ID: 933844140

View in Genome Browser
Species Human (GRCh38)
Location 2:86311687-86311709
Sequence CTTTGCAAATGTAATCAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 1, 2: 8, 3: 31, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933844140_933844145 19 Left 933844140 2:86311687-86311709 CCAACTTGATTACATTTGCAAAG 0: 1
1: 1
2: 8
3: 31
4: 267
Right 933844145 2:86311729-86311751 TCACATTCTAAGGTTCCAGGTGG 0: 3
1: 38
2: 104
3: 233
4: 478
933844140_933844144 16 Left 933844140 2:86311687-86311709 CCAACTTGATTACATTTGCAAAG 0: 1
1: 1
2: 8
3: 31
4: 267
Right 933844144 2:86311726-86311748 AGGTCACATTCTAAGGTTCCAGG 0: 3
1: 58
2: 239
3: 942
4: 1948
933844140_933844143 9 Left 933844140 2:86311687-86311709 CCAACTTGATTACATTTGCAAAG 0: 1
1: 1
2: 8
3: 31
4: 267
Right 933844143 2:86311719-86311741 CCAAATAAGGTCACATTCTAAGG 0: 29
1: 470
2: 1255
3: 2319
4: 2965
933844140_933844141 -4 Left 933844140 2:86311687-86311709 CCAACTTGATTACATTTGCAAAG 0: 1
1: 1
2: 8
3: 31
4: 267
Right 933844141 2:86311706-86311728 AAAGACTCTATTTCCAAATAAGG 0: 58
1: 445
2: 1199
3: 1857
4: 2321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933844140 Original CRISPR CTTTGCAAATGTAATCAAGT TGG (reversed) Intronic
900502113 1:3011460-3011482 CTTTGCAGATGTAACAAGGTAGG - Intergenic
900699100 1:4032948-4032970 CATTGCAGATGTCATCAAGGGGG + Intergenic
900973559 1:6004702-6004724 TTTTGCAGATGTAATTAAGGTGG - Intronic
901302387 1:8209195-8209217 GTTTGTAAATGAAATCCAGTGGG - Intergenic
903105187 1:21072160-21072182 CTTTTCTAAGGTAATAAAGTTGG + Intronic
905468832 1:38176290-38176312 CTCTGCAAAGGCAAACAAGTAGG - Intergenic
905697143 1:39983070-39983092 TTATGCCACTGTAATCAAGTAGG - Intergenic
905785764 1:40756156-40756178 CTTTGCAAAGCTATTGAAGTAGG - Intronic
908513113 1:64865396-64865418 CTTTGTAACAGTACTCAAGTCGG + Intronic
912071301 1:105813295-105813317 CTTGACAAATGGAATCAAATTGG + Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
914694530 1:150064696-150064718 TTTTTCAATTGTTATCAAGTAGG + Intergenic
917505431 1:175622989-175623011 CTTTGCAGATGTAATTAGGATGG - Intronic
917697244 1:177538239-177538261 CTTATCCAATGTGATCAAGTAGG + Intergenic
920841651 1:209560520-209560542 CTCTGCCAATGTTATAAAGTGGG + Intergenic
922237335 1:223731923-223731945 CTTTGCAACTGATACCAAGTAGG - Intronic
1063196688 10:3749965-3749987 CTTTACAAATGTAATTAATGGGG - Intergenic
1063617257 10:7611190-7611212 CTTTGCAAAGGTAGATAAGTTGG - Intronic
1063751798 10:8957423-8957445 GTTTGCAGATGTAATTAAGATGG - Intergenic
1065052310 10:21807535-21807557 CTTTGCAAATGAATGCAAATGGG - Intronic
1065911953 10:30315150-30315172 CTTTGCAAATGCTATCTAGAAGG - Intronic
1066210931 10:33237525-33237547 ATTTTCAAATGTAAGCAATTGGG - Intronic
1067138097 10:43629553-43629575 CTTTGCAGATGTAATTAGTTAGG + Intergenic
