ID: 933846977

View in Genome Browser
Species Human (GRCh38)
Location 2:86334716-86334738
Sequence CAGCCTGAGCAGATGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933846977_933846984 -9 Left 933846977 2:86334716-86334738 CCAGAGCCCATCTGCTCAGGCTG 0: 1
1: 0
2: 3
3: 23
4: 301
Right 933846984 2:86334730-86334752 CTCAGGCTGGGTGGCCCTCAGGG 0: 1
1: 0
2: 1
3: 44
4: 303
933846977_933846987 13 Left 933846977 2:86334716-86334738 CCAGAGCCCATCTGCTCAGGCTG 0: 1
1: 0
2: 3
3: 23
4: 301
Right 933846987 2:86334752-86334774 GAACCCAGTTTGAAAACCACAGG 0: 4
1: 5
2: 13
3: 121
4: 552
933846977_933846983 -10 Left 933846977 2:86334716-86334738 CCAGAGCCCATCTGCTCAGGCTG 0: 1
1: 0
2: 3
3: 23
4: 301
Right 933846983 2:86334729-86334751 GCTCAGGCTGGGTGGCCCTCAGG 0: 1
1: 0
2: 1
3: 26
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933846977 Original CRISPR CAGCCTGAGCAGATGGGCTC TGG (reversed) Intronic
900147508 1:1164875-1164897 CAGCCTGTGCAGGTGGGACCCGG + Intergenic
900563321 1:3319494-3319516 CAGCCTGGTCTGATGGCCTCAGG - Intronic
901586320 1:10296644-10296666 CAGCCTGTTCAGCTGCGCTCAGG + Exonic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902933565 1:19747891-19747913 CAGCCGCAGCAAAGGGGCTCAGG - Intronic
903129371 1:21268701-21268723 GAGCCAGAGCTGATGGGCACGGG - Intronic
903341950 1:22660301-22660323 GGGCCTGAGAAGATGGGATCTGG - Intronic
903779009 1:25809928-25809950 CAGCCCCATGAGATGGGCTCTGG - Intronic
904423384 1:30408319-30408341 CAGCCTGGCCAGATGGCCTTTGG - Intergenic
904434037 1:30482804-30482826 CAGCCTGAGGATCTGGGATCAGG - Intergenic
905157092 1:35994141-35994163 CAGCCTGAGCAGCATAGCTCGGG - Intronic
905285847 1:36879825-36879847 CAGAAAGAGGAGATGGGCTCTGG - Intronic
906148984 1:43576948-43576970 CAGGCTGAGTAGATGGGCAGGGG - Intronic
906562611 1:46770259-46770281 CATCCTGGGCAGAGGGGCTGGGG + Intronic
907036840 1:51223515-51223537 CAGCCAGATCACTTGGGCTCAGG + Intergenic
907510636 1:54955766-54955788 GGGCCTGAGCATAGGGGCTCAGG - Intergenic
908155069 1:61344880-61344902 AAGCCTGAGCAGCTTGTCTCTGG + Intronic
909443200 1:75720719-75720741 CACCCTGAGCACATGTTCTCAGG - Intergenic
913717397 1:121550686-121550708 TAGCCTGAGAAGGTTGGCTCAGG + Intergenic
914846775 1:151287842-151287864 CAGCCTCAGCTGGTGGGCTCAGG - Exonic
915163932 1:153937974-153937996 CAGCCTGGGAAGATGGCGTCAGG + Intronic
915349025 1:155213137-155213159 CAGCCTTGGGAGGTGGGCTCTGG - Intronic
915352212 1:155233764-155233786 CAGCCTTGGGAGGTGGGCTCTGG - Intergenic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
916202354 1:162284029-162284051 CTGCCTGGGCAGGTGAGCTCTGG - Intronic
921565659 1:216715073-216715095 CAGCATCAGGAGTTGGGCTCAGG - Intronic
922239620 1:223747190-223747212 CAGCAAGAGCAGATGGGGTGAGG - Intronic
923302517 1:232655093-232655115 CAGAATCAGCAGATGGGCTGGGG - Intergenic
924015049 1:239711974-239711996 AAGCCTGGGGGGATGGGCTCTGG - Intronic
