ID: 933862879

View in Genome Browser
Species Human (GRCh38)
Location 2:86487644-86487666
Sequence GGTGATGGGGAGTTAAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933862879_933862889 25 Left 933862879 2:86487644-86487666 CCCACTCTTAACTCCCCATCACC 0: 1
1: 0
2: 1
3: 26
4: 248
Right 933862889 2:86487692-86487714 TTTTCCCCCTTAAAAGTCCATGG 0: 1
1: 0
2: 5
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933862879 Original CRISPR GGTGATGGGGAGTTAAGAGT GGG (reversed) Intronic
901081163 1:6585079-6585101 GGGGTTGGGGAGTTGTGAGTGGG + Intronic
901720939 1:11196995-11197017 GGTGAAGGGAAAATAAGAGTAGG + Intronic
902038283 1:13473462-13473484 GCTGAAGGGGAGAAAAGAGTGGG + Intergenic
902285686 1:15407119-15407141 GGTGATGGGGAGATAGCACTGGG - Intergenic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
903129298 1:21268310-21268332 GGTTTTGGGGAGATGAGAGTGGG - Intronic
903224649 1:21887752-21887774 GGTGTTGGGGAGTACAGGGTGGG - Intronic
904394943 1:30213815-30213837 GGTGAGGAGGAGGTTAGAGTTGG + Intergenic
904977827 1:34472193-34472215 GGTATTGGGGAGTGGAGAGTGGG - Intergenic
906124998 1:43422362-43422384 GGTTATGGGGACTGAAGAGCAGG - Intronic
906159549 1:43637624-43637646 AGTGATGCGGAGGTAAGAGAAGG + Intergenic
907489514 1:54800207-54800229 GGTGAGGGGGAGAGAAGAGGTGG + Intronic
910892055 1:92028827-92028849 GGTGAGGGGGAGGGAAGAGGTGG - Intergenic
911619422 1:100050152-100050174 GGTAAGGGAGAGTTAACAGTTGG - Intronic
913452164 1:118999814-118999836 GGAGATGGGGAGGAAAGAGAGGG + Intergenic
918586605 1:186195486-186195508 GGAGATGCAGAGTTAAGATTTGG + Intergenic
918875867 1:190042538-190042560 AGTGATGTGAAGTTCAGAGTAGG - Intergenic
919355159 1:196512981-196513003 GGTGATGGGAAGAAGAGAGTGGG - Intronic
920150532 1:203902756-203902778 GGTGAAGGGGAGAGAAGAATGGG - Intergenic
920164753 1:204028042-204028064 GGTGATGGGGATTTAATTCTGGG + Intergenic
924138031 1:240991511-240991533 GGAAATGCGGAGTTAAGAGAAGG + Intronic
1062983938 10:1749024-1749046 GGTGGTGAGGAGTTAGGAGGGGG - Intergenic
1063621685 10:7654897-7654919 GGGTATGGGGAGGTAAGATTGGG + Intronic
1063662248 10:8042983-8043005 GGTGATGGGGAGATGTGTGTAGG + Intergenic
1066046227 10:31597874-31597896 TGTGAAGGGGAGTCAAGAGAGGG + Intergenic
1067267244 10:44757031-44757053 GGAGATGGGGAGGTGAGAGGGGG - Intergenic
1068936407 10:62639604-62639626 GGTGATGGGGGGCTGTGAGTAGG - Intronic
1070159530 10:73857770-73857792 AGTGGTGGGGAGTTGAGAGGAGG - Intronic
1070660038 10:78299040-78299062 GGGGATGGAGTGTCAAGAGTCGG - Intergenic
1070663037 10:78321335-78321357 GGGAGTGGGGAGTTAGGAGTGGG + Intergenic
1070881982 10:79858689-79858711 GCTAATGGGCAGTGAAGAGTTGG - Intergenic
1071287728 10:84164220-84164242 GGTGACTGGGAGTGAAGTGTGGG + Intergenic
1071451516 10:85795969-85795991 GGAGCTGGGGAGTTAAGGGAGGG + Intronic
1071648557 10:87375000-87375022 GCTAATGGGCAGTGAAGAGTTGG - Intergenic
