ATTCCCCTGATGAATTTTTCAGG + Intergenic
1052487972 9:29127329-29127351 CCTCCACTGGTGACATATTTTGG + Intergenic
1056530881 9:87486534-87486556 TCTCCACTGGTGAACTCTTCTGG - Intergenic
1060300453 9:122371719-122371741 TCTCCCCTGGTGAAGACTTCGGG + Intronic
1061144024 9:128786853-128786875 CCTCCCCTGCTAAACTGTTCAGG - Intergenic
1191996031 X:67095965-67095987 TCTCCCACAGTGAATTATTCAGG + Intergenic
1195970873 X:110471963-110471985 CCTTCCTTGGAGAATTATTATGG + Intergenic
1199288747 X:146082894-146082916 TCTCTCCTGCTGAATTAGTCTGG + Intergenic