1067956095 10:50793319-50793341 ATTTGCAAATGTAGCCTAGTAGG - Intronic
1069635295 10:69921365-69921387 CATTGCAAATGTAATGAGTTAGG - Intronic
1071351085 10:84745881-84745903 CTTTGCTGATGTGATTAAGTTGG - Intergenic
1071776035 10:88789147-88789169 CTTTGCATATGTGATTAAGTTGG + Intergenic
1075493056 10:122891083-122891105 CTTTTCAAATATAATGACGTAGG + Intergenic
1078161856 11:8846949-8846971 CATTGGAACTGTAAGCAAGTAGG - Intronic
1078712497 11:13807924-13807946 CTTTGCAGATGTAAGTAATTAGG - Intergenic
1079910211 11:26300395-26300417 CTTTGCAAATGCTATAAAATGGG - Intergenic
1080345858 11:31323874-31323896 CTTTGGAAGTTTAAGCAAGTTGG - Intronic
1083376560 11:62228019-62228041 CTTTACCAATGTATTCAATTGGG - Intergenic
1084919371 11:72456932-72456954 TATTGTAAATGTAATCAGGTAGG - Intergenic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086562113 11:88179560-88179582 CTTTGCAAATGTAAACTTGAAGG + Intergenic
1086925287 11:92633458-92633480 CTTTACAAATGTCAATAAGTGGG + Intronic
1087079145 11:94152913-94152935 CCTTCCAAATGTAAACCAGTTGG + Intronic
1087516959 11:99176067-99176089 TTTAGCAGATGTAATTAAGTGGG - Intronic
1088254059 11:107886529-107886551 CTATGAGAATGTAATCAAGTAGG + Intronic
1090449753 11:126796116-126796138 TTTTGCTAATGCAATAAAGTTGG + Intronic
1090750497 11:129742785-129742807 ATTTGCAAATGTCATAAACTGGG - Intergenic
1091254037 11:134168022-134168044 CTTGGCAAATGTAGTCATGCAGG - Exonic
1091493482 12:952526-952548 CTTTGTAGATGTAATCAAGTAGG + Intronic
1092938403 12:13385519-13385541 GTTTGCAAAGGAAATCAGGTGGG + Intronic
1093277079 12:17142447-17142469 CTTTGCAAATGTATACCAGCAGG + Intergenic
1094071765 12:26423990-26424012 TTTTGGAAAAGGAATCAAGTGGG - Intronic
1094141578 12:27187236-27187258 TTTTGCAAATGTGGTTAAGTTGG - Intergenic
1095292844 12:40495405-40495427 TTATGCAAATGTAAACAAATTGG + Intronic
1096752049 12:53766392-53766414 CTTTGCAAAAGGAATCATTTTGG + Intergenic
1098405459 12:70121532-70121554 CTAAGCAAAAGTAATCATGTTGG + Intergenic
1098901397 12:76115431-76115453 GTTTGCAAATGCAATGAATTGGG - Intergenic
1099524545 12:83703752-83703774 ATTTGGAAATATAATCAAGGGGG + Intergenic
1100438836 12:94596790-94596812 CTGAGCAAATGTAAACAACTAGG - Intronic
1101105510 12:101436151-101436173 CTTTCAACATGTAAACAAGTAGG + Intergenic
1101183969 12:102253488-102253510 CTTATCCACTGTAATCAAGTTGG - Intergenic
1101612683 12:106305415-106305437 CCTTGCAAATGCACTGAAGTAGG + Intronic
1101687197 12:107036750-107036772 CTGTGCAAAGGTACTGAAGTAGG - Intronic
1104008645 12:124913848-124913870 CTTTTGAAATGTAATCATTTGGG - Exonic
1107506554 13:41039986-41040008 CTTTGCTAATTTAATTTAGTAGG - Intronic
1112569413 13:100580259-100580281 CTTTGCACATGTGATTAATTAGG + Intronic
1112593244 13:100783865-100783887 CTTTGGAAATGTAATCTTTTGGG - Intergenic
1113093156 13:106636012-106636034 CTTTGCAGATGTAAATAAGATGG - Intergenic