1063355576 10:5395465-5395487 CACCCTCTGCAGATGGGATCCGG - Exonic
1066369865 10:34811425-34811447 CTGCAGGGGCAGATGGGCTCTGG - Intronic
1067698629 10:48553059-48553081 CAGCCTGCTCAGATGGGACCTGG - Intronic
1069702041 10:70434056-70434078 GAGCATGAGCACATGGGCTGAGG - Intronic
1071600209 10:86955315-86955337 CAGCCTGAGCATTAGGACTCCGG - Intronic
1071972419 10:90921555-90921577 CAGCCTGAGGGGAAGGGATCTGG + Intergenic
1072570629 10:96654793-96654815 CAGCCTGACCAGAGGGGCATGGG + Intronic
1073132083 10:101196111-101196133 TGGCCTCAGCCGATGGGCTCCGG - Intergenic
1074314968 10:112352908-112352930 CTTCCTGAGGAGGTGGGCTCTGG + Intergenic
1075101605 10:119510137-119510159 CAGCCTGAGCCCCTTGGCTCAGG - Intronic
1075579681 10:123607651-123607673 CAGCCGGAGCAGAAGGGGCCAGG - Intergenic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1076531789 10:131149831-131149853 CAGCATGAGGAGGCGGGCTCAGG - Intronic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1077337146 11:2010536-2010558 GGGCCTGAGCAGATGGGCTGGGG + Intergenic
1077343336 11:2035691-2035713 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1077394200 11:2313161-2313183 AAGCCCGGGCAGCTGGGCTCCGG - Intronic
1078084575 11:8225929-8225951 CAGCCAGGGCTGAAGGGCTCTGG + Intronic
1078091528 11:8267500-8267522 CAGCCTCGGCGGATGGTCTCTGG + Intronic
1078184039 11:9036515-9036537 ATGGCTGAGCAGAGGGGCTCTGG - Intronic
1078707509 11:13759310-13759332 CAGCCAGAGCAGCTGAGCTAAGG + Intergenic
1079090247 11:17476003-17476025 GAGCCTGAGAAGTTGCGCTCTGG + Intronic
1079387487 11:19993669-19993691 CAGTCTGATCACATGGCCTCTGG + Intronic
1080425914 11:32154160-32154182 TAGCCAGAGCTGATGGGCCCAGG - Intergenic
1083782258 11:64924694-64924716 CATCCTGAGCAGCTGGGCGGCGG + Exonic
1084450109 11:69231776-69231798 CAGCCTGGCCACGTGGGCTCGGG - Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087157262 11:94917582-94917604 CAGCTTAGGCAGATGGGGTCTGG - Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088852966 11:113720467-113720489 CAGCATGAGCAAAGGGGCTGTGG - Intergenic
1089930812 11:122309423-122309445 CAGCCGGTGCTGATGGGGTCCGG - Intergenic
1090650546 11:128802332-128802354 CAGCCTGAGCACATTGGCTCTGG - Intronic
1202820130 11_KI270721v1_random:65718-65740 GGGCCTGAGCAGATGGGCTGGGG + Intergenic
1202826322 11_KI270721v1_random:90880-90902 CACCCTGAGCAGCTGGGCGTTGG - Intergenic
1092165604 12:6340780-6340802 CTGCCTGACTAGATGGGCCCAGG + Intronic
1092230343 12:6772608-6772630 CAGCCTGAGGAGGTGGGGGCGGG - Exonic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1094659824 12:32458453-32458475 CAGCCTGGGCACGTTGGCTCAGG - Intronic
1095094442 12:38138291-38138313 CAGCGGGCGCTGATGGGCTCTGG - Intergenic
1095943465 12:47740662-47740684 CTTCCTGAGCAGCTGGGCCCGGG + Exonic
1096165269 12:49417491-49417513 AAGCCTTATCAGATGGGGTCAGG - Intronic
1096778845 12:53980371-53980393 AAGCCTTAGCAGCTGGGCTAGGG + Intergenic
1097388476 12:58979749-58979771 CAGACTGAGGAAATGGGCGCTGG + Intergenic