1072738987 10:97898313-97898335 GGTCATGGGGAGTCCAGAGTTGG + Intronic
1073149302 10:101300981-101301003 GGTTTTGGGGACTTAAGACTTGG + Intergenic
1073272770 10:102280221-102280243 GGGGATGGGGAGGCAAGGGTAGG + Intronic
1073510337 10:104038795-104038817 GGTGCTGGGGAGTTGAGAGAAGG - Intronic
1074574016 10:114651548-114651570 GGTGTTTGGGGGTTAAGAGTGGG + Intronic
1076441451 10:130483838-130483860 GGTGATGGGGAGTAATGGGCTGG + Intergenic
1078547504 11:12256760-12256782 GGGGATCGGGAGAGAAGAGTGGG - Intronic
1080354016 11:31420306-31420328 GGTGGTGGGAAGTTGGGAGTAGG - Intronic
1081521214 11:43882878-43882900 GTTGATGGTGAGCTAAGGGTGGG + Intronic
1081993132 11:47348115-47348137 GGTGAAGGTGAGTTGAGAGATGG - Intronic
1082735746 11:56853799-56853821 GCTTATGCTGAGTTAAGAGTTGG - Intergenic
1083752066 11:64766297-64766319 GGTGATGGGGAGTGGAGGGGTGG + Intronic
1085542567 11:77286224-77286246 GGTGATGGGTGATTAAGAATTGG - Intronic
1089980141 11:122765491-122765513 GGTGAAGGGGAACAAAGAGTTGG + Intronic
1090073532 11:123564222-123564244 GGTGATGCTGAGTTAACTGTGGG + Intronic
1092014745 12:5149373-5149395 GGTGCTGGGGAGTTAGGAGATGG + Intergenic
1092502069 12:9057883-9057905 GGTGATGTGGATTTTAGAGTAGG + Intergenic
1092893503 12:12991452-12991474 GGTGATGGGGAGATGAAAGAAGG - Intronic
1094532767 12:31292562-31292584 GGAGATGGGGGGTTGAGAGCTGG + Intronic
1095562525 12:43583040-43583062 GGGGATGGGGAGTTAGGGGAGGG + Intergenic
1096254144 12:50052659-50052681 AGAGATGGGGAGTGAAGAGGGGG + Intergenic
1096611515 12:52805171-52805193 GGTGAGGAGGAGTTAAAGGTTGG - Intergenic
1097258685 12:57700191-57700213 GGTGCTGGGGGGTTGAGAGAGGG + Intronic
1099076714 12:78118563-78118585 GGTAATGGGGAAATAAGATTAGG + Intronic
1102345893 12:112161309-112161331 GGTGATGGGGAGTGCTGGGTGGG + Exonic
1103948681 12:124540563-124540585 GGGGATGGGGAGTGAAGAGCTGG + Intronic
1103948715 12:124540657-124540679 GGGGATGGGGAGTGAAGAGCTGG + Intronic
1103948774 12:124540809-124540831 GGGAATGGGGAGTGAAGAGCTGG + Intronic
1103948824 12:124540952-124540974 GGGGATGGGGAGTAGAGAGCTGG + Intronic
1103948877 12:124541114-124541136 GGGGATGGGGAGTGAAGAGCTGG + Intronic
1103948886 12:124541139-124541161 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1103948938 12:124541298-124541320 GGGGATGGGGAGTGAAGAGCTGG + Intronic
1103948985 12:124541442-124541464 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1103949160 12:124541921-124541943 GGGGATGGGGAGTGGAGAGCTGG + Intronic
1104671673 12:130685118-130685140 GGTGTGGGGGAGATAAGAGAGGG - Intronic
1105011681 12:132761073-132761095 GGTGATGTGGAGATCAGAGGTGG - Intronic
1105632178 13:22180895-22180917 GGTGATTGGGTCTTAAGAATTGG + Intergenic
1105889071 13:24669104-24669126 GGTGATGTGGAGTGAACTGTGGG - Intergenic
1109713410 13:66188328-66188350 GCTGCTGTGGAGTTAAGATTTGG - Intergenic
