ID: 933839723

View in Genome Browser
Species Human (GRCh38)
Location 2:86276619-86276641
Sequence AGATTGGTGTGCAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933839719_933839723 12 Left 933839719 2:86276584-86276606 CCGAAAGCAACCAAGGTGGGAGT 0: 1
1: 0
2: 1
3: 25
4: 358
Right 933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
933839715_933839723 29 Left 933839715 2:86276567-86276589 CCTGGCATTGGAGGGTTCCGAAA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148
933839720_933839723 2 Left 933839720 2:86276594-86276616 CCAAGGTGGGAGTCAGCATTTTA 0: 1
1: 0
2: 2
3: 9
4: 172
Right 933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG 0: 1
1: 0
2: 0
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933839723 Original CRISPR AGATTGGTGTGCAGTCCTGG AGG Intronic
900576127 1:3383320-3383342 AGATTGGGGTGCAGGGCGGGAGG - Intronic
901705771 1:11071886-11071908 AGATTGGTGGGGAGTGCTGGAGG - Intronic
902674220 1:17997291-17997313 GGTTGGGTGTTCAGTCCTGGAGG + Intergenic
904862350 1:33548235-33548257 ACAATGGTGTTCAGTCCTAGGGG + Intronic
907319931 1:53595820-53595842 AGTCTGAAGTGCAGTCCTGGTGG + Intronic
908842092 1:68290159-68290181 GGTGTGGTTTGCAGTCCTGGAGG + Intergenic
911488710 1:98535406-98535428 AGATTCTTCTGCAGTCCAGGAGG - Intergenic
912058647 1:105636494-105636516 CGATTGTGGTGCAGACCTGGAGG - Intergenic
912672644 1:111645403-111645425 GGATTGATGTGCAGTACTGAGGG + Intronic
916242825 1:162657125-162657147 AGATTGGTGCCCAGGCATGGTGG - Intronic
918139426 1:181707977-181707999 AGGTTGGGGTGCAGTGATGGTGG + Intronic
918214006 1:182377128-182377150 AGAATGGTGTCAATTCCTGGAGG + Intergenic
920644680 1:207791993-207792015 ATAGTGGTGGCCAGTCCTGGTGG + Intronic
920755484 1:208726965-208726987 GGATTGGTGGGCAATCCTGAGGG + Intergenic
922207338 1:223459949-223459971 GGATTGGTGTGCAGATCTCGGGG + Intergenic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
922858830 1:228798092-228798114 AGAGTGGAGTGCAGGCCTGTGGG + Intergenic
1064816738 10:19274006-19274028 AAATTCTTGTGCATTCCTGGTGG + Intronic
1065887712 10:30093494-30093516 AGTTTGTTCTGCAGTCCTGCAGG - Intronic
1068119055 10:52767431-52767453 AAATTACTGTGCAGTCATGGAGG + Exonic
1068145956 10:53071188-53071210 AGACTGGATTGCAGTCCTGCAGG - Intergenic
1069382104 10:67851873-67851895 AGACTGGTGTGCATTGGTGGTGG - Intergenic
1072732395 10:97855147-97855169 ATATTTGTGTGCTGTCCTGAAGG - Intronic
1076047030 10:127302303-127302325 AGAGTCGTGTGCAGACCAGGTGG + Intronic
1076198935 10:128542467-128542489 AGATTCATGTTCTGTCCTGGTGG - Intergenic
1077090520 11:776502-776524 CGAGTGGGGTTCAGTCCTGGGGG - Intronic
1077405773 11:2381948-2381970 AGAATGGTGTGTAGGGCTGGGGG - Intronic
1080132369 11:28811915-28811937 AGGTTGGTTTGCGGTCCTGCTGG - Intergenic
1082086638 11:48055644-48055666 ACATCCCTGTGCAGTCCTGGGGG + Intronic
1082203411 11:49402265-49402287 AGATTGAGGTGCAGTGATGGAGG + Intergenic
1083403442 11:62440494-62440516 ACACTGGCGTGCACTCCTGGGGG - Intronic
1085705482 11:78783471-78783493 TGATGGGTGTGCAGTTCTGTGGG + Intronic