1097983665 12:65760031-65760053 CAGACTGTGCACATGGGATCAGG + Intergenic
1098369235 12:69739213-69739235 CCGCCTGGGCACTTGGGCTCCGG + Intronic
1101953946 12:109197452-109197474 CTGCCTGTGCATCTGGGCTCTGG + Intronic
1102576535 12:113859373-113859395 CAGGCTGAGCAAATGGGATGGGG + Intronic
1103583339 12:121932923-121932945 CAGGATGCGCAGATGGGCTGGGG + Intronic
1104020254 12:124987484-124987506 CCACCTGAGCAGAGGGGCTGAGG - Intronic
1104751760 12:131244630-131244652 CAGCCAGGGCAGAAGAGCTCAGG + Intergenic
1104780134 12:131414445-131414467 CAGCCAGGGCAGAAGAGCTCAGG - Intergenic
1106487031 13:30181160-30181182 CTGCCTGAGCCCATGGGTTCAGG + Intergenic
1106487032 13:30181163-30181185 TAGCCTGAACCCATGGGCTCAGG - Intergenic
1107253340 13:38392408-38392430 CAGCGTGGGCAGATGGGAACAGG - Intergenic
1110923151 13:81114509-81114531 CAGGCTGGGCAGGTTGGCTCAGG - Intergenic
1111929950 13:94502816-94502838 CTGCATGAGCAGATGTGGTCTGG - Intergenic
1113363844 13:109657378-109657400 CAGCTGGAGCCTATGGGCTCCGG - Intergenic
1114593944 14:23895026-23895048 CTGCATGAGCAGCTAGGCTCAGG + Intergenic
1115414445 14:33114922-33114944 CAGCCTGAGGATATGGGCTGTGG + Intronic
1117425611 14:55592507-55592529 AAACCTGAGTAGATGGGCTATGG + Intronic
1119400192 14:74357834-74357856 AAGCATGAGCTGCTGGGCTCTGG + Exonic
1121063264 14:90937254-90937276 CAGCCTCAGCAGATGGTGGCGGG + Intronic
1121273480 14:92652552-92652574 CAGCCTGAGAAGCAGGGCTTTGG - Exonic
1122814597 14:104306316-104306338 GAGCCTGTGCAGATGGCCTGGGG + Intergenic
1122884129 14:104703033-104703055 ATGCCTGTGCAGCTGGGCTCAGG - Intronic
1123008269 14:105334843-105334865 CTGCCAGACCAGAGGGGCTCTGG - Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1125578901 15:40772258-40772280 CAGCCAGTGCTGCTGGGCTCTGG - Exonic
1126108675 15:45163127-45163149 CTGCCTGAGCAGATGGGAATGGG - Intronic
1126142616 15:45450372-45450394 CAGGCGTAGCAGAGGGGCTCCGG + Intergenic
1127378448 15:58406775-58406797 CAGGCTGAGGAGATGGGGTGGGG - Intronic
1127388449 15:58486251-58486273 CAGCCTGAGGAGATGGGGGAGGG - Intronic
1128516299 15:68344082-68344104 CAGCCTGAGGATATGGGGCCAGG + Intronic
1128798780 15:70483678-70483700 CTGCTTGAGCAGATGGCCTAGGG + Intergenic
1129073901 15:72975264-72975286 CAAGGTGAGCAGCTGGGCTCTGG - Intergenic
1129116211 15:73366908-73366930 CAGCATGAGGAGCTGAGCTCAGG + Intronic
1131508083 15:93033569-93033591 CAGGCTGAGAGCATGGGCTCTGG + Intergenic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1133314434 16:4873768-4873790 CAGTCTGAGGAGATGGGTGCTGG + Intronic
1133434258 16:5765760-5765782 CAGCCTTTGGATATGGGCTCTGG + Intergenic
1133545484 16:6802188-6802210 CAGCCTTTGTAGATGGGCTCTGG + Intronic
1134606522 16:15575670-15575692 GTGCCTGAGCATAGGGGCTCAGG + Intronic
1135420194 16:22300602-22300624 CAGCCGGTGCAGATGGGGTGAGG + Intronic
1135421792 16:22309713-22309735 CTGCCTGACCAGATGGGGTGGGG + Intronic