1114398898 14:22391517-22391539 CTTTGCAAATCTAATGAAAAAGG + Intergenic
1114953514 14:27787942-27787964 CTTTGCATATATAATCAATGAGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116176767 14:41480931-41480953 TTTTGTAAATGTATTCAAATTGG + Intergenic
1116313536 14:43357659-43357681 CTTTCTAAATGTAAACACGTGGG + Intergenic
1116797894 14:49411520-49411542 CTTTTCCACTGTGATCAAGTTGG + Intergenic
1117064072 14:51991432-51991454 CTTTGAAAAGGTAATGAATTAGG + Exonic
1117199470 14:53373494-53373516 CTTTGCCAAGGTATTCATGTTGG - Intergenic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1120546575 14:85819535-85819557 CTTTGGAATTGTGATCAATTTGG - Intergenic
1120684282 14:87519736-87519758 CATTGGAAATGTAATTAACTTGG - Intergenic
1125959459 15:43817123-43817145 ATTAGCAAATGTAATCTACTTGG + Intronic
1126309784 15:47302516-47302538 CTTTGCAGATGTGATTAAGTAGG + Intronic
1126749599 15:51863445-51863467 GTCTGGAAATGTAATCAATTCGG - Intronic
1127025966 15:54806910-54806932 CTTTACAAATGTAATCATCAAGG - Intergenic
1127223351 15:56903968-56903990 CTTATCCACTGTAATCAAGTGGG - Intronic
1127330699 15:57936825-57936847 CTAAGCAACCGTAATCAAGTAGG - Intergenic
1127356534 15:58206321-58206343 TTTTTCAAATGTCATCAAGCTGG + Intronic
1128244903 15:66126482-66126504 CATTCCAAATGTATTCATGTTGG + Intronic
1128841825 15:70856697-70856719 CATTGCAAACGTGATCGAGTTGG - Intronic
1130798930 15:87240712-87240734 CTTTGCAGAGGTAATCAACTTGG + Intergenic
1131400739 15:92123753-92123775 CTGTGCAAATGGAATCAAAATGG - Intronic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1135138690 16:19903619-19903641 CTTTGCAGATGTGATTAAGTTGG + Intergenic
1135490500 16:22905267-22905289 CCTTGCACATGCAAGCAAGTGGG - Intronic
1136645719 16:31612695-31612717 CTTATCCAATGTGATCAAGTTGG + Intergenic
1140282490 16:73567246-73567268 CTTTGCAGATGTAATCAGTAAGG - Intergenic
1140689007 16:77463437-77463459 CTCTGCCACTGTGATCAAGTGGG + Intergenic
1140972413 16:80026191-80026213 TTTTGAAAATTTAATCAAGATGG + Intergenic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1146487788 17:33258094-33258116 CTTCCCAACTGTAATCAGGTAGG + Intronic
1149388850 17:56169881-56169903 CTTTGTAATCCTAATCAAGTGGG + Intronic
1149440168 17:56667214-56667236 CTATACAAATATAAGCAAGTAGG - Intergenic
1149485578 17:57040232-57040254 CTTTGGAAATGTAAACAATGGGG - Intergenic
1150015875 17:61556630-61556652 CTTTGCCAAAATAATCAAGCAGG + Intergenic
1150476983 17:65483122-65483144 CTTTGCAGATGTAATTAGTTAGG - Intergenic
1151144207 17:72024877-72024899 CTTTGCGTATATAATCAAATAGG - Intergenic
1151193920 17:72418477-72418499 CTTTGCACATGTAATTAGCTAGG - Intergenic
1151397351 17:73832427-73832449 CTTTGCAGATGTAAATAATTAGG - Intergenic
1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG + Intergenic
1155958867 18:31977208-31977230 CTTTGTTAATGTAAACAAGGGGG - Intergenic