1085825086 11:79838886-79838908 AGAGTGGGGTGCAGTCCTCCAGG - Intergenic
1086156069 11:83667342-83667364 AGATTGACATGCATTCCTGGAGG + Intronic
1087027127 11:93661145-93661167 AGGCTGGAGTGCAGTACTGGCGG + Intergenic
1087579472 11:100033758-100033780 AGACTGGTGTGCAGCACTGAGGG - Intronic
1088786654 11:113188336-113188358 AGATAGATGTGGAGTCCTGGGGG - Intronic
1090241545 11:125185987-125186009 AGATTCTTGTGCATTGCTGGTGG - Intronic
1090429373 11:126633312-126633334 AGATAGGTGTGCAGACTTGCAGG - Intronic
1090883766 11:130858223-130858245 AGATTGCTGTGCAGTTCAGCTGG + Intergenic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1092117969 12:6022941-6022963 ACATGGGTCTGCAGTCCTGGAGG - Intronic
1093811987 12:23502727-23502749 AGATTTCTGTGCATTTCTGGAGG - Intergenic
1096080321 12:48828412-48828434 AGATGGGTGTGCCACCCTGGGGG - Exonic
1100013037 12:89976597-89976619 TGAATGGAGTGAAGTCCTGGAGG + Intergenic
1100436154 12:94573286-94573308 AGATTGGGGTGCTGACCGGGTGG - Intronic
1101538998 12:105647063-105647085 AGATTGGCTCGCAGTTCTGGAGG - Intergenic
1102402730 12:112644340-112644362 TGATTGGAGTTCAGTCCTGCTGG + Intronic
1104394333 12:128419175-128419197 AGAAGGGCGTGCAGTCTTGGAGG - Intronic
1105723980 13:23142542-23142564 GGACTGGTGGGCAGTTCTGGTGG + Intergenic
1110364727 13:74669291-74669313 AGATTGGTATGCCCTCATGGAGG + Intergenic
1111947107 13:94677616-94677638 AGATTTGTGTGTATTCCTTGAGG - Intergenic
1113008925 13:105741039-105741061 GCATTGGGGTGCTGTCCTGGGGG - Intergenic
1118004676 14:61554616-61554638 AGAGTAGTGGGCAGCCCTGGGGG + Intronic
1118931629 14:70247360-70247382 AGATGAGCGTGCACTCCTGGAGG - Intergenic
1119810184 14:77511422-77511444 AGAGTGATGTGCACTCCTGGTGG - Exonic
1121254061 14:92518695-92518717 AGCTTGGTGTACAGACTTGGGGG + Intronic
1122289708 14:100673866-100673888 AGGTTGGGGTGGAGGCCTGGAGG - Intergenic
1122580531 14:102768975-102768997 AAATTGGTGAGCACTCCTCGAGG - Intergenic
1122800826 14:104228796-104228818 ACACTGGTGTGCAGATCTGGGGG - Intergenic
1124687548 15:31795409-31795431 ATATTGGAGTGCTGACCTGGAGG + Intronic
1128145421 15:65329997-65330019 AGATTGGTCTGGAGTCCTGTAGG - Intronic
1128338466 15:66803397-66803419 AGCTTTGTTTGCATTCCTGGAGG - Intergenic
1128770053 15:70275322-70275344 AGAAAGGTTTGCAGCCCTGGAGG + Intergenic
1129748821 15:78045348-78045370 TTATTGGTCTGCAGTACTGGAGG - Intronic
1131202043 15:90406997-90407019 AAATTGGTGTTTAGTTCTGGAGG + Intronic
1131694003 15:94856144-94856166 GGCTTGGTGTGCAGGCGTGGTGG - Intergenic
1133553562 16:6882849-6882871 AGATGGTTGTTCACTCCTGGGGG - Intronic
1140468124 16:75198287-75198309 AGGTCGGCCTGCAGTCCTGGAGG + Intergenic
1141814652 16:86401383-86401405 CGATTTCTGTGCATTCCTGGTGG - Intergenic
1142817383 17:2437167-2437189 TGATTTGTGTCCAGGCCTGGTGG - Intronic
1144031874 17:11330279-11330301 AGAATGCTGTTCAGTCCAGGTGG - Intronic
1146269493 17:31475189-31475211 AGGTTGGTGTGTAGAGCTGGTGG + Intronic
1149593931 17:57852214-57852236 ATATTGGTGGGCAGACTTGGGGG + Intergenic
1150397681 17:64834175-64834197 AGGTTGCTGTTCAGTCATGGTGG - Intergenic
1150650435 17:67006412-67006434 AGGTGGGGCTGCAGTCCTGGAGG - Intronic