1135918432 16:26626393-26626415 CTGCCTGGTCAGATGGGCTCAGG + Intergenic
1137462917 16:48681856-48681878 AAGCCTGAGGAGAGGGGCTGTGG + Intergenic
1137734576 16:50714215-50714237 CAGGGTGTGCAGAAGGGCTCTGG + Intronic
1138239349 16:55414410-55414432 CAGCCAGTGCAGATGGCCTGAGG + Intronic
1138549727 16:57740792-57740814 CAGACTGAGCAGCTGGGGTGGGG - Intronic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1138747565 16:59381197-59381219 ATGCCTGAGCAGAAGGTCTCTGG - Intergenic
1138959445 16:62011139-62011161 GAGCCTGATCAGAAGGGCTGAGG - Intronic
1139960093 16:70712472-70712494 CAGCCTGAGCCCAATGGCTCAGG - Intronic
1140097110 16:71884284-71884306 GGGCCTGAGGAGAGGGGCTCTGG + Intronic
1140687847 16:77450829-77450851 CAGCCTGAGCTGCTGGACCCTGG + Intergenic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1141466222 16:84207438-84207460 CAGCCTTTGCAGAAGGGCACTGG - Intergenic
1142109584 16:88324053-88324075 CAGCTGGAGCAGCTGGGCTGGGG + Intergenic
1142363169 16:89636755-89636777 CAGGCAGAGGGGATGGGCTCTGG - Intronic
1143479272 17:7219291-7219313 CTGCCTGGGCACATGGTCTCTGG + Exonic
1143635476 17:8162021-8162043 CAGCCTGGGCAGGTGTGCTCTGG - Intronic
1144576645 17:16433831-16433853 GAGCCTGAGCAGGTGAGGTCAGG + Intronic
1144726807 17:17506353-17506375 CAGCCTGGGCAGGTGGGCCGTGG - Intronic
1145983382 17:29027667-29027689 AGGCCTGAACAGAAGGGCTCTGG - Intronic
1146953623 17:36923142-36923164 AAGCCTGAGAAGCTGGGCCCTGG + Intergenic
1149953748 17:61021652-61021674 AAGCCAGTGCTGATGGGCTCAGG + Intronic
1149995377 17:61403567-61403589 GAGCCTGGGCAGATTGCCTCGGG - Intronic
1150147107 17:62778230-62778252 GAGGCTGGGCAGATGAGCTCGGG + Intronic
1150429257 17:65102192-65102214 CCCCCTGAGCAGAGAGGCTCGGG - Intergenic
1150647016 17:66985080-66985102 CAGCCTGGGCAGCTGTGATCGGG + Intronic
1151379098 17:73712580-73712602 CAGCCTGTGCACAAGGGGTCTGG + Intergenic
1151927227 17:77207310-77207332 CAGCCTGACTTGGTGGGCTCAGG + Intronic
1152758200 17:82095915-82095937 CAGCCTGGCCGGAAGGGCTCTGG + Intronic
1152771274 17:82171061-82171083 CAGCCAGGGCACGTGGGCTCCGG + Intronic
1155472404 18:26204787-26204809 CATCCTGAGCAGCTGCTCTCTGG + Intergenic
1156903241 18:42325719-42325741 CACCCTGAGCACATGAACTCAGG + Intergenic
1158390427 18:57040508-57040530 CAGCCTGAGCACATGGTCATTGG - Intergenic
1158626627 18:59077351-59077373 GTGGCTGAGCATATGGGCTCTGG - Intergenic
1158959286 18:62575088-62575110 CCACCGCAGCAGATGGGCTCAGG + Exonic
1159357345 18:67354278-67354300 CAGCCCCAGCATCTGGGCTCTGG + Intergenic
1160534459 18:79584787-79584809 CAGCCTGGGCAGAAGGGGCCGGG + Intergenic
1160829685 19:1097905-1097927 CAGCCTCAACCGCTGGGCTCAGG - Intergenic
1161056940 19:2195416-2195438 GAGACAGAGCAGATGGGCCCGGG - Intronic
1161398791 19:4058689-4058711 CTGCCTGAGCTGCTGGGCTGGGG - Intronic
1161628902 19:5341425-5341447 CCTCCTGAGTAGTTGGGCTCGGG + Intergenic
