ID: 933833821

View in Genome Browser
Species Human (GRCh38)
Location 2:86230478-86230500
Sequence GCCCGCTTCCTAGCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933833818_933833821 -9 Left 933833818 2:86230464-86230486 CCAGGGCCACCTAAGCCCGCTTC 0: 1
1: 0
2: 0
3: 5
4: 134
Right 933833821 2:86230478-86230500 GCCCGCTTCCTAGCCAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933833821 Original CRISPR GCCCGCTTCCTAGCCAAAGC AGG Intronic
901290878 1:8123410-8123432 GCCCGCTGCCTAGACAGAGCTGG + Intergenic
904482151 1:30800818-30800840 GGTCACTTCCTAGCCAAGGCAGG + Intergenic
904889994 1:33772496-33772518 GCCCGTTTCCTAGCTAATCCAGG - Intronic
913116258 1:115700393-115700415 GCTGGCTTCCTAGCCTAAGCTGG - Exonic
915619864 1:157074574-157074596 GCCCGCGCCAGAGCCAAAGCTGG - Intergenic
916579580 1:166095505-166095527 GTACTCTTCCTAGCCAATGCTGG + Intronic
919468770 1:197953114-197953136 GCCCACTGCCTAGACAGAGCCGG - Intergenic
924772005 1:247087395-247087417 GACAGCTTCCTCCCCAAAGCTGG - Intergenic
1065852536 10:29802679-29802701 GCCTGCTTCCTTGCCAATACTGG - Intergenic
1069859133 10:71459635-71459657 GCCCACCTCCTAGCCTAACCAGG + Intronic
1073251045 10:102120477-102120499 GCCGGCTCCCCAGCCCAAGCCGG + Intergenic
1075075608 10:119348442-119348464 GCCTGCTTCCTAGGCCGAGCAGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1080645756 11:34186434-34186456 GCCTGCTTCCGAGGCGAAGCTGG - Intronic
1083183647 11:61004889-61004911 GCCTGCTTTTGAGCCAAAGCAGG - Intronic
1084758417 11:71252853-71252875 TCCCCCTCCCTGGCCAAAGCCGG + Intergenic
1085404514 11:76254131-76254153 CCCTGCTTCCAACCCAAAGCAGG - Intergenic
1085574482 11:77589938-77589960 GACCGCCTCCTACCCAGAGCCGG + Exonic
1089599167 11:119602962-119602984 GCCCGCCCCAGAGCCAAAGCTGG + Intergenic
1093969020 12:25357615-25357637 GCCCCCTCCCTTGTCAAAGCTGG + Intergenic
1096626190 12:52897536-52897558 GCCCGCGCCAGAGCCAAAGCTGG + Exonic
1098264755 12:68706944-68706966 GCCCGCACCAGAGCCAAAGCTGG - Intronic
1102965117 12:117119826-117119848 GCCCTGTTGGTAGCCAAAGCAGG + Intergenic
1114422212 14:22593892-22593914 GCCCGCTGCCTAGACAGAGCTGG + Intergenic
1118088275 14:62443309-62443331 GCCTGCTGCCTAGACAGAGCTGG - Intergenic
1119648561 14:76366936-76366958 GCCCCCTTCCTAACCAAAGAGGG + Intronic
1121366344 14:93315341-93315363 TCTCGCTTCCTAGCAACAGCAGG - Intronic
1128079508 15:64847831-64847853 TTCCGCTTCCCACCCAAAGCAGG - Intronic
1128227566 15:66012844-66012866 CCCTGCTTCCTAGAGAAAGCTGG - Intronic
1129160776 15:73746573-73746595 GACTGCTTCCTAGGCAAATCCGG + Intronic
1132197251 15:99924831-99924853 GCCCTCTTCCTAGTCAAATAGGG + Intergenic
1137442871 16:48511121-48511143 TCCCGCCTCCCAGCCAATGCAGG + Intergenic
1138449607 16:57085617-57085639 GCCCCCTTCCTCCCCAAAGTAGG + Intergenic
1156162987 18:34382721-34382743 TCCCCCTTCATAGCCAAAGGTGG + Intergenic
1156903287 18:42326181-42326203 GCCCACTGCCTAGACAGAGCTGG + Intergenic
1158865854 18:61636991-61637013 GCCTGTTTCCTTACCAAAGCAGG + Intergenic
1163210026 19:15833479-15833501 GCTCTCTTGCTGGCCAAAGCTGG + Intergenic
928272965 2:29873705-29873727 GGCCTCTTCCTGGGCAAAGCAGG + Intronic
928949603 2:36803031-36803053 GCTGGCTTCCTGGACAAAGCAGG - Intronic
933833821 2:86230478-86230500 GCCCGCTTCCTAGCCAAAGCAGG + Intronic
934717502 2:96552134-96552156 GCCCACTTCCTGGCCACCGCAGG + Exonic
941195435 2:162445152-162445174 GGCTGCTTCCTAGCCAATGAAGG - Intronic