1158266786 18:55667542-55667564 CATTACAAATTTAATCATGTTGG - Intergenic
1158944745 18:62438421-62438443 CTTTGCAGATGTAATTAAGGGGG + Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159470358 18:68846472-68846494 CTTTGGATATGTAAGCATGTGGG + Intronic
1160017742 18:75157432-75157454 CTTTGTAGATGTAATCAGTTAGG + Intergenic
1160373726 18:78395342-78395364 CTTTGCCAGTGGAATCCAGTTGG - Intergenic
1160574886 18:79847662-79847684 TTTTTCAAATGTAATCAATAAGG - Intergenic
1163403346 19:17107819-17107841 CTTTGCAAATGCAATTAGGTAGG - Intronic
1164012746 19:21220984-21221006 TCTTGCAAATGTAATAAATTTGG - Intergenic
1164032981 19:21426643-21426665 TCTTGCAAATGTAATAAATTTGG + Exonic
1164035847 19:21454268-21454290 TTGTGCAAATGTAATAAATTTGG - Intronic
1164059446 19:21656739-21656761 CCCTGCAAATGTAATAAATTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164278224 19:23743131-23743153 CCCTGCAAATGTAATAAATTTGG - Exonic
1164298282 19:23936076-23936098 CCCTGCAAATGTAATGAATTTGG + Intronic
1164414770 19:28037947-28037969 CTTTGCAAAACAAACCAAGTGGG + Intergenic
1164874900 19:31677319-31677341 CTTTGCCCATTTAGTCAAGTGGG - Intergenic
1165038320 19:33050573-33050595 CTATGTAAATGTAATCAGATAGG + Intronic
1165613276 19:37175690-37175712 ATTTGAAAATGTAATAAAATAGG + Intronic
1167835269 19:52063196-52063218 CCTTGCAAATGTAATTAACGTGG - Intronic
1167861832 19:52290767-52290789 CTTTACAAATGTAATAAATGTGG + Exonic
1167872553 19:52384631-52384653 CTTTACAAATGTAATAAATGTGG + Exonic
1167876331 19:52416410-52416432 CCTTACAAATGTAATCAATGTGG + Exonic
1167878925 19:52438937-52438959 CTTTACAAATGTAATGAATGTGG + Exonic
1167956430 19:53068486-53068508 CCTTACAAATGTAATCAATGTGG - Exonic
1167961542 19:53108624-53108646 CCTTACAAATGTAATCAATGTGG - Exonic
1168426103 19:56240345-56240367 ATTGGGAAATGTAATCAACTCGG + Intronic
1168507761 19:56950730-56950752 CTTTACAGAGGTGATCAAGTTGG + Intergenic
925389966 2:3487913-3487935 CTTTGCAGATGTAATTAAATAGG - Intergenic
925814846 2:7737425-7737447 CTTTGCAAATGAAAACATATGGG + Intergenic
926765385 2:16319170-16319192 CTTTGCACAGGTAACGAAGTGGG - Intergenic
926776309 2:16426643-16426665 CTTTTCAAATGTCAGGAAGTTGG - Intergenic
927820859 2:26263539-26263561 CTTTGTAAATGTAACCCAGTAGG + Intronic
931545529 2:63380945-63380967 TTTTGGCAATGTAATAAAGTGGG + Intronic
932481348 2:72041360-72041382 CTTTGCAAAAGTAATTAGGGAGG + Intergenic
932810908 2:74825393-74825415 CTATGGAAAAGTAAACAAGTAGG - Intergenic
932949421 2:76275437-76275459 CTTTTCAAACATAATCAAGATGG - Intergenic
933221882 2:79700117-79700139 CATTGCAAATGGATACAAGTTGG - Intronic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934057482 2:88263816-88263838 CTTTGCAGGTGTAATTAAGGTGG - Intergenic
934483799 2:94681308-94681330 CTTTGCATATATAATCAATGAGG + Intergenic
934582313 2:95453626-95453648 CTTTGCAGATGTAATTACCTTGG + Intergenic