1162334225 19:10050262-10050284 CAGGCTGGGCAGGTGGGCCCAGG + Intergenic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1162787253 19:13043509-13043531 CAGACTGCGCAGCTGGCCTCAGG - Intronic
1163182799 19:15615871-15615893 CAGGCTGAGGGGGTGGGCTCGGG + Intronic
1166299559 19:41906320-41906342 AAGGCTGAGCAGATGGGGTTCGG - Intronic
1166333235 19:42090694-42090716 CAGCCTGGGCAGATGGGCTGGGG - Exonic
1167516268 19:49924791-49924813 CAGACTTAGCAGCTGGACTCAGG - Intronic
1167631182 19:50627189-50627211 CAGCCTGGGCAGATGCCCTGAGG - Intronic
925386925 2:3468361-3468383 CAGCCTGAGCAGCTGGACCAGGG - Intronic
927112661 2:19875101-19875123 CAGCCTGAGCAGATGCTGTAAGG + Intergenic
928063265 2:28136403-28136425 CAGCCTGGCCAGAGGGGCTGTGG - Intronic
928196424 2:29219644-29219666 AAGCATGGGCAGCTGGGCTCTGG + Intronic
928366532 2:30707151-30707173 CAGCCTGAGGAGGAGGGCTGTGG + Intergenic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
931696416 2:64873878-64873900 CAGTCTGGGCACATTGGCTCAGG + Intergenic
931830476 2:66045813-66045835 CAGCCTGAGCAGACTAGCACAGG + Intergenic
932580258 2:72988802-72988824 CAGCCAGACCATAAGGGCTCAGG + Intronic
933386954 2:81622872-81622894 CAGCCTGGGCACAGAGGCTCCGG + Intergenic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
936457763 2:112688524-112688546 CAGAATGAGAAGATGGGTTCTGG - Intergenic
936477182 2:112849439-112849461 CACCCTGAGCACATGTGGTCAGG + Intergenic
937060361 2:118976323-118976345 CAGAAAGTGCAGATGGGCTCTGG - Intronic
938259020 2:129882073-129882095 CACCGTGAGTAAATGGGCTCTGG + Intergenic
938370459 2:130764827-130764849 CTGCCTGAGCTGGTGGGTTCAGG - Exonic
940053185 2:149485646-149485668 CAGGATGAGCTGCTGGGCTCTGG - Intergenic
940645579 2:156389145-156389167 AAGCAGGAGCAGATGGGTTCTGG - Intergenic
941705926 2:168657837-168657859 CAGGCTGAGGAAGTGGGCTCTGG + Intronic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
942284036 2:174395909-174395931 CAGCCGGTGCAGCTGGGCTCCGG - Intronic
942512416 2:176716723-176716745 CACCCTGAGCACATGTCCTCAGG + Intergenic
944599390 2:201288027-201288049 CAGCCTCAGTAGAGGGGCTTGGG - Intergenic
946090180 2:217215538-217215560 CAGCCTGAGCTTCTGGGCTCAGG + Intergenic
946309902 2:218877690-218877712 CAGCCTGAGGCCACGGGCTCGGG + Intergenic
947669267 2:231926205-231926227 CAGCGTGAGCAGCAGGGCGCAGG + Exonic
947946303 2:234105907-234105929 AAGCCTCAGCAGCTGGTCTCTGG + Intergenic
948234918 2:236380205-236380227 CGGCCTCAGCAGAGGCGCTCGGG + Intronic
948645202 2:239400366-239400388 CCCCCCGAGCAGGTGGGCTCCGG - Exonic
1169908855 20:10630646-10630668 CATGCTGAGCAGAAGGGCGCTGG - Intronic
1170891033 20:20375532-20375554 TATGCTGAGCAGATGGGTTCTGG + Intergenic
1172390982 20:34565085-34565107 CAGACTGGGCAAAGGGGCTCTGG - Intronic
1173127851 20:40356608-40356630 TAGCTTGAGCAGATAGGCACTGG - Intergenic
1173152798 20:40582205-40582227 CAGGCTGAACAGATGGGCAGTGG - Intergenic
1173882391 20:46425898-46425920 CAGCCAGTGCAGCTGGTCTCAGG - Intronic
