ID: 933858402

View in Genome Browser
Species Human (GRCh38)
Location 2:86441302-86441324
Sequence AGCGGCGGAAGCGGCTCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933858390_933858402 15 Left 933858390 2:86441264-86441286 CCCCGGAGCCTCGCCCAGCTCCT 0: 1
1: 0
2: 6
3: 45
4: 393
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858392_933858402 13 Left 933858392 2:86441266-86441288 CCGGAGCCTCGCCCAGCTCCTGT 0: 1
1: 1
2: 5
3: 42
4: 367
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858396_933858402 -5 Left 933858396 2:86441284-86441306 CCTGTGTTTCAGCCAATGAGCGG 0: 1
1: 0
2: 0
3: 4
4: 66
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858394_933858402 2 Left 933858394 2:86441277-86441299 CCCAGCTCCTGTGTTTCAGCCAA 0: 1
1: 0
2: 2
3: 17
4: 199
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858391_933858402 14 Left 933858391 2:86441265-86441287 CCCGGAGCCTCGCCCAGCTCCTG 0: 1
1: 1
2: 7
3: 54
4: 540
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858389_933858402 16 Left 933858389 2:86441263-86441285 CCCCCGGAGCCTCGCCCAGCTCC 0: 1
1: 0
2: 2
3: 33
4: 335
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858393_933858402 7 Left 933858393 2:86441272-86441294 CCTCGCCCAGCTCCTGTGTTTCA 0: 1
1: 0
2: 5
3: 51
4: 474
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
933858395_933858402 1 Left 933858395 2:86441278-86441300 CCAGCTCCTGTGTTTCAGCCAAT 0: 1
1: 0
2: 1
3: 22
4: 400
Right 933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933858402 Original CRISPR AGCGGCGGAAGCGGCTCCGA GGG Exonic