1112712118 13:102141019-102141041 GTTGGTGGTGAGTTAAGAATGGG - Intronic
1113131500 13:107042381-107042403 GGTGCTGGGAAGTTCAGACTGGG - Intergenic
1113558707 13:111258992-111259014 GGAAAAGGGGAGTGAAGAGTGGG + Intronic
1114260570 14:21033421-21033443 GGGGATGGGGAGGTGAGACTCGG + Exonic
1115324342 14:32121757-32121779 GTTGATGGGGGGGTGAGAGTGGG - Intronic
1116051151 14:39804783-39804805 GGGGATGGGAGGTTGAGAGTGGG + Intergenic
1116140180 14:40983396-40983418 GATAGTGGGGAGTTGAGAGTGGG - Intergenic
1116832865 14:49739559-49739581 GGTGATGGGGAACATAGAGTAGG + Intronic
1116982931 14:51190469-51190491 GGTGAGGGGCAGTGAAGACTGGG - Intergenic
1118602832 14:67482503-67482525 GGGGATGGGGAGTGAAGCTTGGG - Intronic
1118706910 14:68488557-68488579 GGTGATAGGGTATTAAGGGTGGG - Intronic
1119439721 14:74620036-74620058 GGTCATGGGGGGTGAAGAGGAGG - Intergenic
1121307322 14:92915209-92915231 GCTGATGAGGGGATAAGAGTGGG + Intergenic
1121390650 14:93570562-93570584 GGTGAAGGGGAGTTTATGGTGGG + Intronic
1124888888 15:33713234-33713256 GGTGATGGGGTGTTCATGGTGGG + Intronic
1125012397 15:34893549-34893571 GTTGAGGGGGAGGTAAGTGTGGG - Intronic
1125930869 15:43599263-43599285 GGCGATGGGGAGTTAATGCTTGG - Exonic
1125944036 15:43699079-43699101 GGCGATGGGGAGTTAATGCTTGG - Exonic
1126547943 15:49893280-49893302 GAAGATGGGGAGGTGAGAGTGGG + Intronic
1127375274 15:58378677-58378699 GGTGATGGGGAGGTCTAAGTAGG - Intronic
1128711713 15:69877010-69877032 GGTGAGGAGCAGGTAAGAGTAGG + Intergenic
1129652308 15:77499736-77499758 GGTGGAGGGGAGTTAAGAGGGGG - Intergenic
1131506584 15:93025181-93025203 GCTGATGGGGAGTGGCGAGTTGG + Exonic
1131662654 15:94535052-94535074 GATGATGGGGGAATAAGAGTTGG + Intergenic
1133393932 16:5430997-5431019 GGATATTGGGAGTTAAGAGAAGG + Intergenic
1133403141 16:5503322-5503344 GGTGAGGGAGATTCAAGAGTGGG - Intergenic
1133820105 16:9228322-9228344 GGAAGGGGGGAGTTAAGAGTAGG + Intergenic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1135476046 16:22776087-22776109 GGTTATGGTGAGTGGAGAGTGGG + Intergenic
1135942843 16:26837815-26837837 GGTGAGGTGGAGTGAGGAGTAGG + Intergenic
1135975587 16:27107256-27107278 GGGGAGGGGGAGTTAAGGGGGGG - Intergenic
1136377111 16:29872226-29872248 GGTGATGGGGCTGTAGGAGTGGG + Exonic
1138329959 16:56205550-56205572 GCACATGGGGAATTAAGAGTAGG - Intronic
1139457580 16:67094272-67094294 TGTGATGAAGAGTCAAGAGTAGG - Intronic
1140942301 16:79733649-79733671 GGTGATGGGGTGATAATGGTAGG - Intergenic
1141822124 16:86453700-86453722 GGTGATGGGGAGGTGGGGGTGGG - Intergenic
1142916688 17:3146427-3146449 GGTGGTGGCCAGTTAGGAGTTGG - Intergenic
1143649568 17:8255137-8255159 GGTGATGGGGAATCAGGAGGAGG + Intronic
1144153311 17:12472416-12472438 GGGGAAGTGGAGTTAAGGGTGGG + Intergenic
1144707523 17:17379471-17379493 GGGGATGGGGAGTGGAGAGAGGG - Intergenic