1175305193 20:57971029-57971051 CATGCTGAACAGATGGGCTGGGG - Intergenic
1175892169 20:62320763-62320785 CAGCCTGTGCAGACGGGCCCAGG + Exonic
1176900650 21:14437730-14437752 GAGCTTGAGCAGGTGGGCCCCGG + Intergenic
1178267172 21:31154348-31154370 AGTCCTGAGGAGATGGGCTCTGG + Exonic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180151054 21:45948116-45948138 CAGCCTCAGGAGAGGGGCTAGGG - Intergenic
1180212427 21:46302742-46302764 CACCGTGTGCAGACGGGCTCAGG - Intronic
1180212440 21:46302783-46302805 CACCGTGTGCAGACGGGCTCAGG - Intronic
1180212453 21:46302824-46302846 CACCGTGTGCAGACGGGCTCAGG - Intronic
1180212466 21:46302865-46302887 CACCGTGTGCAGACGGGCTCAGG - Intronic
1180212479 21:46302906-46302928 CACCGTGTGCAGACGGGCTCAGG - Intronic
1180226304 21:46394402-46394424 CAGCGTCAGCAGCAGGGCTCTGG - Intronic
1181086441 22:20441725-20441747 CAGCCTGGGCAGGGGGGCTGAGG - Exonic
1181630513 22:24148765-24148787 CAGCCTGAGCGGGTGGGGCCTGG - Intronic
1181950533 22:26550613-26550635 GAGCCTGAGCACGTGGGCACTGG - Intronic
1182061583 22:27402294-27402316 CATCCTGAGCAAATGGACCCAGG + Intergenic
1182585738 22:31343473-31343495 CCGCCTGAGCAGGTGGGCAGGGG + Intronic
1183933348 22:41248490-41248512 CTGCCTCAGCTGGTGGGCTCTGG + Intronic
1184339571 22:43878931-43878953 CACCCTCAGCAGCTGGGTTCGGG - Intergenic
1184538953 22:45107152-45107174 CAGCCTGAGCTGATGGAGCCAGG + Intergenic
1185073853 22:48672200-48672222 AAGCCTTAGCCGATGGACTCTGG + Intronic
949119183 3:365141-365163 CAGCTTGTGCAGTTGGTCTCTGG + Intronic
949910042 3:8896084-8896106 CAGCATGCCCAGATGGGCTTGGG - Intronic
950579063 3:13850945-13850967 CAGCCTGGGCAAATGGGTACTGG - Intronic
950764313 3:15262010-15262032 GAGCCTGAGCAGGGGGGCTCTGG + Intronic
953880610 3:46689513-46689535 CTGCCTGAGAGGATGGGCACTGG - Intronic
954305269 3:49722259-49722281 CAGCCTGAGCGGCTGTGCTCAGG - Exonic
954447998 3:50557009-50557031 CAGCAGGAGCGGATGGGCACTGG + Intergenic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
955133245 3:56191093-56191115 CAACCTGAGCAGAAGGGCACAGG + Intronic
955698420 3:61659225-61659247 CAGCCTGAATAGATGTTCTCAGG + Intronic
960963105 3:123085649-123085671 CTGCCTGGGCAGATGAGCTCTGG + Intronic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961824040 3:129589502-129589524 CAGCCAGAGCAGCTGGACTGTGG - Exonic
962317288 3:134366873-134366895 CAGTTTTAGCAGATGGCCTCAGG - Intronic
964053829 3:152427163-152427185 CAGCCTGAGAGAATGGGCCCTGG + Intronic
964679203 3:159318631-159318653 CAGCCTGCACTGATGGCCTCAGG - Intronic
965226726 3:166000477-166000499 CAGCCTGCACCGATGGCCTCAGG - Intergenic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
967390487 3:188949427-188949449 CAGCCACATCAGATGGGTTCTGG + Intronic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
968321691 3:197774858-197774880 CAGCCTGAGCAGCATAGCTCGGG + Intronic
968952115 4:3700563-3700585 CAGACTGGGCAGATGGGTTAGGG + Intergenic
969688351 4:8689440-8689462 CACCCTCAGCTCATGGGCTCTGG + Intergenic
