ID: 933847542

View in Genome Browser
Species Human (GRCh38)
Location 2:86337703-86337725
Sequence CCCGCCGAGCCCCGGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933847542_933847557 18 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847557 2:86337744-86337766 TGAGCTGGTCAGGGCACCCGCGG 0: 1
1: 0
2: 1
3: 17
4: 314
933847542_933847555 8 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847555 2:86337734-86337756 GATTGGGCGGTGAGCTGGTCAGG 0: 1
1: 0
2: 0
3: 13
4: 65
933847542_933847549 -9 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847549 2:86337717-86337739 CTCGGCGGGCCCGCAGCGATTGG 0: 1
1: 0
2: 0
3: 0
4: 36
933847542_933847556 9 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847556 2:86337735-86337757 ATTGGGCGGTGAGCTGGTCAGGG 0: 1
1: 0
2: 2
3: 10
4: 110
933847542_933847554 3 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847554 2:86337729-86337751 GCAGCGATTGGGCGGTGAGCTGG 0: 1
1: 1
2: 0
3: 4
4: 92
933847542_933847558 19 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847558 2:86337745-86337767 GAGCTGGTCAGGGCACCCGCGGG 0: 1
1: 0
2: 1
3: 13
4: 151
933847542_933847550 -8 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847550 2:86337718-86337740 TCGGCGGGCCCGCAGCGATTGGG 0: 1
1: 0
2: 0
3: 2
4: 12
933847542_933847551 -5 Left 933847542 2:86337703-86337725 CCAGCCCCCCGGGGCTCGGCGGG 0: 1
1: 0
2: 1
3: 43
4: 345
Right 933847551 2:86337721-86337743 GCGGGCCCGCAGCGATTGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933847542 Original CRISPR CCCGCCGAGCCCCGGGGGGC TGG (reversed) Intronic