934597137 2:95623088-95623110 CTTTGCAGATGTAATTACCTTGG - Intergenic
934842743 2:97639912-97639934 CTTTGCAGATGTAATTACCTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
939571275 2:143843062-143843084 CTAAGCAAATGTAATCACGATGG - Intergenic
941346643 2:164377303-164377325 CATTGCAAACAAAATCAAGTGGG + Intergenic
942114651 2:172716133-172716155 TTTTGAAAATGTTATCAAGATGG + Intergenic
943708234 2:191059235-191059257 TGTTTCAAATGTATTCAAGTTGG - Intronic
943862936 2:192892073-192892095 CTTTGCAGATGTCATTAAGATGG - Intergenic
943894785 2:193342481-193342503 CTGTGCAAATGCAATCAACTGGG - Intergenic
943981975 2:194564865-194564887 TTTTCCAAATGTATTTAAGTAGG + Intergenic
944318174 2:198305831-198305853 CTTTGCCTATAGAATCAAGTTGG - Intronic
946578504 2:221102182-221102204 CATTGCAAGTATAATCAAATAGG + Intergenic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
946965007 2:225028120-225028142 CTTTGCAAATATGATTAAGATGG + Intronic
947196572 2:227573869-227573891 CTTTGGAAATGCAATCAATTTGG - Intergenic
1170338206 20:15294575-15294597 CTTTTCACCTGTAATCCAGTGGG + Intronic
1173045859 20:39511108-39511130 CTTTGCAAATGTTATCATTGGGG - Intergenic
1174057067 20:47805354-47805376 GTCTGCAAATATCATCAAGTGGG + Intergenic
1174128692 20:48326880-48326902 CTTTGCAAATGTACTTAGTTAGG + Intergenic
1176313910 21:5223896-5223918 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1177606295 21:23381898-23381920 CCTTGCAAAAGAAATCAAGAAGG + Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1177919599 21:27134686-27134708 CTTTACAAATGTACACAAGATGG - Intergenic
1178906255 21:36639470-36639492 CTTTGCAGATGTAACTAAGATGG - Intergenic
1178969703 21:37162208-37162230 CTATATAAATGTAATCAAGATGG - Intronic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1180391729 22:12290013-12290035 CTCTGCAAATAAAATAAAGTTGG - Intergenic
1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG + Intergenic
949210117 3:1488488-1488510 CTTTGTAAATGTAGTAAAATAGG - Intergenic
949270363 3:2209361-2209383 CTTGGGAAATATAATCAAGTTGG + Intronic
949325168 3:2855481-2855503 TTTTGAAAATGTAAAGAAGTAGG + Intronic
953640790 3:44705659-44705681 CTTTGGAGAGGTAATCAGGTGGG + Intergenic
953775528 3:45813350-45813372 CTTTGCAGATGTCATTAAGTTGG + Intergenic
956772343 3:72537194-72537216 CTTTAAAATTGTAAACAAGTTGG - Intergenic
957452441 3:80397305-80397327 CTTATCAAATGTAATAATGTAGG + Intergenic
958613744 3:96462732-96462754 ATTAGAAAATGTAATCAAATAGG - Intergenic
959731262 3:109605218-109605240 GTTTGCAAATATAAATAAGTTGG + Intergenic
960211781 3:114976775-114976797 CTTTGACAATGTAATCTAGTGGG - Intronic
961577880 3:127853361-127853383 CTTTGTATATGTAATCATGCTGG - Intergenic
964078445 3:152721414-152721436 CTTTCCAAGTGTACTCATGTTGG - Intergenic
966230515 3:177646625-177646647 ATTTTCAAATGGACTCAAGTTGG + Intergenic