969841555 4:9886771-9886793 CAGACTGAGAAGGGGGGCTCAGG - Intronic
969894816 4:10293543-10293565 CAGCCTGGACAGTTGGGCTGAGG + Intergenic
972201271 4:36716902-36716924 CAGCCTGCACCGATGGCCTCAGG - Intergenic
975743870 4:77456759-77456781 CTTCCTGAGCAGCTGGGATCTGG + Intergenic
979316635 4:119272681-119272703 CAGCCTGGGCATAGTGGCTCAGG - Intronic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
982428306 4:155293239-155293261 CACCCTGGGCACATGGTCTCAGG - Intergenic
983504868 4:168542209-168542231 TAGCCTGAGCAGTTTGTCTCTGG + Intronic
987927961 5:24365546-24365568 CAGCCTGAGCAGATAGGTATTGG - Intergenic
991031215 5:62084282-62084304 CTGCCTGAGTTGATGGGCGCTGG - Intergenic
991929466 5:71738207-71738229 CAGCCTGAGCAGTGGGGTTTGGG - Intergenic
994591825 5:101783527-101783549 CGGCCTCTGCAGTTGGGCTCAGG + Intergenic
995198672 5:109401311-109401333 CAGCCTGGGCACAGTGGCTCAGG + Intronic
997408222 5:133669388-133669410 CAGCCTGACCAAAAGTGCTCAGG + Intergenic
997696801 5:135867475-135867497 GAGCCTCAGCAGATAGCCTCAGG - Intronic
997884674 5:137619642-137619664 CAGCTAGAGCAGATTGGCTTTGG + Exonic
998456618 5:142278741-142278763 CAGTCTGAGCCCATGGGCTGGGG - Intergenic
1002698845 5:181108670-181108692 CAGCCTCCTCTGATGGGCTCGGG - Intergenic
1004265408 6:14144829-14144851 CAGCCTGAGCAGGAGGGATGGGG - Intergenic
1005814684 6:29541050-29541072 AAGCAGGAGCAGTTGGGCTCTGG + Intergenic
1005868719 6:29957487-29957509 CACCCTGAGGTGCTGGGCTCTGG + Intergenic
1006092384 6:31635675-31635697 TGGCCTGAGGAGCTGGGCTCCGG - Exonic
1006408008 6:33856327-33856349 CAGCTGGTGCAGATGGGGTCTGG + Intergenic
1006706393 6:36024677-36024699 GAGCATGAGCAGCTGGGCTAGGG + Exonic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1007235237 6:40386374-40386396 CAGCCTGGACGGATGGGCTGGGG + Intergenic
1007264241 6:40585367-40585389 CAGCATCAGCAGAAGGGCCCAGG + Intronic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1009750798 6:67877248-67877270 CAGCATGAGCACATGTTCTCAGG - Intergenic
1009751634 6:67884286-67884308 CACCTTGACCAGATGGGTTCTGG - Intergenic
1011793542 6:90926910-90926932 CAGCTTGAGAAGAAGTGCTCTGG - Intergenic
1012528545 6:100206416-100206438 CCTCCAGAGCAGAGGGGCTCTGG - Intergenic
1018010540 6:159666005-159666027 AAGCCTCAGCATATGGGCTGTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018582535 6:165319498-165319520 GGGCCTGAGCACAGGGGCTCAGG - Intergenic
1019023306 6:168937322-168937344 CCACCTGAGCAGCTGGCCTCCGG + Intergenic
1019981906 7:4627938-4627960 CAGCCTAAGAGGATGGGCTCTGG - Intergenic
1020087508 7:5319214-5319236 CAGCCTGAGTAGAGGATCTCAGG - Intronic
1020697811 7:11437127-11437149 CAGCCTGGCCTGAGGGGCTCTGG + Intronic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1024533205 7:50409927-50409949 TGGGCTGAGCAGATGGGCCCTGG + Intergenic
1025206803 7:56997951-56997973 CAGCCTGAGTAGAGGATCTCAGG + Intergenic
