ID: 933835959

View in Genome Browser
Species Human (GRCh38)
Location 2:86245709-86245731
Sequence CCCATAGGGTAGCTGAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933835959_933835965 -8 Left 933835959 2:86245709-86245731 CCGGACTTCAGCTACCCTATGGG 0: 1
1: 0
2: 2
3: 16
4: 78
Right 933835965 2:86245724-86245746 CCTATGGGTGGTGTTGAGGCTGG 0: 4
1: 21
2: 24
3: 23
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933835959 Original CRISPR CCCATAGGGTAGCTGAAGTC CGG (reversed) Intronic
902956405 1:19926892-19926914 CCTGTAGAGTACCTGAAGTCCGG + Intergenic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904284277 1:29443958-29443980 GCCAGAGGGAAGCTGAAGTCAGG - Intergenic
904610145 1:31721350-31721372 TCCATAGGGAAGCTGAGGCCTGG + Intergenic
904934590 1:34121164-34121186 GCCAAAGGGCAGCTGAAGTCTGG + Intronic
906536669 1:46554642-46554664 ACCATTTGGAAGCTGAAGTCAGG + Intergenic
908314201 1:62916755-62916777 CTCATAGTGAAGCAGAAGTCAGG - Intergenic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
915410626 1:155699002-155699024 TCCGTAGGGTACCTGAAGTCCGG + Intronic
915779830 1:158535100-158535122 CCCGTAGGGTATCCGAAGTTTGG - Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
919245674 1:194980210-194980232 CCCATAGGCTAGGAGAAGGCAGG - Intergenic
921403903 1:214757823-214757845 CCCATAGCTTAGCAGAATTCAGG + Intergenic
1063714492 10:8513815-8513837 CCCATGGCGTAGCTGAGGCCGGG + Intergenic
1065287200 10:24197580-24197602 CACATAGGGTAGTGGAAGTTGGG - Intronic
1078437941 11:11340870-11340892 CTCTCAGGGTGGCTGAAGTCTGG - Exonic
1079082048 11:17420505-17420527 GCCTTTGGGGAGCTGAAGTCAGG - Intronic
1086923443 11:92613916-92613938 GACATATGGTTGCTGAAGTCTGG - Intronic
1089095491 11:115916693-115916715 CTCAAAGGGCAGCTGAAATCTGG + Intergenic
1089854567 11:121531812-121531834 CCTATAGGGTAGGTAAAGTGTGG - Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1096110195 12:49024220-49024242 CCCATGGGGTATCTGAGGTTTGG + Intronic
1102511714 12:113420631-113420653 CCCATAGGGTAGCTGGGGATGGG - Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1111053156 13:82912690-82912712 CACAGAGTGTAGCTGAAGTTTGG + Intergenic
1112321820 13:98414880-98414902 CCCATCAGGTACCTGCAGTCTGG + Intronic
1117401525 14:55362942-55362964 CCCAAAGGGAAGGTGAGGTCAGG + Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1124998055 15:34743477-34743499 CCCACAGAGAAGCTGCAGTCAGG + Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1142211189 16:88809395-88809417 CCCACAGTACAGCTGAAGTCTGG + Exonic
1142334233 16:89476853-89476875 CCCAGAGGGACTCTGAAGTCAGG - Intronic
1144760771 17:17706153-17706175 CCCATAGGGCTGCTGACCTCTGG - Intronic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1147986242 17:44309089-44309111 CCCAGAGGGAGGCTGCAGTCTGG + Intronic
1148750209 17:49941186-49941208 GCCTTAGGGGAGCTGAAGGCTGG - Intergenic
1149125657 17:53228112-53228134 AGCATGGGGAAGCTGAAGTCAGG - Intergenic
1154000992 18:10482326-10482348 CGCAGAGGGGAGCTGAAGGCTGG + Intronic
1157185711 18:45538527-45538549 CCCACAGGGGAACTGAAGCCTGG - Intronic
1157263964 18:46200637-46200659 CAGGTAGGGCAGCTGAAGTCTGG + Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG + Intergenic