967501421 3:190202579-190202601 ATATGCAAAAGTAAACAAGTAGG + Intergenic
968388080 4:162739-162761 TTTTACAAATGTAATAAATTTGG + Intronic
969475778 4:7421829-7421851 CCTTGCAAATGAAATCCAGTGGG + Intronic
969978438 4:11128554-11128576 CTTTGGAAATTTCATCAACTGGG - Intergenic
970087010 4:12360691-12360713 ATTTGCAAATGTACTGTAGTAGG + Intergenic
970743248 4:19263300-19263322 CTTTGCAAATGTTATGAACTAGG - Intergenic
970836431 4:20414227-20414249 GTATACAAATGAAATCAAGTTGG - Intronic
971433927 4:26599313-26599335 CTTTTAAAATTTAATCAAGAGGG + Intronic
971772889 4:30921605-30921627 CTCTGCAAAATTAATCAAGAGGG - Intronic
972554853 4:40171586-40171608 CTTTACAGAAGTAATCTAGTTGG + Intergenic
973880257 4:55264318-55264340 CTTGGCAAATGTTATCAATCAGG + Intergenic
975127098 4:70795087-70795109 CTTTCCAAATGAAATCAAGTTGG - Intronic
977758367 4:100700685-100700707 CCTTGTAGATATAATCAAGTTGG - Intronic
979016359 4:115439443-115439465 CTTTGCAGCTGTAATTATGTAGG + Intergenic
979056589 4:116002704-116002726 TTGTGCAAATATAATCAAATTGG - Intergenic
980441600 4:132854319-132854341 CTTTACAAATGTAATTCATTCGG + Intergenic
980681062 4:136160759-136160781 CTTTCCAAATGTAATGTAGAGGG + Intergenic
981877142 4:149560196-149560218 CTTTGAAAATTTGATAAAGTAGG - Intergenic
982044117 4:151424674-151424696 CTTCTCAACTGTACTCAAGTTGG - Intronic
982841587 4:160194588-160194610 CTTTGCAAATGTTAGTAAGTAGG - Intergenic
982913892 4:161180623-161180645 CTGTTCAAATGTAATCAGGAAGG + Intergenic
984332683 4:178345648-178345670 CTTTGTAACTGTAATAATGTGGG + Intergenic
985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG + Intronic
988183355 5:27827411-27827433 CTTGGCAAATGCCATCAAGAAGG - Intergenic
988626860 5:32886132-32886154 CTTCTCAAATGTGATCAACTAGG - Intergenic
988626863 5:32886212-32886234 CTTCTCAAATGTGATCAATTAGG - Intergenic
989535068 5:42553639-42553661 TTTTGCAGATGTAATTAAGATGG - Intronic
990104182 5:52236252-52236274 CTTTGTAAATTTGACCAAGTAGG - Intergenic
992240398 5:74763713-74763735 CATTGCAAATATCCTCAAGTTGG + Exonic
993434495 5:87874853-87874875 CCTTTCAAATGTTATCAAATTGG + Intergenic
993838935 5:92852135-92852157 CTATGTAAAAGTAATAAAGTAGG + Intergenic
994971203 5:106740781-106740803 CTTTGCATCTGAAATCAAATGGG - Intergenic
995161523 5:108989017-108989039 CGTTGCAAATGAAATCAAGATGG - Intronic
996237510 5:121149999-121150021 CTTTGCAAATTTGAATAAGTAGG + Intergenic
996556250 5:124782053-124782075 CTTTTCAAATGTCAACACGTTGG + Intergenic
996960774 5:129246575-129246597 CTTTGCAGATGTAATCAAATTGG + Intergenic
997270193 5:132529925-132529947 CTTTATAAATGGAATCATGTTGG + Intergenic
997399991 5:133594915-133594937 CTTTTAAAATGTCATTAAGTAGG - Intronic
997857455 5:137384865-137384887 CTTCGCAGATGTAATTAAGTTGG - Intronic
998788304 5:145737136-145737158 CTTTACAAATTTATTCAAGTTGG + Intronic