1146127403 17:30239778-30239800 GGTGATGGGGTGCTAGGAGGAGG - Intergenic
1146953283 17:36921211-36921233 GGTTCTGGGGAGTTGAGTGTGGG - Intergenic
1147732552 17:42613097-42613119 GGGTATGGGGTGTTGAGAGTTGG - Intronic
1147994327 17:44352900-44352922 GGTGATGGGGAGCTCAGAATGGG - Exonic
1148065122 17:44863540-44863562 GGGGATGGGGAGGCAAGGGTGGG + Intronic
1148336244 17:46843240-46843262 AGTGTTGGGGACTTAAGAATAGG - Intronic
1152922875 17:83074477-83074499 GGTGATGAGCAGTCAAGTGTGGG + Intergenic
1153101334 18:1473340-1473362 GGAGATGAGGTCTTAAGAGTGGG - Intergenic
1156353820 18:36323637-36323659 GAAGGTGGGGAGTTAAGAGCAGG + Intronic
1156490601 18:37493661-37493683 GGTGATGGGGACTGCAGAGGTGG + Intronic
1157743637 18:50115713-50115735 GGTAATGGGGATTTAAATGTTGG - Intronic
1159923397 18:74246759-74246781 GGGGATGGGGAGATAACAGGGGG - Intergenic
1161027037 19:2041641-2041663 GGTTAGGGGGAGTACAGAGTAGG + Intronic
1161762355 19:6183408-6183430 GGTCATGCGGAGTTAGGACTTGG - Intronic
1162558152 19:11400343-11400365 GGGGATGGAGAGATAAGAGTTGG + Intronic
1166094081 19:40529016-40529038 GGGGATGGGGAGATAAGGGCTGG - Intronic
1168609768 19:57789865-57789887 GGTGTGGGGGAGTTAGGTGTTGG + Intronic
927168992 2:20352375-20352397 GGTGATGGGGAGCAATGAGATGG - Intergenic
929415488 2:41743036-41743058 GGGGAAGGGGAGGTAAGAGTAGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931176277 2:59858215-59858237 CGGGCTGGGGAGTTAAGGGTGGG - Intergenic
931406852 2:61987899-61987921 GGAGAAGGGGAGGAAAGAGTGGG - Intronic
932125585 2:69142838-69142860 GGTGCTGGAGAGATAAGAGAGGG + Intronic
933862879 2:86487644-86487666 GGTGATGGGGAGTTAAGAGTGGG - Intronic
934102702 2:88668051-88668073 GGTGAGGGGAAAGTAAGAGTGGG - Intergenic
934122582 2:88854554-88854576 GGTGGTGGGGAAAGAAGAGTAGG - Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
937869624 2:126777889-126777911 GGGGATGGGCAGTTAAGAGAGGG - Intergenic
938983155 2:136545951-136545973 GGAGTTGGGGACTTGAGAGTGGG + Intergenic
939166432 2:138645928-138645950 GGAGATGGGGAGCTCATAGTGGG + Intergenic
940008290 2:149029840-149029862 GTGGATGGGAAGTTGAGAGTCGG - Intergenic
941341318 2:164308654-164308676 GGTAGTGGGGAGTTGGGAGTCGG + Intergenic
941426796 2:165356808-165356830 AGTGATGTGGGGTTTAGAGTAGG + Intronic
941967614 2:171315005-171315027 GGTGATGAGGAATCCAGAGTTGG - Intergenic
944057908 2:195542722-195542744 TGTGATGGGAAGGGAAGAGTGGG - Intergenic
946243310 2:218370214-218370236 AGTGATGGAGAGTTGAGGGTGGG + Intergenic
947354226 2:229275521-229275543 GGATATGAGGAGTCAAGAGTAGG - Intergenic
948364129 2:237443564-237443586 GGAGATGGGGAGTTGGGAGTTGG + Intergenic
1171343071 20:24445615-24445637 GGGGATGGGGAGTTGGGAGGGGG - Intergenic
1172202105 20:33133658-33133680 GGTGATGAGGAGGAAAGAGTTGG + Intergenic
1172433307 20:34910700-34910722 GGTGATTGGGAGATAGGAGTGGG + Intronic
1172460120 20:35111461-35111483 GGTTATGGGGAATTATGTGTAGG + Intergenic