1025665137 7:63578976-63578998 CAGCCTGAGTAGAGGATCTCAGG - Intergenic
1029359181 7:100075824-100075846 CTGCCTGAGCAGATGGCCACAGG + Intronic
1029946382 7:104537571-104537593 CAGCCAGAGAAGATGGGCAGTGG - Intronic
1030090543 7:105854066-105854088 CTGCCTGCAGAGATGGGCTCTGG - Intronic
1031977383 7:128102667-128102689 CTGCCTGAGGAGAGGGGCTGGGG + Intergenic
1032708343 7:134441458-134441480 CAGCCTGTGCAGTGGGGCTCTGG + Intergenic
1032793401 7:135258877-135258899 CAGGATGAGCAGGTGGGCTGTGG - Intergenic
1033033343 7:137847223-137847245 CAGCGTCGGCAGCTGGGCTCAGG - Intergenic
1036104293 8:5823811-5823833 CATCCTGAGCAGATGTGCGGTGG - Intergenic
1038069303 8:23995730-23995752 AAGGCTGATCAGATTGGCTCTGG + Intergenic
1039020022 8:33194962-33194984 TAGCCTGAGAAAATGTGCTCCGG - Intergenic
1039890295 8:41681432-41681454 TGGCCAGAGCAGAGGGGCTCAGG - Intronic
1040484561 8:47857696-47857718 CACCCTGGGCACATGGTCTCAGG - Intronic
1040555594 8:48475079-48475101 CAGCCTGGGAAGATGGGCAGGGG - Intergenic
1040915493 8:52564067-52564089 AAGCCTGAGGAGAAGGGATCAGG + Intronic
1041760234 8:61358414-61358436 AAGCCTGAGCAGATAGACTTTGG - Intronic
1045036170 8:98178196-98178218 CTGCATGAGCAGATGGGAACTGG - Intergenic
1048304512 8:133274192-133274214 CTGCCAGAGCAGATGGCATCAGG - Intronic
1048963448 8:139598289-139598311 GAGCTTGAGCAGATGGGGGCAGG - Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049510217 8:143023447-143023469 CAGGCTGCTCTGATGGGCTCCGG - Intronic
1049709533 8:144057374-144057396 CAGCCTGAGCAGGAGGCCTGGGG + Intronic
1052569114 9:30198614-30198636 CATGCTGAGCGGATGGCCTCTGG + Intergenic
1056262389 9:84862062-84862084 CAGCCTGGCCAGATGGGGCCTGG + Intronic
1056273671 9:84971726-84971748 CAGAGTAAGCAGATGGGCTGAGG + Intronic
1057184295 9:93048212-93048234 CTGCATGAGCAGAGGGGCTTTGG + Intergenic
1058802403 9:108557554-108557576 CAGCCTTAGCAGAGGTGCCCTGG - Intergenic
1060145248 9:121247231-121247253 CAGCCAGACCAGAGGTGCTCAGG + Intronic
1185893963 X:3842848-3842870 CTGCAGGAGCAGCTGGGCTCCGG - Intronic
1185899080 X:3881272-3881294 CTGCAGGAGCAGCTGGGCTCCGG - Intergenic
1185904197 X:3919701-3919723 CTGCAGGAGCAGCTGGGCTCCGG - Intergenic
1185996035 X:4950371-4950393 CACCCTGGGCACATGTGCTCAGG + Intergenic
1189594821 X:42553031-42553053 CAGCGTGAACACATGGGCACAGG - Intergenic
1191731815 X:64344313-64344335 CAGACTGAGCAGATGAGATCTGG + Intronic
1196027044 X:111052097-111052119 CAGCATGAGGAGCTAGGCTCAGG - Intronic
1198054781 X:132983090-132983112 CAGACTGAGCTGATGGGATGTGG - Intergenic
1198434871 X:136607430-136607452 CACCCTGGGCAGATGTTCTCAGG - Intergenic
1199983394 X:152933489-152933511 CAGCGTGTCCAGCTGGGCTCTGG + Intronic
1199996950 X:153031561-153031583 CTGCCCCAGCAGATGGGCTTGGG + Intergenic
1200001098 X:153060160-153060182 CTGCCCCAGCAGATGGGCTTGGG + Intronic
1200034246 X:153317960-153317982 CTGCCCCAGCGGATGGGCTCGGG - Intergenic
1200787892 Y:7274937-7274959 CTGCAGGAGCAGCTGGGCTCCGG + Intergenic