998889702 5:146733123-146733145 CTTTACAAATGTAAATCAGTGGG + Intronic
999215809 5:149933977-149933999 TTTTGCAAATCTAATCATGAAGG - Exonic
1001903397 5:175450633-175450655 CATTGCAAATTTTATCTAGTTGG + Intergenic
1002547555 5:179960283-179960305 CTTTGCAAATATAAACAGGATGG - Intronic
1003034346 6:2630062-2630084 CTTTGCAGACATAATTAAGTTGG + Intronic
1005008431 6:21313038-21313060 CATTGCAAATGTAATCAGGTAGG + Intergenic
1007388091 6:41532791-41532813 CATTGCAGATGTAATCAGTTAGG + Intergenic
1010041185 6:71386442-71386464 TTGTGCAAATGTAATCATGTGGG - Intergenic
1011028071 6:82891275-82891297 CTGTGCTAATGGAATCTAGTGGG + Intergenic
1012968219 6:105698507-105698529 GTTTGCAAATGTAGTCTAGAGGG - Intergenic
1013687834 6:112606292-112606314 CTTTGTAAATCAAATCAAATGGG + Intergenic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1014127785 6:117796263-117796285 CTATGCAAATCTAGTAAAGTTGG + Intergenic
1016683993 6:146860993-146861015 CTTTTGAAATGTAATCAGGCTGG - Intergenic
1016732122 6:147438491-147438513 CATTTCAAATGTAATGAGGTGGG - Intergenic
1017019754 6:150130699-150130721 CATTGCAGATGTAATCAGTTAGG - Intergenic
1017308210 6:152945353-152945375 CTTTGGAAATGTAGTCAAATTGG - Intergenic
1017509243 6:155098455-155098477 ATATGAAAATGAAATCAAGTAGG - Intronic
1017916816 6:158837461-158837483 CATTGCAAATGTAATTAGTTTGG - Intergenic
1019912971 7:4112653-4112675 ATTTGCAAGTGAAATCTAGTTGG - Intronic
1020577800 7:9956463-9956485 CTTTGCAAATATGATTAACTTGG + Intergenic
1020679012 7:11214114-11214136 GTTTGCAAATGTTATAATGTAGG - Intergenic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1020993303 7:15229795-15229817 CTCTGCAAATCAAACCAAGTGGG + Intronic
1021109958 7:16682087-16682109 GTTTCCTAATGTAATCAAGATGG - Intronic
1021235208 7:18135157-18135179 CATTTAAAATGTAATGAAGTAGG + Intronic
1022660388 7:32361447-32361469 CCTAGCAAATGTAATAAAGAAGG - Intergenic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1024737500 7:52321414-52321436 CTTTGCAATTTAAATCAAATTGG + Intergenic
1025767655 7:64471423-64471445 TCTTGCAAATGTAATAAATTTGG + Intergenic
1027552349 7:79614853-79614875 AATTGCAAATGTAAACAATTTGG - Intergenic
1028718042 7:93996842-93996864 CTTTCAAAATGTAATAAGGTTGG - Intronic
1029731570 7:102441812-102441834 CTATGCTAATCTAATCAAGCAGG - Intronic
1030642041 7:112017313-112017335 TTTTGGAAATGTTATAAAGTTGG + Intronic
1031072167 7:117173795-117173817 CCTAGCAAATGTAATAAAGAAGG - Intronic
1031492463 7:122405805-122405827 CTTTGGAAATGAAATGAAATTGG + Intronic
1032362210 7:131266462-131266484 CTTTGTAAATGTAATTTATTTGG + Intronic
1033473986 7:141673088-141673110 CTCTGCAAAGGCAATGAAGTGGG + Intronic
1033665988 7:143441018-143441040 CTTTATAAATGTAATCATGAGGG - Intergenic
1033916675 7:146334710-146334732 CTCTGCAAGTGTAATGAAGAGGG + Intronic
1035209582 7:157317971-157317993 ATTTGAAAAAATAATCAAGTGGG - Intergenic