1173706826 20:45116062-45116084 GGTGATGGGGAGGCCACAGTGGG - Intergenic
1173825131 20:46043323-46043345 GGTGAAGGGGAGCTCAGAGAGGG + Exonic
1173994442 20:47326992-47327014 GGGGATGGGGAGTTACGGGAGGG + Intronic
1174078455 20:47954411-47954433 GGAGTTGGGGGATTAAGAGTTGG - Intergenic
1175264053 20:57691996-57692018 GGTGATGGGATGTGAAAAGTTGG - Intronic
1178527704 21:33346215-33346237 GGTTATGGGGAGAAAAGAGATGG + Intronic
1181054432 22:20253444-20253466 GGTGATGCAGAGTGAGGAGTGGG + Intronic
1181541743 22:23576895-23576917 GGTGAGGGGGAGGGAAGAATGGG - Intronic
1182363765 22:29764218-29764240 GCTGATGGGAAGTTCAGAGGAGG - Intronic
1182497972 22:30724034-30724056 GGGGATGGGGAGTGATGAATAGG - Intronic
1182706296 22:32282701-32282723 GGAGATGAGGAGTTCAGTGTTGG - Intergenic
1183747300 22:39699033-39699055 GGTGATGGGGAGTGATGAGGAGG - Intergenic
1183747337 22:39699193-39699215 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1183747349 22:39699226-39699248 GGTGATGGGGAGTGATGGGGAGG - Intergenic
1183756394 22:39770271-39770293 GGAGATGGGAAGGTTAGAGTAGG + Intronic
1183971597 22:41481618-41481640 GGTTGTGGGGAGTTCTGAGTGGG + Intronic
1185036007 22:48477258-48477280 GGTGATGGGGTGTGTGGAGTGGG - Intergenic
950173316 3:10854019-10854041 GGTGATGGGGAGTTACTGGTGGG - Intronic
950366172 3:12485634-12485656 GGGCATGAGGAGTTAAGGGTAGG + Intronic
950475030 3:13209708-13209730 GGAGCTGTGGACTTAAGAGTTGG - Intergenic
951025622 3:17825600-17825622 GAGGATGGAGAGTTTAGAGTTGG + Intronic
951998366 3:28756580-28756602 CGTGGTGGGAAGTTAAGAGTGGG + Intergenic
952345862 3:32484827-32484849 GGAGATAGGGAGTTTAGATTTGG - Intronic
953291446 3:41667891-41667913 GGTAATGAAGAATTAAGAGTTGG - Intronic
953373083 3:42406574-42406596 GGTGTTGGGGAGTTGAGAGGAGG - Intronic
954355122 3:50078418-50078440 AGAGATGGGGAGTGAGGAGTGGG + Intronic
954817154 3:53291764-53291786 GGAGATAGGGAGTTAAGCTTTGG + Intronic
958870388 3:99551718-99551740 GGTGAGGAGGAGTGAAGAGGAGG + Intergenic
960271982 3:115684714-115684736 GGTTGAGGAGAGTTAAGAGTTGG + Intronic
961042642 3:123688218-123688240 GTTGAGGGGGAGGTCAGAGTTGG - Intronic
963833138 3:150030157-150030179 GGCGATGGGGAGTTACGAGAGGG + Intronic
964603307 3:158528549-158528571 GGTTATGGGGTGTTTAGAGATGG + Intronic
966943571 3:184761907-184761929 CGGGATGGGGAGCTGAGAGTGGG - Intergenic
967186203 3:186946803-186946825 GTTCCTGGGGAGTGAAGAGTGGG + Intronic
968163684 3:196447537-196447559 GGTGATGGGGGGTGAGGAGAGGG - Intergenic
969206646 4:5652204-5652226 GGTGATGAGGTGGTAAGAGGTGG + Intronic
969278713 4:6154727-6154749 GGGGGTGGGGAGTTAGGAGTGGG - Intronic
969462868 4:7337986-7338008 GGTGATGGGGATGCAACAGTAGG - Intronic
969474878 4:7416161-7416183 GGTGATGGGGAGTTAGGCCTGGG + Intronic
969627175 4:8311606-8311628 GGTTCTGGGGAGTCAAGACTTGG + Intergenic