1166424734 19:42667580-42667602 CCCGTAGGGTACCTGAAGTCTGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
925472354 2:4175890-4175912 CCCATTGGGCAGCTGGAGGCTGG + Intergenic
929758969 2:44790608-44790630 CCCAAAAGGTAGCTGAGGTGTGG + Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
937195933 2:120156385-120156407 CCCAGGGGGAAGCTGAAGTGTGG - Intronic
940303303 2:152198686-152198708 GCCCTAGGGTGGCTGAGGTCAGG - Intergenic
1169218129 20:3805003-3805025 CCCATAGGGCAGCTGGCTTCAGG - Exonic
1184505006 22:44895228-44895250 CCCATGGGGAAGCTGAGGCCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
949571404 3:5297044-5297066 CCCATTGGGTACCTGTTGTCTGG - Intergenic
951853590 3:27170110-27170132 CACATAAGTTAGCTAAAGTCAGG + Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
961712024 3:128835127-128835149 CCCACAGGGTACCCGAGGTCGGG - Intergenic
962485018 3:135833923-135833945 TCCTTAAAGTAGCTGAAGTCGGG + Intergenic
963676419 3:148317048-148317070 CACAAAGGGTATCTGAATTCTGG - Intergenic
966446140 3:180003122-180003144 TCAATAGGGTATTTGAAGTCAGG - Intronic
969375605 4:6761469-6761491 CAGATGGGGAAGCTGAAGTCAGG - Intergenic
974219284 4:58946093-58946115 CTCATTGGGTAGCTTAAGTAGGG + Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
984941166 4:184933409-184933431 CCCAGAGAGAATCTGAAGTCAGG - Intergenic
986212356 5:5686038-5686060 TCCATAGGGTCGCAGAATTCAGG - Intergenic
988360256 5:30228461-30228483 CTCAGAGGGAAGATGAAGTCTGG + Intergenic
988547323 5:32170920-32170942 CCCATGTGGTTGCTGAAATCAGG + Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
997414316 5:133713378-133713400 GCCTTAGGGCAGCTGAAGCCAGG - Intergenic
998118014 5:139553306-139553328 CCTATAGGGTTGCTGAGATCCGG + Intronic
1005575777 6:27188024-27188046 CCCTTAGGGTACCTAAAGTCCGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006151115 6:31990529-31990551 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1006157416 6:32023267-32023289 CCTGTAGGGTACCTGAAGTCTGG + Intronic
1011357239 6:86484524-86484546 CCCAAAGTTTAGCTGCAGTCTGG - Intergenic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1014526209 6:122504869-122504891 TCCGTAGGGTATCCGAAGTCCGG + Intronic
1018766024 6:166933259-166933281 CCCATGGTGTAGCTGCAGTAGGG - Intronic
1021652569 7:22846238-22846260 CCCATAGGGCAGCTCAAAACAGG + Intergenic
1022405221 7:30083150-30083172 CACAAAGAGTATCTGAAGTCAGG - Exonic
1037331542 8:17748303-17748325 CAGAGAGGGTAGCTGAAGACGGG - Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1039264422 8:35809040-35809062 GCCCTAGGGTAGCTGCAGTTTGG - Intergenic
1049978908 9:885725-885747 CCCATGGACTAGCTGAAGACAGG - Intronic
1052028148 9:23597542-23597564 TCCAAAGGGAAGCTGAAGCCAGG - Intergenic
1052993976 9:34539846-34539868 CCCGTAGGGTACCTGAAGTCTGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1057079767 9:92164408-92164430 CCCATAGGGTAACTGGGGACTGG - Intergenic
1058857039 9:109072586-109072608 CCCGTAGGGTACCTGAAGTTCGG - Intronic
1059781658 9:117535116-117535138 CTCTTAGGGTAGATGAAGCCAGG - Intergenic
1060972721 9:127748030-127748052 CTCATGGGGTAGTTGAATTCTGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1198454984 X:136808087-136808109 CCTATAGAGTAGCTTAACTCAGG + Intergenic
1199671282 X:150150476-150150498 CCCATTGGATAGCTAAAGACAGG - Intergenic