1037465100 8:19152009-19152031 ATTAGCAAATGTAAGCATGTAGG - Intergenic
1039189461 8:34956186-34956208 CTTTGCAAAGGAAACCAAATAGG - Intergenic
1039522520 8:38183357-38183379 TTTTGCAAGTGTAATCAACCAGG + Intronic
1039522952 8:38186912-38186934 CTTTGCAAAAATAATCCAGCTGG + Intronic
1041223439 8:55674480-55674502 CTTTGCAGATGTATTTGAGTAGG + Intergenic
1043624222 8:82234626-82234648 CTTTTAACATGTAATTAAGTAGG - Intergenic
1045171104 8:99669206-99669228 CTTTTAAAATGGGATCAAGTGGG - Intronic
1046528423 8:115412391-115412413 ATTTGCAAATGTAAACAGCTAGG + Exonic
1046807281 8:118493567-118493589 CTTTGCAAATGTGATCAAGGTGG + Intronic
1048003056 8:130395367-130395389 CTTTGCAGATATAATTAAGGTGG + Intronic
1050534219 9:6617763-6617785 CATTGCAAATGTAATCCTGGTGG - Intronic
1050991758 9:12164632-12164654 CTTTGCAAATATAATCCCATGGG + Intergenic
1051519649 9:17971655-17971677 CTTTGCAAATTTAACTAAATGGG + Intergenic
1051759180 9:20441998-20442020 CTTTCCAAATGTAAGTATGTGGG + Intronic
1052470449 9:28887877-28887899 TTTTGCAAATTAAATCCAGTTGG - Intergenic
1053174328 9:35911106-35911128 ATGTGCAAAAGTAATCAATTAGG - Intergenic
1053673987 9:40403077-40403099 CTTTGCATATATAATCAATAAGG - Intergenic
1053923787 9:43029443-43029465 CTTTGCATATATAATCAATAAGG - Intergenic
1054510640 9:65973213-65973235 CTTTGCATATATAATCAATAAGG + Intergenic
1054888544 9:70226157-70226179 TTTTGCAAAAGTAATGAAGGAGG - Exonic
1055707495 9:79022341-79022363 CTTTGCAATTGTGATTAATTAGG - Intergenic
1056502298 9:87221886-87221908 CTTTGAAGATGTAATTAATTAGG - Intergenic
1057098710 9:92337365-92337387 TTTTGCAAAGATAATCAATTTGG + Intronic
1057124284 9:92603851-92603873 CTTTCCAAATGACATCAGGTGGG + Intronic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058783029 9:108358106-108358128 CTTTGCTAATTCACTCAAGTTGG - Intergenic
1058855482 9:109057855-109057877 CTTTGCAAATGTATTTAGGAGGG - Intronic
1059510394 9:114839716-114839738 CTCTGCAAAAGTACTCCAGTGGG - Intergenic
1186395737 X:9207097-9207119 CTGAGGAAATGTAACCAAGTTGG + Intergenic
1189810964 X:44780296-44780318 CTTTGCAAAGTTAAGCATGTTGG - Intergenic
1192626233 X:72731447-72731469 CTGAGCAAAGGTAATCAAGGTGG + Intergenic
1194044008 X:88979317-88979339 ATTTGCACATGTAATTATGTAGG + Intergenic
1196566192 X:117207587-117207609 CTTAACAAATGTCAGCAAGTTGG - Intergenic
1196715090 X:118803139-118803161 CTTTGCTAATGTAGCCAAGGAGG + Intergenic
1196743239 X:119044089-119044111 CTTTACAAATGTGCACAAGTTGG + Intergenic
1197533941 X:127664048-127664070 CCTTGCACATGTACTCCAGTGGG - Intergenic
1198558127 X:137818092-137818114 CTTTGCAGATGTTATTAAATTGG + Intergenic
1200888007 Y:8291066-8291088 CTTATCAACTATAATCAAGTTGG - Intergenic
1201323726 Y:12731442-12731464 GTATGCAACTGAAATCAAGTTGG - Intronic
1202106903 Y:21380422-21380444 CTTTGCATATTTAATGAACTTGG - Intergenic