970484180 4:16507771-16507793 GGGGCTGGGGAGTTAGGAGATGG + Intronic
970587013 4:17523873-17523895 GGTGTTGGGGAGGTGAGAGGAGG - Intronic
971273082 4:25170098-25170120 GGTGGTGGGGAGTGGAGAGGGGG - Intronic
971926604 4:33017887-33017909 GGTGATGGGTAATTAAGACCTGG - Intergenic
973151768 4:46897257-46897279 GGTGGTGGGGAGAAAGGAGTTGG - Intronic
973650127 4:52991018-52991040 TGTGATGAGGAGTAGAGAGTAGG + Intronic
975455459 4:74585112-74585134 GGGGATGGGGAGAGAAGAGAGGG + Intergenic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
979600035 4:122577359-122577381 GATGATGGGGAGTACAGGGTAGG - Intergenic
980288550 4:130813590-130813612 TGTGATGGAGAGTCAAGAATAGG - Intergenic
981759218 4:148174798-148174820 GGTATTGGGAAGTCAAGAGTGGG - Intronic
983490102 4:168378977-168378999 CGTTATGGGGAGTGGAGAGTAGG - Intronic
984578028 4:181474165-181474187 GGGGATGGGGAGTTAGGGGAGGG + Intergenic
984932175 4:184857772-184857794 GGTGATGGGAAGTAAGGAGGAGG + Intergenic
985792412 5:1937294-1937316 AGAGATGGGGAGTTGAGAGCAGG - Intergenic
988352131 5:30122333-30122355 AGTGATAGGGAGATAAGAATAGG + Intergenic
989232899 5:39106152-39106174 GGTAATTGGTAGTGAAGAGTTGG + Intronic
989430370 5:41347741-41347763 GTTGATCTGGTGTTAAGAGTAGG - Intronic
989492453 5:42073577-42073599 GGTGAAGAGCAGTTAAGAGGAGG + Intergenic
992205628 5:74427819-74427841 GGTTAAGGGGAGTAAGGAGTTGG + Intergenic
992804444 5:80323270-80323292 GGTGCAGAGGAGGTAAGAGTAGG + Intergenic
995478537 5:112572212-112572234 GGTGTTGGTAAGTCAAGAGTTGG - Intergenic
995544058 5:113212703-113212725 GGTGTTGGGGAGTGAATAGAAGG - Intronic
997570185 5:134921371-134921393 GGAGAAGGGGAGTTTTGAGTTGG + Intronic
998005822 5:138656277-138656299 GGTGATGGGGAGTCAAGAAGAGG - Intronic
998824200 5:146084396-146084418 GGTGTTGGGGAGTAAGGAGGAGG + Exonic
999101853 5:149031942-149031964 GGAGATGGGGTTTTAAGAGAAGG - Intronic
999627227 5:153533522-153533544 GGTGAAGGGGTTTAAAGAGTGGG - Intronic
1001834783 5:174822709-174822731 AGTGAGGGGAAGTTAAGAGAAGG + Intergenic
1004594598 6:17087074-17087096 GGGGAAGGGGAGTAAAGGGTTGG - Intergenic
1007953810 6:45897731-45897753 AGTGATGTGGTGTTGAGAGTAGG + Intergenic
1008514440 6:52306459-52306481 GGGGATGGCGATTTAAGAGGAGG - Intergenic
1008982054 6:57495712-57495734 GGTTATGGGGAGTGGAGTGTAGG - Intronic
1009805675 6:68599021-68599043 GGTGATGGGGAGTGAATGGAAGG + Intergenic
1011992056 6:93534127-93534149 GGTGATGGGGAGCAAAGGGAGGG - Intergenic
1014080720 6:117283139-117283161 GGGGATGGGAAGGTAAGACTGGG - Intergenic
1014896794 6:126911061-126911083 GGTGATTGGGAGTTATGAAATGG - Intergenic
1017685917 6:156913873-156913895 GTTGCTGGGAAGTGAAGAGTGGG - Intronic
1019500814 7:1363994-1364016 GGAGATGGGGAGTGAGGAGTGGG - Intergenic
1021897909 7:25255032-25255054 GGTGATGGGGAGAAATGAGATGG - Intergenic
1022032118 7:26501640-26501662 GGGCATGGGGAATCAAGAGTGGG - Intergenic