943064381 2:183071148-183071170 GCCCGCGCCAGAGCCAAAGCTGG + Intergenic
947426647 2:229989589-229989611 TCTCGCTTTCTAGCCAAGGCTGG + Intronic
948945050 2:241215147-241215169 ACCCCCTCCCCAGCCAAAGCTGG - Intronic
1171519268 20:25763770-25763792 GCAGGCTTCCCAGCCAAGGCTGG - Intronic
1171557658 20:26092721-26092743 GCAGGCTTCCCAGCCAAGGCTGG + Intergenic
1174395273 20:50243255-50243277 GCCCGCTTCCCCGCCAACGTGGG - Intergenic
1178876515 21:36418524-36418546 GCCTGCTTCCTGGCCATACCTGG + Exonic
1183020247 22:35021021-35021043 GCCGGATGCCCAGCCAAAGCAGG - Intergenic
950565617 3:13768102-13768124 GCCAGCTTCCTCCCCACAGCTGG + Intergenic
951962800 3:28348459-28348481 GGCCGCTCCCTAGTCAAAGGAGG + Intronic
952611488 3:35215810-35215832 GCCCGCACCAGAGCCAAAGCTGG + Intergenic
953938027 3:47063513-47063535 GCCAGCTTCCTATTCAAAGATGG + Intronic
960298049 3:115968096-115968118 GCCCCCTTCCAGCCCAAAGCAGG + Intronic
960755881 3:121011716-121011738 GCCCCTTTCCCATCCAAAGCTGG + Intronic
964759773 3:160123789-160123811 GCCCACTACCTAGACAGAGCCGG + Intergenic
965313743 3:167164423-167164445 GCCCTCTGCCTAGCCACAACAGG - Intergenic
965605834 3:170496754-170496776 GCCCGCGACAGAGCCAAAGCTGG - Intronic
966230449 3:177645900-177645922 TCCCACTTCCTTGTCAAAGCAGG + Intergenic
967177340 3:186873297-186873319 CCCCGATGCCGAGCCAAAGCTGG + Intergenic
972290657 4:37686862-37686884 GCCCGCTTCCTTTCCAAGCCGGG + Intergenic
982904464 4:161050135-161050157 GCCCACTGCCTAGACAGAGCTGG - Intergenic
984646924 4:182230635-182230657 GCACCCTTCCTACGCAAAGCAGG + Intronic
984888684 4:184473335-184473357 GCCCGCTCCGTAGCCGAGGCGGG + Intronic
984977354 4:185241435-185241457 CCCCGATGCCGAGCCAAAGCTGG - Intronic
989589085 5:43096546-43096568 GCCTGCTTTCTATCCAAAGCTGG - Intronic
994320746 5:98392178-98392200 GCCCGCGCCAGAGCCAAAGCTGG + Intergenic
998103676 5:139455079-139455101 GCCCGCCCCCTAGCCAGAGTGGG + Intronic
1003512627 6:6793976-6793998 GCCCGCTTTCCAGCCTATGCAGG + Intergenic
1009751714 6:67884834-67884856 GCCCTCCTTCCAGCCAAAGCTGG - Intergenic
1017378580 6:153800110-153800132 GTCCTCTTCCTAATCAAAGCAGG + Intergenic
1021406677 7:20275889-20275911 ACCCTCTTTCTAGCCAAAGCTGG + Intergenic
1022622828 7:32002328-32002350 TCCTGCTACCCAGCCAAAGCAGG + Intronic
1023289705 7:38656486-38656508 GCCCGCGCCAGAGCCAAAGCTGG - Intergenic
1026126711 7:67585939-67585961 GCCTGCTGCCTAGACAAAGCTGG - Intergenic
1037602552 8:20409922-20409944 GCCTCCTTCCTTGCCAAACCTGG + Intergenic
1041026659 8:53693618-53693640 TCTTGCTTCCTTGCCAAAGCTGG + Intergenic
1048957617 8:139549775-139549797 GGCCTCTGCCTAGCCAGAGCTGG + Intergenic
1051731914 9:20152670-20152692 GCCTGCATCCTAGTCAAAACTGG - Intergenic
1056203757 9:84300799-84300821 GCCAGCTTCATATCCATAGCAGG + Intronic
1057943711 9:99306481-99306503 GCCCGCGGCAGAGCCAAAGCTGG - Intergenic
1060263079 9:122092863-122092885 GCCCCCGTCCAAGCCGAAGCCGG - Exonic
1061478448 9:130884568-130884590 GCCCTCTTCCGAGGCAGAGCCGG - Exonic
1186748997 X:12602305-12602327 GCCCCCTTCCAGGCCACAGCAGG + Intronic
1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG + Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1198228246 X:134666301-134666323 GCTCACTTCCCAGCAAAAGCAGG + Intronic
1198568492 X:137930704-137930726 GCAGGCTTTCTAGCCACAGCTGG + Intergenic
1199093182 X:143714164-143714186 GCCTGGTTCCTAGCGAAAGGGGG - Intronic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic