ID: 933858434

View in Genome Browser
Species Human (GRCh38)
Location 2:86441443-86441465
Sequence GGGTAAGAGCGCCGCGGCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933858428_933858434 3 Left 933858428 2:86441417-86441439 CCGGTGACTCAGGGAGGCGGGAG 0: 1
1: 0
2: 0
3: 24
4: 299
Right 933858434 2:86441443-86441465 GGGTAAGAGCGCCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 67
933858425_933858434 6 Left 933858425 2:86441414-86441436 CCGCCGGTGACTCAGGGAGGCGG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 933858434 2:86441443-86441465 GGGTAAGAGCGCCGCGGCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933858434 Original CRISPR GGGTAAGAGCGCCGCGGCCT CGG Exonic