1022360710 7:29654307-29654329 GGAGCTGGGGAGAGAAGAGTGGG - Intergenic
1022412332 7:30148776-30148798 GGTGGTGGGGAGTTTGGGGTTGG + Intronic
1026146990 7:67755095-67755117 TGTGATGGGGAGTTCAGAAGTGG + Intergenic
1029492780 7:100881508-100881530 GGTGATGGGAAGTTGAGAAAAGG - Intronic
1029901902 7:104049930-104049952 GGTGATGGAGAGTTAAAATGTGG + Intergenic
1030267959 7:107640095-107640117 AGAGATGGGGAATAAAGAGTTGG - Intergenic
1030735838 7:113047655-113047677 GATGGTGGGGAGTGAGGAGTGGG - Intergenic
1030987463 7:116259368-116259390 GGTGGTGGGGAGTGGAGAGGTGG - Intergenic
1032824645 7:135557267-135557289 GGTGTTGGGGTGGTAAGGGTGGG + Intergenic
1036579834 8:10063564-10063586 GGTGATGGGGGATTAGGAGGTGG + Intronic
1036605725 8:10303736-10303758 GATGATGGTTAGTTAAGGGTAGG + Intronic
1037046333 8:14309044-14309066 GTAGTTGGGGAATTAAGAGTAGG - Intronic
1038096616 8:24319052-24319074 AGAGACGGGGAGTAAAGAGTAGG - Intronic
1039274799 8:35923587-35923609 GATGGTGGGGAGTGAAGAATTGG + Intergenic
1039371066 8:36984338-36984360 GGTGACAGGGAGTTAAGTGATGG + Intergenic
1040103557 8:43525763-43525785 GGTGGTGGGGAGTGAAATGTGGG + Intergenic
1041843240 8:62296250-62296272 GGTGAGGGAGAGTGAAAAGTAGG + Intronic
1042387564 8:68195067-68195089 ATTAATGTGGAGTTAAGAGTAGG - Intronic
1043981487 8:86646056-86646078 AGAGATGGGGAATGAAGAGTTGG + Intronic
1044945695 8:97386867-97386889 TGAGATGTGGAGTTAAGAATGGG - Intergenic
1045905504 8:107339972-107339994 GGTGATGGGGAAAGAAGAGGAGG - Intronic
1047888645 8:129281592-129281614 GGTGAGGTGGATTTCAGAGTTGG + Intergenic
1048074267 8:131052088-131052110 GGGGATGGGGGGATAAAAGTTGG + Intergenic
1048221128 8:132543188-132543210 GGAGGTGGGGAGTTCAGTGTTGG - Intergenic
1048329938 8:133464591-133464613 AGTGATAGGGAGAGAAGAGTTGG + Intronic
1049445046 8:142626187-142626209 GGTTATGGGGAGGTGACAGTGGG - Intergenic
1049445094 8:142626401-142626423 GGTTATGGGGTGTTGACAGTGGG - Intergenic
1050020448 9:1279352-1279374 GATGATGGGAAGTTAGGGGTAGG - Intergenic
1053021242 9:34695774-34695796 GGTGAGAGGGAGTAGAGAGTAGG + Intergenic
1054723829 9:68630278-68630300 GGTGATGGGGACCAAAGAGGAGG + Intergenic
1056235997 9:84595156-84595178 GGTGATGAGGAAGTAAGAATAGG + Intergenic
1058188201 9:101880758-101880780 AGTGATGGGGAGGTAGGAGATGG + Intergenic
1060450313 9:123732500-123732522 GGAGAAGAGGGGTTAAGAGTAGG + Intronic
1062006517 9:134240974-134240996 GGTGATGGGTGGTTAAGTTTGGG - Intergenic
1186203371 X:7176455-7176477 GCTGATGGGGTGTAAAGGGTTGG - Intergenic
1189239524 X:39515017-39515039 GGGGATGGGGAGCTGCGAGTGGG - Intergenic
1190154028 X:47973262-47973284 GGTGATGGGGAGTTGGGTGGAGG - Intronic
1192556086 X:72090659-72090681 GGGGATGGGGGGTTAGGGGTAGG - Intergenic
1196644819 X:118106247-118106269 TGTGAGGTGGAGCTAAGAGTAGG - Intronic
1200057553 X:153469703-153469725 GGAGATGTGGGGTTAAGAATGGG - Intronic