1151297942 17:73199331-73199353 TGAGTGCTATGCAGTCCTGGGGG - Intronic
1152845705 17:82598526-82598548 GGATTGGCTTGCAGTTCTGGAGG + Intronic
1155263754 18:24071701-24071723 AGACTGGTGTGCATTTTTGGGGG + Intronic
1155597237 18:27502300-27502322 TGATTGGTGTTCTGTCCTGCTGG - Intergenic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1163649240 19:18507555-18507577 GGCTTGGTGTGCAGTGGTGGTGG - Intronic
926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG + Intergenic
927081044 2:19630920-19630942 AAATTGTTTTGCAGTTCTGGAGG - Intergenic
927173774 2:20391415-20391437 AGAATGGTGTTCAGGGCTGGGGG + Intergenic
928011176 2:27609200-27609222 TGGTAGGTGTGCACTCCTGGTGG + Intronic
928406150 2:31016551-31016573 AGATGGGTGTGCAGGCCCAGTGG - Intronic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
933890267 2:86762183-86762205 TGATTGGTGTGTCTTCCTGGTGG + Intronic
935394059 2:102586825-102586847 AGGTTGGTGTTGAGGCCTGGAGG - Intergenic
936849503 2:116878443-116878465 AGGTTGGTGCTCAGTCCTGGTGG + Intergenic
938337952 2:130515774-130515796 ACATTGGTGTGCAGTCTGGAGGG + Intergenic
938351887 2:130604964-130604986 ACATTGGTGTGCAGTCTGGAGGG - Intergenic
940483664 2:154269607-154269629 AGATTGGTCTGCATTCTTTGTGG - Intronic
944225709 2:197346803-197346825 TGACTGGTGTTCAGTCCTGGGGG - Intergenic
945357504 2:208857233-208857255 AGACTGCTGTGCTGTGCTGGGGG + Intergenic
946269939 2:218583005-218583027 AGACTGGTGTGCTGTCAAGGTGG - Exonic
1168885444 20:1249545-1249567 TGATTGGAGTACAGACCTGGTGG - Intronic
1171146269 20:22786340-22786362 AGAATGGTCAGCATTCCTGGTGG + Intergenic
1173042922 20:39481795-39481817 AGTTTGGTGTGAGGTGCTGGTGG - Intergenic
1173180763 20:40804719-40804741 AGATTGAGATGGAGTCCTGGAGG - Intergenic
1174519286 20:51117340-51117362 AGGCTGGTGAGCAGTCCTGATGG + Intergenic
1175725069 20:61312559-61312581 AGAAGGGGGTGCAGTCCTGATGG - Intronic
1175914251 20:62418450-62418472 AGCTTGTTCTGCAGGCCTGGGGG + Exonic
1178022038 21:28419534-28419556 ACCTTGGTGGGCAGTTCTGGGGG - Intergenic
1178292770 21:31383571-31383593 AGATAGGTGTACAGTGTTGGTGG - Intronic
1180086175 21:45508930-45508952 GGACTGGGGTGCAGGCCTGGGGG + Intronic
1180569404 22:16701355-16701377 ACATGGGTCTGCAGTCCTGGAGG - Intergenic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1184037154 22:41923779-41923801 AGTTTGGAGTCCAGCCCTGGAGG + Intergenic
1184097094 22:42322244-42322266 GGCTTGCTGTGCAGGCCTGGAGG + Intronic
1184274708 22:43403797-43403819 AGGGTGCTGTGCAGTCCTGGAGG + Intergenic
951663203 3:25093738-25093760 GGAGTGGTCTGCAGTCCAGGTGG - Intergenic
952067042 3:29583202-29583224 AGATTGAAGTTTAGTCCTGGAGG + Intronic
957866436 3:86029919-86029941 AGTTTGGTGTGGAGCCCTTGAGG + Intronic
957887837 3:86313462-86313484 AAATTGCTGTGCTGTCCTGAGGG - Intergenic
961018828 3:123487098-123487120 AAGTTGGCGTGCAGTCCTGCTGG - Intergenic
961356927 3:126345175-126345197 AGAATTGGATGCAGTCCTGGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967302490 3:188029122-188029144 ATATTGTTATGCATTCCTGGTGG + Intergenic
969938793 4:10709713-10709735 AGAAAAGTGTGCAGTCCTGGAGG - Intergenic
972262737 4:37426922-37426944 ACATTGCTGTGCAGTCATGATGG + Intronic
974186790 4:58457104-58457126 AGGTTGGGGGGCAGTGCTGGAGG - Intergenic
975321944 4:73018748-73018770 AGATTGATGGGCAGCCCTGGTGG + Intergenic
977732456 4:100370317-100370339 AGACTGGTATGATGTCCTGGGGG + Intergenic
982428480 4:155295328-155295350 AAATTTGTTTGCAGTTCTGGAGG + Intergenic
984293777 4:177828492-177828514 AGATTGCTGAGTAGTGCTGGAGG + Intronic
984302632 4:177942509-177942531 AGATAGGTCTGAAGTCATGGTGG - Intronic
991517446 5:67453794-67453816 AAAGTGGTGGGCAGTCCTGCTGG - Intergenic
992551731 5:77866137-77866159 AGGGTGGTGGGCAGTCCTGGGGG + Intronic
996001741 5:118372407-118372429 AGGTTGTTGGCCAGTCCTGGAGG - Intergenic
999821858 5:155236664-155236686 GGATTGGTGGCCAGTCATGGTGG + Intergenic
1001084098 5:168687902-168687924 AGATTGGTGTGCAGGGCCTGGGG - Intronic
1001891977 5:175347147-175347169 AGATAGATGTGCTTTCCTGGGGG - Intergenic
1005510015 6:26504369-26504391 AGTTTGGTGGGCAGACTTGGGGG - Intronic
1006340979 6:33446888-33446910 AGAGTGGTGGGCTCTCCTGGTGG - Intronic
1006570197 6:34996756-34996778 AGATTGGTGGCCAGGCATGGTGG - Intronic
1008064641 6:47034514-47034536 AGATTGGTGAAGTGTCCTGGGGG - Intronic
1008379798 6:50828093-50828115 TAATGGGTGTGCAGTCCTAGAGG + Intronic
1013574052 6:111462393-111462415 AGATCGGTGTGCCTTTCTGGCGG - Intronic
1013754917 6:113450162-113450184 AGATTGGAGACCAGTCCTTGAGG - Intergenic
1015825638 6:137308429-137308451 ATAATGTTGTACAGTCCTGGTGG + Intergenic
1015826569 6:137318754-137318776 AGCTGGGTGTGCAGGCCTGCAGG + Intergenic
1018651082 6:165991605-165991627 AGATGGGTTTGCAGGCCTTGGGG + Intergenic
1018730665 6:166647413-166647435 AGATTGGGGAGGAATCCTGGAGG - Intronic
1022450001 7:30505332-30505354 AGATTGATGACCAGTGCTGGGGG - Intronic
1025192667 7:56907937-56907959 AGATTGGTGACCAGGCATGGTGG + Intergenic
1025679278 7:63668983-63669005 AGATTGGTGACCAGGCATGGTGG - Intergenic
1029670270 7:102025337-102025359 AGATTGGTGGCCAGGCATGGTGG + Intronic
1032398918 7:131610267-131610289 AGATCTGGGAGCAGTCCTGGAGG + Intergenic
1035049012 7:155987800-155987822 GGATTGATGTGCACCCCTGGGGG - Intergenic
1037144376 8:15555338-15555360 AGGCTGGAGTGCAGTGCTGGGGG + Intronic
1037941570 8:22955433-22955455 ACATTGGTCTAGAGTCCTGGAGG - Intronic
1040592273 8:48804763-48804785 AGGTTGGGGTGTATTCCTGGAGG + Intergenic
1047392512 8:124464879-124464901 AGCTTGGTGTGCTTCCCTGGTGG - Intergenic
1049325883 8:142021236-142021258 AGAGGGTTGTTCAGTCCTGGGGG + Intergenic
1053728326 9:41026673-41026695 CCATTGGGGTGCAGTTCTGGAGG - Intergenic
1054700179 9:68405407-68405429 CCATTGGGGTGCAGTTCTGGAGG + Intronic
1057532228 9:95859431-95859453 ATCTTGGTGTTCATTCCTGGAGG - Intergenic
1061328025 9:129875725-129875747 AGTGTGGTGTGGGGTCCTGGTGG - Intronic
1185580225 X:1206355-1206377 AGCTTGGTTTTCAGTCCTTGTGG + Intronic
1186276030 X:7939040-7939062 AGATGGGGATGCAGTCCTGGGGG + Intergenic
1193149362 X:78108565-78108587 AGATTGGAGTTCAGGCCTAGTGG + Intronic
1200017818 X:153179646-153179668 GGATTGGAGTGCAGTCTTGGGGG - Intronic